Home |
Help |
Advanced search
2024-04-20 08:26:39, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001277764 1104 bp mRNA linear PRI 01-JUN-2013
DEFINITION Homo sapiens calcium and integrin binding 1 (calmyrin) (CIB1),
transcript variant a, mRNA.
ACCESSION NM_001277764
VERSION NM_001277764.1 GI:480540324
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1104)
AUTHORS Armacki,M., Joodi,G., Nimmagadda,S.C., de Kimpe,L., Pusapati,G.V.,
Vandoninck,S., Van Lint,J., Illing,A. and Seufferlein,T.
TITLE A novel splice variant of calcium and integrin-binding protein 1
mediates protein kinase D2-stimulated tumour growth by regulating
angiogenesis
JOURNAL Oncogene (2013) In press
PUBMED 23503467
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 1104)
AUTHORS Zhao,F., Zhang,S., Chen,L., Wu,Y., Qin,J., Shao,Y., Wang,X. and
Chen,Y.
TITLE Calcium- and integrin-binding protein-1 and calcineurin are
upregulated in the right atrial myocardium of patients with atrial
fibrillation
JOURNAL Europace 14 (12), 1726-1733 (2012)
PUBMED 22547769
REMARK GeneRIF: The CIB1 and calcineurin expression was increased in AF
atrial tissue and was related to the type of AF. This finding
suggests that CIB1 may be involved in the pathogenesis of AF in VHD
patients.
REFERENCE 3 (bases 1 to 1104)
AUTHORS Huang,H., Bogstie,J.N. and Vogel,H.J.
TITLE Biophysical and structural studies of the human calcium- and
integrin-binding protein family: understanding their functional
similarities and differences
JOURNAL Biochem. Cell Biol. 90 (5), 646-656 (2012)
PUBMED 22779914
REFERENCE 4 (bases 1 to 1104)
AUTHORS Leisner,T.M., Moran,C., Holly,S.P. and Parise,L.V.
TITLE CIB1 prevents nuclear GAPDH accumulation and non-apoptotic tumor
cell death via AKT and ERK signaling
JOURNAL Oncogene (2012) In press
PUBMED 22964641
REMARK Publication Status: Available-Online prior to print
REFERENCE 5 (bases 1 to 1104)
AUTHORS Naik,M.U. and Naik,U.P.
TITLE Contra-regulation of calcium- and integrin-binding protein
1-induced cell migration on fibronectin by PAK1 and MAP kinase
signaling
JOURNAL J. Cell. Biochem. 112 (11), 3289-3299 (2011)
PUBMED 21748785
REMARK GeneRIF: results suggest that CIB1 positively regulates cell
migration and is necessary for the recruitment of FAK to the focal
adhesions. Furthermore, CIB1-induced cell migration is dependent on
MAP kinase signaling and its function is attenuated by PAK1
REFERENCE 6 (bases 1 to 1104)
AUTHORS Junrong,T., Huancheng,Z., Feng,H., Yi,G., Xiaoqin,Y., Zhengmao,L.,
Hong,Z., Jianying,Z., Yin,W., Yuanhang,H., Jianlin,Z., Longhua,S.
and Guolin,H.
TITLE Proteomic identification of CIB1 as a potential diagnostic factor
in hepatocellular carcinoma
JOURNAL J. Biosci. 36 (4), 659-668 (2011)
PUBMED 21857112
REMARK GeneRIF: CIB1 may be used as a novel prognostic factor and possibly
an attractive therapeutic target for hepatocellular carcinoma.
REFERENCE 7 (bases 1 to 1104)
AUTHORS Stabler,S.M., Ostrowski,L.L., Janicki,S.M. and Monteiro,M.J.
TITLE A myristoylated calcium-binding protein that preferentially
interacts with the Alzheimer's disease presenilin 2 protein
JOURNAL J. Cell Biol. 145 (6), 1277-1292 (1999)
PUBMED 10366599
REFERENCE 8 (bases 1 to 1104)
AUTHORS Seki,N., Hayashi,A., Abe,M., Araki,R., Fujimori,A., Fukumura,R.,
Hattori,A., Kozuma,S., Ohhira,M., Hori,T. and Saito,T.
TITLE Chromosomal assignment of the gene for human DNA-PKcs interacting
protein (KIP) on chromosome 15q25.3-q26.1 by somatic hybrid
analysis and fluorescence in situ hybridization
JOURNAL J. Hum. Genet. 43 (4), 275-277 (1998)
PUBMED 9852683
REFERENCE 9 (bases 1 to 1104)
AUTHORS Wu,X. and Lieber,M.R.
TITLE Interaction between DNA-dependent protein kinase and a novel
protein, KIP
JOURNAL Mutat. Res. 385 (1), 13-20 (1997)
PUBMED 9372844
REFERENCE 10 (bases 1 to 1104)
AUTHORS Naik,U.P., Patel,P.M. and Parise,L.V.
TITLE Identification of a novel calcium-binding protein that interacts
with the integrin alphaIIb cytoplasmic domain
JOURNAL J. Biol. Chem. 272 (8), 4651-4654 (1997)
PUBMED 9030514
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CD622547.1, JQ246073.1 and
BG231771.1.
Summary: This gene encodes a member of the EF-hand
domain-containing calcium-binding superfamily. The encoded protein
interacts with many other proteins, including the platelet integrin
alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal
adhesion kinase, p21 activated kinase, and protein kinase D. The
encoded protein may be involved in cell survival and proliferation,
and is associated with several disease states including cancer and
Alzheimer's disease. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Apr 2013].
Transcript Variant: This variant (a) represents the longest
transcript and encodes the longer isoform (a, also known as CIB1a).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BU944719.1, JQ246073.1 [ECO:0000332]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-162 CD622547.1 8-169
163-793 JQ246073.1 1-631
794-1104 BG231771.1 1-311 c
FEATURES Location/Qualifiers
source 1..1104
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="15"
/map="15q25.3-q26"
gene 1..1104
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="calcium and integrin binding 1 (calmyrin)"
/db_xref="GeneID:10519"
/db_xref="HGNC:16920"
/db_xref="MIM:602293"
exon 1..213
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
misc_feature 106..108
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="upstream in-frame stop codon"
CDS 163..858
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="isoform a is encoded by transcript variant a;
DNA-dependent protein kinase interacting protein;
DNA-PKcs-interacting protein; SNK-interacting protein
2-28; DNA-PK interaction protein"
/codon_start=1
/product="calcium and integrin-binding protein 1 isoform
a"
/protein_id="NP_001264693.1"
/db_xref="GI:480540325"
/db_xref="GeneID:10519"
/db_xref="HGNC:16920"
/db_xref="MIM:602293"
/translation="
MGGSGSRLSKELLAEYQDLTFLTKQEILLSVYVVLAPHLVDNEQQARSGNEHTGRPIAENTDSSPLSTRAHRRFCELLPQEQRSVESSLRAQVPFEQILSLPELKANPFKERICRVFSTSPAKDSLSFEDFLDLLSVFSDTATPDIKSHYAFRIFDFDDDGTLNREDLSRLVNCLTGEGEDTRLSASEMKQLIDNILEESDIDRDGTINLSEFQHVISRSPDFASSFKIVL
"
misc_feature 613..816
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="EF-hand, calcium binding motif; A diverse
superfamily of calcium sensors and calcium signal
modulators; most examples in this alignment model have 2
active canonical EF hands. Ca2+ binding induces a
conformational change in the EF-hand motif, leading to...;
Region: EFh; cd00051"
/db_xref="CDD:238008"
misc_feature 619..813
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="EF-hand domain pair; Region: EF_hand_5; pfam13499"
/db_xref="CDD:222177"
misc_feature order(628..630,634..636,640..642,661..663,763..765,
769..771,775..777,796..798)
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238008"
exon 214..248
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
exon 249..477
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
variation 285
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="t"
/db_xref="dbSNP:4451921"
variation 413
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="g"
/db_xref="dbSNP:3210935"
variation 414
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="t"
/db_xref="dbSNP:1127801"
variation 444
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="t"
/db_xref="dbSNP:1139752"
exon 478..628
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
variation 524
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="a"
/replace="c"
/db_xref="dbSNP:1139757"
variation 551
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="a"
/replace="g"
/db_xref="dbSNP:1804798"
STS 600..668
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/standard_name="CIB1"
/db_xref="UniSTS:503072"
exon 629..747
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
exon 748..836
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
variation 765
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="t"
/db_xref="dbSNP:11551248"
exon 837..1097
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/inference="alignment:Splign:1.39.8"
variation 877
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804804"
polyA_signal 1072..1077
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
polyA_site 1097
/gene="CIB1"
/gene_synonym="CIB; CIBP; KIP1; PRKDCIP; SIP2-28"
ORIGIN
ggctgggaacgcctggcagcttttaggagggggcgggcccgggggtggtggccccaggagcggttgccgcggggaccgggcagtgacgcggcccaagggcggaagtgagaaagttgtctgcgtctcgaggcgagttggcggagctgtgcgcgcggcggggcgatggggggctcgggcagtcgcctgtccaaggagctgctggccgagtaccaggacttgacgttcctgacgaagcaggagatcctcctttctgtgtacgtggttttagctcctcacctggttgacaatgagcagcaggcaaggagtgggaatgaacacacagggagaccgatcgctgagaacaccgacagttcccctctctctaccagagcccacaggcggttttgtgagctgcttccccaggagcagcggagcgtggagtcgtcacttcgggcacaagtgcccttcgagcagattctcagccttccagagctcaaggccaaccccttcaaggagcgaatctgcagggtcttctccacatccccagccaaagacagccttagctttgaggacttcctggatctcctcagtgtgttcagtgacacagccacgccagacatcaagtcccattatgccttccgcatctttgactttgatgatgacggaaccttgaacagagaagacctgagccggctggtgaactgcctcacgggagagggcgaggacacacggcttagtgcgtctgagatgaagcagctcatcgacaacatcctggaggagtctgacattgacagggatggaaccatcaacctctctgagttccagcacgtcatctcccgttctccagactttgccagctcctttaagattgtcctgtgacagcagccccagcgtgtgtcctggcaccctgtccaagaacctttctactgctgagctgtggccaaggtcaagcctgtgttgccagtgcgggccaagctggcccagcctggagctggcgctgtgcagcctcaccccgggcaggggcggccctcgttgtcagggcctctcctcactgctgttgtcattgctccgtttgtgtttgtactaatcagtaataaaggtttagaagtttgaccctaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10519 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IMP
GeneID:10519 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:10519 -> Molecular function: GO:0043495 [protein anchor] evidence: IGI
GeneID:10519 -> Molecular function: GO:0044325 [ion channel binding] evidence: IEA
GeneID:10519 -> Biological process: GO:0006302 [double-strand break repair] evidence: TAS
GeneID:10519 -> Biological process: GO:0006915 [apoptotic process] evidence: IMP
GeneID:10519 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
GeneID:10519 -> Biological process: GO:0007113 [endomitotic cell cycle] evidence: IDA
GeneID:10519 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
GeneID:10519 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IMP
GeneID:10519 -> Biological process: GO:0070886 [positive regulation of calcineurin-NFAT signaling cascade] evidence: IDA
GeneID:10519 -> Biological process: GO:0090004 [positive regulation of establishment of protein localization to plasma membrane] evidence: IGI
GeneID:10519 -> Biological process: GO:0097191 [extrinsic apoptotic signaling pathway] evidence: TAS
GeneID:10519 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IMP
GeneID:10519 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:10519 -> Cellular component: GO:0005737 [cytoplasm] evidence: IMP
GeneID:10519 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IMP
GeneID:10519 -> Cellular component: GO:0016020 [membrane] evidence: IDA
GeneID:10519 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
GeneID:10519 -> Cellular component: GO:0030175 [filopodium] evidence: IEA
GeneID:10519 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.