2024-04-27 14:05:36, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001271698 2447 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 4, mRNA. ACCESSION NM_001271698 VERSION NM_001271698.1 GI:411147366 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2447) AUTHORS Nikpour,M., Scharenberg,C., Liu,A., Conte,S., Karimi,M., Mortera-Blanco,T., Giai,V., Fernandez-Mercado,M., Papaemmanuil,E., Hogstrand,K., Jansson,M., Vedin,I., Stephen Wainscoat,J., Campbell,P., Cazzola,M., Boultwood,J., Grandien,A. and Hellstrom-Lindberg,E. TITLE The transporter ABCB7 is a mediator of the phenotype of acquired refractory anemia with ring sideroblasts JOURNAL Leukemia 27 (4), 889-896 (2013) PUBMED 23070040 REMARK GeneRIF: findings support that ABCB7 is implicated in the phenotype of acquired RARS and suggest a relation between SF3B1 mutations and ABCB7 downregulation REFERENCE 2 (bases 1 to 2447) AUTHORS D'Hooghe,M., Selleslag,D., Mortier,G., Van Coster,R., Vermeersch,P., Billiet,J. and Bekri,S. TITLE X-linked sideroblastic anemia and ataxia: a new family with identification of a fourth ABCB7 gene mutation JOURNAL Eur. J. Paediatr. Neurol. 16 (6), 730-735 (2012) PUBMED 22398176 REMARK GeneRIF: We describe a fourth family with X-linked sideroblastic anemia and ataxia and a novel mutation in the ABCB7 gene REFERENCE 3 (bases 1 to 2447) AUTHORS Sato,K., Torimoto,Y., Hosoki,T., Ikuta,K., Takahashi,H., Yamamoto,M., Ito,S., Okamura,N., Ichiki,K., Tanaka,H., Shindo,M., Hirai,K., Mizukami,Y., Otake,T., Fujiya,M., Sasaki,K. and Kohgo,Y. TITLE Loss of ABCB7 gene: pathogenesis of mitochondrial iron accumulation in erythroblasts in refractory anemia with ringed sideroblast with isodicentric (X)(q13) JOURNAL Int. J. Hematol. 93 (3), 311-318 (2011) PUBMED 21380928 REMARK GeneRIF: loss of the ABCB7 gene may be a pathogenetic factor underlying mitochondrial iron accumulation in RARS patients with idicXq13. REFERENCE 4 (bases 1 to 2447) AUTHORS Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C., Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G., Jadersten,M., Killick,S., Giagounidis,A., Bowen,D., Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S. TITLE The role of the iron transporter ABCB7 in refractory anemia with ring sideroblasts JOURNAL PLoS ONE 3 (4), E1970 (2008) PUBMED 18398482 REMARK GeneRIF: ABCB7 may have a role in refractory anemia with ring sideroblasts Publication Status: Online-Only REFERENCE 5 (bases 1 to 2447) AUTHORS Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T. TITLE Involvement of ABC7 in the biosynthesis of heme in erythroid cells: interaction of ABC7 with ferrochelatase JOURNAL Blood 101 (8), 3274-3280 (2003) PUBMED 12480705 REFERENCE 6 (bases 1 to 2447) AUTHORS Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M. and Koeller,D.M. TITLE Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A) JOURNAL Hum. Mol. Genet. 8 (5), 743-749 (1999) PUBMED 10196363 REFERENCE 7 (bases 1 to 2447) AUTHORS Csere,P., Lill,R. and Kispal,G. TITLE Identification of a human mitochondrial ABC transporter, the functional orthologue of yeast Atm1p JOURNAL FEBS Lett. 441 (2), 266-270 (1998) PUBMED 9883897 REFERENCE 8 (bases 1 to 2447) AUTHORS Shimada,Y., Okuno,S., Kawai,A., Shinomiya,H., Saito,A., Suzuki,M., Omori,Y., Nishino,N., Kanemoto,N., Fujiwara,T., Horie,M. and Takahashi,E. TITLE Cloning and chromosomal mapping of a novel ABC transporter gene (hABC7), a candidate for X-linked sideroblastic anemia with spinocerebellar ataxia JOURNAL J. Hum. Genet. 43 (2), 115-122 (1998) PUBMED 9621516 REFERENCE 9 (bases 1 to 2447) AUTHORS Savary,S., Allikmets,R., Denizot,F., Luciani,M.F., Mattei,M.G., Dean,M. and Chimini,G. TITLE Isolation and chromosomal mapping of a novel ATP-binding cassette transporter conserved in mouse and human JOURNAL Genomics 41 (2), 275-278 (1997) PUBMED 9143506 REFERENCE 10 (bases 1 to 2447) AUTHORS Allikmets,R., Gerrard,B., Hutchinson,A. and Dean,M. TITLE Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database JOURNAL Hum. Mol. Genet. 5 (10), 1649-1655 (1996) PUBMED 8894702 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP228998.1, AK294657.1, BC006323.2 and CN411218.1. Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a half-transporter involved in the transport of heme from the mitochondria to the cytosol. With iron/sulfur cluster precursors as its substrates, this protein may play a role in metal homeostasis. Mutations in this gene have been associated with mitochondrial iron accumulation and isodicentric (X)(q13) and sideroblastic anemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]. Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 4), compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK294657.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025088 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-58 BP228998.1 1-58 59-2174 AK294657.1 1-2116 2175-2339 BC006323.2 2189-2353 2340-2401 CN411218.1 466-527 2402-2437 CN411218.1 529-564 2438-2447 CN411218.1 567-576 FEATURES Location/Qualifiers source 1..2447 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xq13.3" gene 1..2447 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ATP-binding cassette, sub-family B (MDR/TAP), member 7" /db_xref="GeneID:22" /db_xref="HGNC:48" /db_xref="MIM:300135" exon 1..236 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" CDS 69..2249 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="isoform 4 is encoded by transcript variant 4; ATP-binding cassette sub-family B member 7, mitochondrial; ABC transporter 7 protein; ATP-binding cassette transporter 7" /codon_start=1 /product="ATP-binding cassette sub-family B member 7, mitochondrial isoform 4" /protein_id="NP_001258627.1" /db_xref="GI:411147367" /db_xref="GeneID:22" /db_xref="HGNC:48" /db_xref="MIM:300135" /translation="
MALLAMHSWRWAAAAAAFEKRRHSAILIRPLVSVSGSGPQWRPHQLGALGTARAYQALQVWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIMFEVMLVSGVLYYKCGAQFALVTLGTLGTYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNERYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGTLTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTQIKDKVMASPLQITPQTATVAFDNVHFEYIEGQKVLSGISFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNISASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMKDVVKHRTSIFIAHRLSTVVDADEIIVLDQGKVAERGTHHGLLANPHSIYSEMWHTQSSRVQNHDNPKWEAKKENISKEEERKKLQEEIVNSVKGCGNCSC
" misc_feature 408..1223 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ABC transporter transmembrane region; Region: ABC_membrane; pfam00664" /db_xref="CDD:201380" misc_feature 618..2105 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ABC-type transport system involved in Fe-S cluster assembly, permease and ATPase components [Posttranslational modification, protein turnover, chaperones]; Region: ATM1; COG5265" /db_xref="CDD:34862" misc_feature 1404..2114 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ATP-binding cassette domain of iron-sulfur clusters transporter, subfamily C; Region: ABCC_ATM1_transporter; cd03253" /db_xref="CDD:213220" misc_feature 1503..1526 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="Walker A/P-loop; other site" /db_xref="CDD:213220" misc_feature order(1512..1517,1521..1529,1647..1649,1887..1892, 1983..1985) /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:213220" misc_feature 1638..1649 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="Q-loop/lid; other site" /db_xref="CDD:213220" misc_feature 1815..1844 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="ABC transporter signature motif; other site" /db_xref="CDD:213220" misc_feature 1875..1892 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="Walker B; other site" /db_xref="CDD:213220" misc_feature 1899..1910 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="D-loop; other site" /db_xref="CDD:213220" misc_feature 1971..1991 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="H-loop/switch region; other site" /db_xref="CDD:213220" exon 237..323 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 324..443 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 444..576 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 577..845 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" variation 763 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="a" /replace="g" /db_xref="dbSNP:1054913" variation 802 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="c" /replace="t" /db_xref="dbSNP:1054914" exon 846..934 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" variation 858 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="g" /replace="t" /db_xref="dbSNP:1133577" exon 935..1022 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" variation 948 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1133578" variation 950 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="a" /replace="g" /db_xref="dbSNP:1133579" exon 1023..1197 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" variation 1067 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="c" /replace="t" /db_xref="dbSNP:1054919" exon 1198..1355 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 1356..1519 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 1520..1649 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 1650..1821 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" variation 1729 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="c" /replace="t" /db_xref="dbSNP:1340989" variation 1730 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /replace="a" /replace="g" /db_xref="dbSNP:1340990" exon 1822..1925 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 1926..2033 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" exon 2034..2447 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /inference="alignment:Splign:1.39.8" STS 2204..2320 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /standard_name="WI-11286" /db_xref="UniSTS:60847" polyA_signal 2317..2322 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" polyA_site 2349 /gene="ABCB7" /gene_synonym="ABC7; ASAT; Atm1p; EST140535" /note="The 3' most polyA site has not been determined. This represents a 5' major polyA site." ORIGIN
aggtagccgaattcagtccgccagtgtcccataatcctcttctctcggttcctctttcctcgctcaagatggcgctgctcgcgatgcattcttggcgctgggcggccgcggcggctgctttcgaaaagcgccggcactccgcgattctgatccggcctttagtctctgttagcggctcaggtccgcagtggaggccacatcaactcggcgccttgggaaccgctcgagcctaccaggctctccaggtatggccactgatagaaaagaggacatgttggcatggtcatgcaggaggaggactccacacagacccaaaagaagggttaaaagatgttgatactcggaaaatcataaaagcaatgctttcttatgtgtggcccaaagacaggccagatctacgagctagagttgccatttcgctgggatttttgggtggtgcaaaggccatgaatattgtggttcccttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagctggagctgctttttttaacgaagttcgaaatgcagtatttggcaaggtagcccagaattcaatccgaagaatagccaaaaatgtctttctccatcttcacaacctggatctgggttttcacctgagcagacagacgggagctttatctaaggctattgacagaggaacaaggggtatcagttttgtcctgagtgctttggtatttaatcttcttcccatcatgtttgaagtgatgcttgtcagtggtgttttgtattacaaatgcggtgcccagtttgctttggtaacccttggaacacttggtacatacacagcattcacagttgcagtcacacggtggagaactagatttagaatagaaatgaacaaagcagataatgatgcaggtaatgctgctatagactcactgctgaattatgaaactgtgaagtattttaataatgaaagatatgaagcacagagatatgatggatttttgaagacgtatgagactgcttcattgaaaagtacctctactctggctatgctgaactttggtcaaagtgctattttcagtgtcggtttaacagctataatggtgctcgccagtcagggaattgtggcaggtacccttactgttggagatctagtaatggtgaatggactgctttttcagctttcattacccctgaactttctgggaactgtatatagagagactagacaagcactcatagatatgaacaccttgtttactctactcaaggtagacacccaaattaaagacaaagtgatggcatctccccttcagatcacaccacagacagctaccgtggcctttgataatgtgcattttgaatacattgagggccagaaagtccttagtggaatatcctttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcagggaaaagcacaatagtgaggctattatttcgcttctatgagcctcaaaagggtagcatttatcttgctggtcaaaatatacaagatgtgagcctggaaagccttcggagggcagtgggagtggtacctcaggatgctgtcctcttccataatactatttattacaacctcttatatggaaacatcagtgcttcacctgaggaagtgtatgcagtggcaaaattagctggacttcatgatgcaattcttcgaatgccacatggatatgacacccaagtaggggaacgaggactcaagctttcaggaggagaaaagcaaagagtagcaattgcaagagccattttgaaggaccccccagtcatactctatgatgaagctacttcatcgttagattcgattactgaagagactattcttggtgccatgaaggatgtggtcaaacacagaacttctattttcattgcacacagattgtcaacagtggttgatgcagatgaaatcattgtcttggatcagggtaaggtagccgaacgtggtacccaccatggtttgcttgctaaccctcatagtatctattcagaaatgtggcatacacagagcagccgtgtgcagaaccatgataaccccaaatgggaagcaaagaaagaaaatatatccaaagaggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtggaaactgttcgtgctaagtcacataagacattttctttttttgttgttttggactacatatttgcactgaagcagaattgttttattaaaaaaatcatacattcccattttctataatccttcttttagataagatttatttaaaaggggatttgagttttacatctttcatagtctatttaatgtggcatctgtatttatccccaaattatttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:22 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:22 -> Molecular function: GO:0015232 [heme transporter activity] evidence: TAS GeneID:22 -> Molecular function: GO:0042626 [ATPase activity, coupled to transmembrane movement of substances] evidence: IBA GeneID:22 -> Biological process: GO:0006810 [transport] evidence: TAS GeneID:22 -> Biological process: GO:0006879 [cellular iron ion homeostasis] evidence: IBA GeneID:22 -> Biological process: GO:0015886 [heme transport] evidence: TAS GeneID:22 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: IBA GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS GeneID:22 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:22 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: IDA GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: TAS GeneID:22 -> Cellular component: GO:0016021 [integral to membrane] evidence: IBA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.