GGRNA Home | Help | Advanced search

2020-10-26 19:04:53, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001277335            2794 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens RAS p21 protein activator 4B (RASA4B), mRNA.
ACCESSION   NM_001277335 XM_003118598 XM_003118599 XM_003118600 XM_003119053
            XM_003119054 XM_003119055 XM_003959919 XM_003960009
VERSION     NM_001277335.1  GI:472824973
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2794)
  AUTHORS   Lockyer,P.J., Kupzig,S. and Cullen,P.J.
  TITLE     CAPRI regulates Ca(2+)-dependent inactivation of the Ras-MAPK
            pathway
  JOURNAL   Curr. Biol. 11 (12), 981-986 (2001)
   PUBMED   11448776
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC093668.4.
            On or before Apr 3, 2013 this sequence version replaced
            gi:410170527, gi:310120064, gi:310120066, gi:410170525,
            gi:310118383, gi:310118385, gi:410170364, gi:410170366.
            
            CCDS Note: The exon combination of this transcript is based on the
            paralogous transcript alignment AK026441.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-132               AC093668.4         131596-131727       c
            133-189             AC093668.4         125875-125931       c
            190-303             AC093668.4         124129-124242       c
            304-365             AC093668.4         123549-123610       c
            366-495             AC093668.4         120645-120774       c
            496-577             AC093668.4         117113-117194       c
            578-709             AC093668.4         115046-115177       c
            710-804             AC093668.4         114649-114743       c
            805-922             AC093668.4         110797-110914       c
            923-1073            AC093668.4         110419-110569       c
            1074-1138           AC093668.4         110090-110154       c
            1139-1251           AC093668.4         109228-109340       c
            1252-1444           AC093668.4         108831-109023       c
            1445-1582           AC093668.4         108488-108625       c
            1583-1727           AC093668.4         107775-107919       c
            1728-1897           AC093668.4         107066-107235       c
            1898-2033           AC093668.4         102413-102548       c
            2034-2154           AC093668.4         98989-99109         c
            2155-2219           AC093668.4         97775-97839         c
            2220-2794           AC093668.4         97089-97663         c
FEATURES             Location/Qualifiers
     source          1..2794
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q22.1"
     gene            1..2794
                     /gene="RASA4B"
                     /note="RAS p21 protein activator 4B"
                     /db_xref="GeneID:100271927"
                     /db_xref="HGNC:35202"
     exon            1..132
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     CDS             68..2341
                     /gene="RASA4B"
                     /codon_start=1
                     /product="putative Ras GTPase-activating protein 4B"
                     /protein_id="NP_001264264.1"
                     /db_xref="GI:472824974"
                     /db_xref="CCDS:CCDS59506.1"
                     /db_xref="GeneID:100271927"
                     /db_xref="HGNC:35202"
                     /translation="
MAKRSSLYIRIVEGKNLPAKDITGSSDPYCIVKVDNEPIIRTATVWKTLCPFWGEEYQVHLPPTFHAVAFYVMDEDALSRDDVIGKVCLTRDTIASHPKGFSGWAHLTEVDPDEEVQGEIHLRLEVWPGARACRLRCSVLEARDLAPKDRNGTSDPFVRVRYKGRTRETSIVKKSCYPRWNETFEFELQEGAMEALCVEAWDWDLVSRNDFLGKVVIDVQRLRVVQQEEGWFRLQPDQSKSRRHDEGNLGSLQLEVRLRDETVLPSSYYQPLVHLLCHEVKLGMQGPGQLIPLIEETTSTECRQDVATNLLKLFLGQGLAKDFLDLLFQLELSRTSETNTLFRSNSLASKSVESFLKVAGMQYLHGVLGPIINKVFEEKKYVELDPSKVEVKDVGCSGLHRPQTEAEVLEQSAQTLRAHLGALLSALSRSVRACPAVVRATFRQLFRRVRERFPGAQHENVPFIAVTSFLCLRFFSPAIMSPKLFHLRERHADARTSRTLLLLAKAVQNVGNMDTPASRAKEAWMEPLQPTVHQGVAQLKDFITKLVDIEEKDELDLQRTLSLQAPPVKEGPLFIHRTKGKGPLMSSSFKKLYFSLTTEALSFAKTPSSKCVNELNQWLSALRKVSINNTGLLGSYHPGVFRGDKWSCCHQKEKTGQGCDKTRSRVTLQEWNDPLDHDLEAQLIYRHLLGVEAMLWERHRELSGGAEAGTVPTSPGKVPEDSLARLLRVLQDLREAHSSSPAGSPPSEPNCLLELQT
"
     misc_feature    83..445
                     /gene="RASA4B"
                     /note="C2 domain first repeat present in RasA1 and RasA4;
                     Region: C2A_Rasal1_RasA4; cd04054"
                     /db_xref="CDD:176018"
     misc_feature    order(128..130,146..148,287..289,293..295,311..313)
                     /gene="RASA4B"
                     /note="Ca2+ binding pocket [ion binding]; other site"
                     /db_xref="CDD:176018"
     misc_feature    467..838
                     /gene="RASA4B"
                     /note="C2 domain second repeat present in RasA1 and RasA4;
                     Region: C2B_RasA1_RasA4; cd04025"
                     /db_xref="CDD:175991"
     misc_feature    order(512..514,530..532,671..673,677..679,695..697)
                     /gene="RASA4B"
                     /note="Ca2+ binding pocket [ion binding]; other site"
                     /db_xref="CDD:175991"
     misc_feature    860..1717
                     /gene="RASA4B"
                     /note="Ras-GTPase Activating Domain of RASA4; Region:
                     RasGAP_RASA4; cd05395"
                     /db_xref="CDD:213343"
     misc_feature    order(974..976,1082..1084,1088..1090,1094..1099,
                     1103..1105,1112..1114,1124..1126,1457..1459,1481..1486,
                     1493..1498,1505..1507,1568..1570,1577..1582,1589..1591,
                     1601..1603,1607..1609,1628..1633)
                     /gene="RASA4B"
                     /note="putative RAS interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:213343"
     misc_feature    1691..1972
                     /gene="RASA4B"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl17171"
                     /db_xref="CDD:247725"
     misc_feature    <1904..2059
                     /gene="RASA4B"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl17171"
                     /db_xref="CDD:247725"
     exon            133..189
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            190..303
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            304..365
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            366..495
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            496..577
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            578..709
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            710..804
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            805..922
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            923..1073
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1074..1138
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     variation       1121
                     /gene="RASA4B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746316"
     exon            1139..1251
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1252..1444
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1445..1582
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1583..1727
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1728..1897
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            1898..2033
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            2034..2154
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            2155..2219
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
     exon            2220..2794
                     /gene="RASA4B"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
agtccagcgcccgccgcccgccaccccggaccccggtgtctggcttcccccgagccggcaccccgcgatggccaagcgcagctcgctgtacatccgcatcgtggaggggaagaaccttcccgccaaggacatcactggcagcagcgacccctactgcatcgtgaaggtggacaatgagcccatcatcaggacagccacagtgtggaagaccctgtgccccttctggggtgaggagtaccaagtgcacctgccgcccaccttccacgctgtggctttctatgtcatggatgaggatgccctcagccgggacgacgttatcggaaaggtctgccttacaagggacaccatagcctctcaccctaagggtttcagcgggtgggcccacctgacagaggtcgaccccgacgaggaggtgcagggcgagatccacctgcggctggaagtgtggccaggggcccgggcctgccggctacgctgctctgtgctggaggccagggatctggccccaaaggaccgcaatggcacatctgaccccttcgtccgagtgcgctacaagggccggacacgggagacctcgatcgtgaagaagtcatgctacccacgctggaatgagacgtttgaatttgagctgcaggagggggccatggaggcgctgtgcgtggaggcctgggactgggaccttgtcagccgaaacgacttcctgggcaaagtggtgattgatgtccagagactgcgggtggtgcagcaggaggagggctggttccggctgcagcccgaccagtccaagagccggcggcatgacgagggcaacctgggctccttgcagctggaggtgcggctgcgggacgagacggtgctgccctccagctactaccagccactggtgcacctgctgtgccacgaggtcaagctgggcatgcagggcccagggcagctgatcccactcatcgaggagacaaccagcaccgagtgtcgccaggacgtggccacgaacctgctcaagctcttcctggggcaggggctggccaaggacttcctggacctgctcttccagctggagctgagtcgcaccagtgagaccaacaccctgttccggagcaactctctggcctcaaagtccgtggagtcttttctgaaggtggccgggatgcagtacctgcacggcgtcctgggccccatcatcaacaaggtgtttgaggagaagaagtacgtggagctggaccccagcaaagtggaagttaaggatgtagggtgctccgggctgcaccgcccgcagaccgaggccgaggtgctggagcagagcgcgcagacgctgcgcgcccacctgggggccctgctgagcgcgctcagccgctcggttcgcgcgtgccccgccgtggtgcgcgccaccttccgccagctcttccggcgcgtgcgcgagcgcttccccggcgcccagcacgagaatgtaccgttcatcgccgtcaccagcttcctgtgcctgcgcttcttctctcccgccatcatgtcgcccaagctcttccacctgcgggagcgccacgcggacgcccgcaccagccgcaccctgctcctgttggccaaggcagtccagaacgtgggcaacatggacacgccggcttccagggccaaggaggcttggatggagccgctgcagcccaccgtgcaccagggcgtggcgcagctgaaggacttcatcaccaagctcgtggacatcgaggagaaggacgagctggacctgcagcggacgctgagtttgcaggcgccacctgtgaaggaggggccactcttcatccacaggaccaagggcaagggccccctcatgtcctcctccttcaagaagctctacttctccctcactaccgaggccctcagcttcgcgaagacgcccagctccaagtgtgtgaatgagcttaaccagtggctgtctgcgctgcggaaggtgagcatcaacaacaccggactgctgggctcctaccaccctggcgtcttccgtggggacaagtggagctgctgccaccaaaaagagaagacaggtcagggctgcgataagacccggtcacgggtgaccctgcaggagtggaatgaccctcttgaccatgaccttgaggcccagctcatctaccggcacctgctgggcgtggaggccatgctgtgggagaggcaccgggagctgagcgggggcgcagaggcaggcacggtgcccacgagccctggcaaagtccccgaggactcattggcccggctgctccgggtgctgcaggacctccgcgaggcccatagctccagcccggccggctccccaccctcagagcccaactgcctcctggagctgcagacgtgaggcccgccctacgctccccttgctgagtcccctgccaagcgctcggagcccccccaggacactctgcaccccctcaccccggtcctcctcattagggtgcagggcctaggtctcttccaggtgggggaggggggagagtcaggaataaggggatccccagaagtgcagagctgagcaggcttgggcctgtcatggctggccggaagtgtccccagctccctacagacgctgtagccatcactgcctctccagggaccctcctctcctgcccaggacagacccagccagaaccactgctaggatgggccgcacccaggggtctggcctccagggacctagagaatgggagggagaacggggccccaggagacccggccgccaccccacccgctacccttgggtgccacagggctgtgctgttgccaacagtaaacctgctcttactgtccaggc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:100271927 -> Molecular function: GO:0005096 [GTPase activator activity] evidence: IEA
            GeneID:100271927 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
            GeneID:100271927 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:100271927 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: IEA
            GeneID:100271927 -> Biological process: GO:0051056 [regulation of small GTPase mediated signal transduction] evidence: IEA
            GeneID:100271927 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
            GeneID:100271927 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.