2024-03-29 20:50:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001276271 2338 bp mRNA linear PRI 14-MAY-2013 DEFINITION Homo sapiens methyl-CpG binding domain protein 4 (MBD4), transcript variant 3, mRNA. ACCESSION NM_001276271 VERSION NM_001276271.1 GI:442796451 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2338) AUTHORS Otani,J., Arita,K., Kato,T., Kinoshita,M., Kimura,H., Suetake,I., Tajima,S., Ariyoshi,M. and Shirakawa,M. TITLE Structural basis of the versatile DNA recognition ability of the methyl-CpG binding domain of methyl-CpG binding domain protein 4 JOURNAL J. Biol. Chem. 288 (9), 6351-6362 (2013) PUBMED 23316048 REMARK GeneRIF: the crystal structure of MBD4 bound to 5-hydroxymethylcytosine further demonstrates that MBDMBD4 is able to recognize a wide range of 5-methylcytosine modifications REFERENCE 2 (bases 1 to 2338) AUTHORS Xiong,X.D., Luo,X.P., Liu,X., Jing,X., Zeng,L.Q., Lei,M., Hong,X.S. and Chen,Y. TITLE The MBD4 Glu346Lys polymorphism is associated with the risk of cervical cancer in a Chinese population JOURNAL Int. J. Gynecol. Cancer 22 (9), 1552-1556 (2012) PUBMED 23027038 REMARK GeneRIF: MBD4 Glu346Lys polymorphism is associated with the risk of cervical cancer in a Chinese population. REFERENCE 3 (bases 1 to 2338) AUTHORS Morera,S., Grin,I., Vigouroux,A., Couve,S., Henriot,V., Saparbaev,M. and Ishchenko,A.A. TITLE Biochemical and structural characterization of the glycosylase domain of MBD4 bound to thymine and 5-hydroxymethyuracil-containing DNA JOURNAL Nucleic Acids Res. 40 (19), 9917-9926 (2012) PUBMED 22848106 REMARK GeneRIF: Crystal structures of human MBD4(catalytic domain) reveal that MBD4 uses a base flipping mechanism to specifically recognize thymine and 5-hydroxymethyluracil. REFERENCE 4 (bases 1 to 2338) AUTHORS Manvilla,B.A., Maiti,A., Begley,M.C., Toth,E.A. and Drohat,A.C. TITLE Crystal structure of human methyl-binding domain IV glycosylase bound to abasic DNA JOURNAL J. Mol. Biol. 420 (3), 164-175 (2012) PUBMED 22560993 REMARK GeneRIF: specificity of MBD4 for acting at CpG sites depends largely on its methyl-CpG-binding domain, which binds preferably to G.T mispairs in a methylated CpG site REFERENCE 5 (bases 1 to 2338) AUTHORS Lin,Y. and Li,W. TITLE MBD 4--a potential substrate for protein kinase X JOURNAL Acta Biochim. Biophys. Sin. (Shanghai) 43 (11), 916-917 (2011) PUBMED 21971312 REMARK GeneRIF: MBD 4--a potential substrate for protein kinase X REFERENCE 6 (bases 1 to 2338) AUTHORS Hendrich,B., Hardeland,U., Ng,H.H., Jiricny,J. and Bird,A. TITLE The thymine glycosylase MBD4 can bind to the product of deamination at methylated CpG sites JOURNAL Nature 401 (6750), 301-304 (1999) PUBMED 10499592 REMARK Erratum:[Nature 2000 Mar 30;404(6777):525] REFERENCE 7 (bases 1 to 2338) AUTHORS Hendrich,B., Abbott,C., McQueen,H., Chambers,D., Cross,S. and Bird,A. TITLE Genomic structure and chromosomal mapping of the murine and human Mbd1, Mbd2, Mbd3, and Mbd4 genes JOURNAL Mamm. Genome 10 (9), 906-912 (1999) PUBMED 10441743 REFERENCE 8 (bases 1 to 2338) AUTHORS Bellacosa,A., Cicchillitti,L., Schepis,F., Riccio,A., Yeung,A.T., Matsumoto,Y., Golemis,E.A., Genuardi,M. and Neri,G. TITLE MED1, a novel human methyl-CpG-binding endonuclease, interacts with DNA mismatch repair protein MLH1 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 96 (7), 3969-3974 (1999) PUBMED 10097147 REFERENCE 9 (bases 1 to 2338) AUTHORS Boland,C.R., Thibodeau,S.N., Hamilton,S.R., Sidransky,D., Eshleman,J.R., Burt,R.W., Meltzer,S.J., Rodriguez-Bigas,M.A., Fodde,R., Ranzani,G.N. and Srivastava,S. TITLE A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer JOURNAL Cancer Res. 58 (22), 5248-5257 (1998) PUBMED 9823339 REMARK Review article REFERENCE 10 (bases 1 to 2338) AUTHORS Hendrich,B. and Bird,A. TITLE Identification and characterization of a family of mammalian methyl-CpG binding proteins JOURNAL Mol. Cell. Biol. 18 (11), 6538-6547 (1998) PUBMED 9774669 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL449212.1. Summary: The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]. Transcript Variant: This variant (3) lacks an exon and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK303013.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-450 AL449212.1 59758-60207 c 451-681 AL449212.1 57748-57978 c 682-1547 AL449212.1 56471-57336 c 1548-1622 AL449212.1 54090-54164 c 1623-1757 AL449212.1 53878-54012 c 1758-1907 AL449212.1 53126-53275 c 1908-2338 AL449212.1 52204-52634 c FEATURES Location/Qualifiers source 1..2338 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3q21.3" gene 1..2338 /gene="MBD4" /gene_synonym="MED1" /note="methyl-CpG binding domain protein 4" /db_xref="GeneID:8930" /db_xref="HGNC:6919" /db_xref="MIM:603574" exon 1..450 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 55 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:3138334" variation 232 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="t" /db_xref="dbSNP:2307292" misc_feature 266..268 /gene="MBD4" /gene_synonym="MED1" /note="upstream in-frame stop codon" CDS 347..2065 /gene="MBD4" /gene_synonym="MED1" /note="isoform 3 is encoded by transcript variant 3; 3,N(4)-ethenocytosine glycosylase; G/T mismatch glycosylase; G/U mismatch glycosylase; G/5-fluorouracil mismatch glycosylase with biphasic kinetics; putative methyl-CpG binding protein; methyl-CpG-binding protein MBD4; methyl-CpG-binding endonuclease 1; mismatch-specific DNA N-glycosylase" /codon_start=1 /product="methyl-CpG-binding domain protein 4 isoform 3" /protein_id="NP_001263200.1" /db_xref="GI:442796452" /db_xref="GeneID:8930" /db_xref="HGNC:6919" /db_xref="MIM:603574" /translation="
MGTTGLESLSLGDRGAAPTVTSSERLVPDPPNDLRKEDVAMELERVGEDEEQMMIKRSSECNPLLQEPIASAQFGATAGTECRKSVPCGWERVVKQRLFGKTAGRFDVYFISPQGLKFRSKSSLANYLHKNGETSLKPEDFDFTVLSKRGIKSRYKDCSMAALTSHLQNQSNNSNWNLRTRSKCKKDVFMPPSSSSELQESRGLSNFTSTHLLLKEDEGVDDVNFRKVRKPKGKVTILKGIPIKKTKKGCRKSCSGFVQSDSKRESVCNKADAESEPVAQKSQLDRTVCISDAGACGETLSVTSEENSLVKKKERSLSSGSNFCSEQKTSGIINKFCSAKDSEHNEKYEDTFLESEEIGTKVEVVERKEHLHTDILKRGSEMDNNCSPTRKDFTGEKIFQEDTIPRTQIERRKTSLYFSSKYNKEALSPPRRKAFKKWTPPRSPFNLVQETLFHDPWKLLIATIFLNRTSGKMAIPVLWKFLEKYPSAEVARTADWRDVSELLKPLGLYDLRAKTIVKFSDEYLTKQWKYPIELHGIGKYGNDSYRIFCVNEWKQVRLTPIHNSAHLVSEAK
" misc_feature 581..811 /gene="MBD4" /gene_synonym="MED1" /note="Methyl-CpG binding domain; Region: MBD; smart00391" /db_xref="CDD:128673" misc_feature order(623..625,629..631,635..637,659..661,665..667, 692..694,701..703,713..715) /gene="MBD4" /gene_synonym="MED1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:29025" misc_feature 1727..>2005 /gene="MBD4" /gene_synonym="MED1" /note="endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786" /db_xref="CDD:209897" misc_feature order(1748..1756,1763..1765,1880..1882) /gene="MBD4" /gene_synonym="MED1" /note="minor groove reading motif; other site" /db_xref="CDD:28938" misc_feature 1946..1966 /gene="MBD4" /gene_synonym="MED1" /note="helix-hairpin-helix signature motif; other site" /db_xref="CDD:28938" variation 377 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:2307297" exon 451..681 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 527 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:2307296" exon 682..1547 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 1163 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:10342" variation 1370 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:2307289" variation 1382 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /db_xref="dbSNP:140693" variation 1419 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:2307298" exon 1548..1622 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 1570 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /db_xref="dbSNP:3138351" exon 1623..1757 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" exon 1758..1907 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 1759 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:140696" exon 1908..2338 /gene="MBD4" /gene_synonym="MED1" /inference="alignment:Splign:1.39.8" variation 1954 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /db_xref="dbSNP:2005619" variation 2172 /gene="MBD4" /gene_synonym="MED1" /replace="c" /replace="t" /db_xref="dbSNP:2005620" variation 2187 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /db_xref="dbSNP:3138360" variation 2219 /gene="MBD4" /gene_synonym="MED1" /replace="a" /replace="g" /db_xref="dbSNP:3138361" ORIGIN
cttgctccgagcgcgcatgtccgaaagggaaagccagaaaagcagcaaaagcaatggtggcactggagcccctaaggcgccagcgcaaccagagcgcgagcgattggtcggggcgtgtgggggcggtgcgtcttcctcgagaatggatttgattggtggagcgtggaaatggcggctgtagccgagggggcggccggaaagcagcggcggcgtctggggcgctttcgcaacattcagacctcggttgcagcccggtgccgtgagctgaagaggtttcacatcttactccgccccacaccctgggcgttgcggcgctgggctcgttgctgcagccggaccctgctcgatgggcacgactgggctggagagtctgagtctgggggaccgcggagctgcccccaccgtcacctctagtgagcgcctagtcccagacccgccgaatgacctccgcaaagaagatgttgctatggaattggaaagagtgggagaagatgaggaacaaatgatgataaaaagaagcagtgaatgtaatcccttgctacaagaacccatcgcttctgctcagtttggtgctactgcaggaacagaatgccgtaagtctgtcccatgtggatgggaaagagttgtgaagcaaaggttatttgggaagacagcaggaagatttgatgtgtactttatcagcccacaaggactgaagttcagatccaaaagttcacttgctaattatcttcacaaaaatggagagacttctcttaagccagaagattttgattttactgtactttctaaaaggggtatcaagtcaagatataaagactgcagcatggcagccctgacatcccatctacaaaaccaaagtaacaattcaaactggaacctcaggacccgaagcaagtgcaaaaaggatgtgtttatgccgccaagtagtagttcagagttgcaggagagcagaggactctctaactttacttccactcatttgcttttgaaagaagatgagggtgttgatgatgttaacttcagaaaggttagaaagcccaaaggaaaggtgactattttgaaaggaatcccaattaagaaaactaaaaaaggatgtaggaagagctgttcaggttttgttcaaagtgatagcaaaagagaatctgtgtgtaataaagcagatgctgaaagtgaacctgttgcacaaaaaagtcagcttgatagaactgtctgcatttctgatgctggagcatgtggtgagaccctcagtgtgaccagtgaagaaaacagccttgtaaaaaaaaaagaaagatcattgagttcaggatcaaatttttgttctgaacaaaaaacttctggcatcataaacaaattttgttcagccaaagactcagaacacaacgagaagtatgaggatacctttttagaatctgaagaaatcggaacaaaagtagaagttgtggaaaggaaagaacatttgcatactgacattttaaaacgtggctctgaaatggacaacaactgctcaccaaccaggaaagacttcactggtgagaaaatatttcaagaagataccatcccacgaacacagatagaaagaaggaaaacaagcctgtatttttccagcaaatataacaaagaagctcttagccccccacgacgtaaagcctttaagaaatggacacctcctcggtcaccttttaatctcgttcaagaaacactttttcatgatccatggaagcttctcatcgctactatatttctcaatcggacctcaggcaaaatggcaatacctgtgctttggaagtttctggagaagtatccttcagctgaggtagcaagaaccgcagactggagagatgtgtcagaacttcttaaacctcttggtctctacgatcttcgggcaaaaaccattgtcaagttctcagatgaatacctgacaaagcagtggaagtatccaattgagcttcatgggattggtaaatatggcaacgactcttaccgaattttttgtgtcaatgagtggaagcaggtgaggctcactcccatccataattcagcacatttggtctctgaggcaaaataagtccaccattatggttaagactatttattggatacaaatgctattacagtcacaaacaattgtgttcctggctgcggggaagcgggtggcatgtgggttttggggtttttgatcagtaggcgctcccaagtccacaaagaccagtccagcggcgtggcctctgactcatctccagtggtttgtcacctctggccctgttcctgtcattccctatttgtgtgctatctctaagcctgacgtggttttcctcctgtcaaaagtacaccactacag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:8930 -> Molecular function: GO:0003696 [satellite DNA binding] evidence: TAS GeneID:8930 -> Molecular function: GO:0004520 [endodeoxyribonuclease activity] evidence: TAS GeneID:8930 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:8930 -> Molecular function: GO:0008263 [pyrimidine-specific mismatch base pair DNA N-glycosylase activity] evidence: IDA GeneID:8930 -> Biological process: GO:0006281 [DNA repair] evidence: TAS GeneID:8930 -> Biological process: GO:0006284 [base-excision repair] evidence: TAS GeneID:8930 -> Biological process: GO:0006285 [base-excision repair, AP site formation] evidence: TAS GeneID:8930 -> Biological process: GO:0008630 [intrinsic apoptotic signaling pathway in response to DNA damage] evidence: IEA GeneID:8930 -> Biological process: GO:0009314 [response to radiation] evidence: IEA GeneID:8930 -> Biological process: GO:0031572 [G2 DNA damage checkpoint] evidence: IEA GeneID:8930 -> Biological process: GO:0045008 [depyrimidination] evidence: TAS GeneID:8930 -> Cellular component: GO:0000785 [chromatin] evidence: IEA GeneID:8930 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:8930 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:8930 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:8930 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.