GGRNA Home | Help | Advanced search

2020-10-26 19:52:32, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001271581            5783 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 10
            (DNAJC10), transcript variant 2, mRNA.
ACCESSION   NM_001271581
VERSION     NM_001271581.1  GI:409971396
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5783)
  AUTHORS   Velez Edwards,D.R., Naj,A.C., Monda,K., North,K.E., Neuhouser,M.,
            Magvanjav,O., Kusimo,I., Vitolins,M.Z., Manson,J.E.,
            O'Sullivan,M.J., Rampersaud,E. and Edwards,T.L.
  TITLE     Gene-environment interactions and obesity traits among
            postmenopausal African-American and Hispanic women in the Women's
            Health Initiative SHARe Study
  JOURNAL   Hum. Genet. 132 (3), 323-336 (2013)
   PUBMED   23192594
REFERENCE   2  (bases 1 to 5783)
  AUTHORS   Hagiwara,M. and Nagata,K.
  TITLE     Redox-dependent protein quality control in the endoplasmic
            reticulum: folding to degradation
  JOURNAL   Antioxid. Redox Signal. 16 (10), 1119-1128 (2012)
   PUBMED   22229892
  REMARK    Review article
REFERENCE   3  (bases 1 to 5783)
  AUTHORS   Tamura,T., Cormier,J.H. and Hebert,D.N.
  TITLE     Characterization of early EDEM1 protein maturation events and their
            functional implications
  JOURNAL   J. Biol. Chem. 286 (28), 24906-24915 (2011)
   PUBMED   21632540
REFERENCE   4  (bases 1 to 5783)
  AUTHORS   Hagiwara,M., Maegawa,K., Suzuki,M., Ushioda,R., Araki,K.,
            Matsumoto,Y., Hoseki,J., Nagata,K. and Inaba,K.
  TITLE     Structural basis of an ERAD pathway mediated by the ER-resident
            protein disulfide reductase ERdj5
  JOURNAL   Mol. Cell 41 (4), 432-444 (2011)
   PUBMED   21329881
REFERENCE   5  (bases 1 to 5783)
  AUTHORS   Ushioda,R. and Nagata,K.
  TITLE     The endoplasmic reticulum-associated degradation and disulfide
            reductase ERdj5
  JOURNAL   Meth. Enzymol. 490, 235-258 (2011)
   PUBMED   21266254
REFERENCE   6  (bases 1 to 5783)
  AUTHORS   Dong,M., Bridges,J.P., Apsley,K., Xu,Y. and Weaver,T.E.
  TITLE     ERdj4 and ERdj5 are required for endoplasmic reticulum-associated
            protein degradation of misfolded surfactant protein C
  JOURNAL   Mol. Biol. Cell 19 (6), 2620-2630 (2008)
   PUBMED   18400946
  REMARK    GeneRIF: ERdj4 and ERdj5 promote turnover of misfolded SP-C and
            this activity is dependent on their ability to stimulate BiP ATPase
            activity.
REFERENCE   7  (bases 1 to 5783)
  AUTHORS   Corazzari,M., Lovat,P.E., Armstrong,J.L., Fimia,G.M., Hill,D.S.,
            Birch-Machin,M., Redfern,C.P. and Piacentini,M.
  TITLE     Targeting homeostatic mechanisms of endoplasmic reticulum stress to
            increase susceptibility of cancer cells to fenretinide-induced
            apoptosis: the role of stress proteins ERdj5 and ERp57
  JOURNAL   Br. J. Cancer 96 (7), 1062-1071 (2007)
   PUBMED   17353921
REFERENCE   8  (bases 1 to 5783)
  AUTHORS   Gu,S.H., Chen,J.Z., Ying,K., Wang,S., Jin,W., Qian,J., Zhao,E.P.,
            Xie,Y. and Mao,Y.M.
  TITLE     Cloning and identification of a novel cDNA which encodes a putative
            protein with a DnaJ domain and a thioredoxin active motif, human
            macrothioredoxin
  JOURNAL   Biochem. Genet. 41 (7-8), 245-253 (2003)
   PUBMED   14587667
  REMARK    GeneRIF: The organization of the functional motifs of hMTHr
            suggests that the protein might be a member of a molecular
            chaperone family.
REFERENCE   9  (bases 1 to 5783)
  AUTHORS   Hosoda,A., Kimata,Y., Tsuru,A. and Kohno,K.
  TITLE     JPDI, a novel endoplasmic reticulum-resident protein containing
            both a BiP-interacting J-domain and thioredoxin-like motifs
  JOURNAL   J. Biol. Chem. 278 (4), 2669-2676 (2003)
   PUBMED   12446677
  REMARK    GeneRIF: JPDI may have roles in folding of some proteins in the ER,
            chaperoning by BiP and formation of proper disulfide bonds
REFERENCE   10 (bases 1 to 5783)
  AUTHORS   Cunnea,P.M., Miranda-Vizuete,A., Bertoli,G., Simmen,T.,
            Damdimopoulos,A.E., Hermann,S., Leinonen,S., Huikko,M.P.,
            Gustafsson,J.A., Sitia,R. and Spyrou,G.
  TITLE     ERdj5, an endoplasmic reticulum (ER)-resident protein containing
            DnaJ and thioredoxin domains, is expressed in secretory cells or
            following ER stress
  JOURNAL   J. Biol. Chem. 278 (2), 1059-1066 (2003)
   PUBMED   12411443
  REMARK    GeneRIF: ERdj5 is a ubiquitous protein localized in the ER and is
            particularly abundant in secretory cells. Its transcription is
            induced during ER stress, suggesting potential roles for ERdj5 in
            protein folding and translocation across the ER membrane.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA106532.1, AK027647.1,
            AY358577.1, AC105396.2 and AA651917.1.
            
            Summary: This gene encodes an endoplasmic reticulum co-chaperone
            which is part of the endoplasmic reticulum-associated degradation
            complex involved in recognizing and degrading misfolded proteins.
            The encoded protein reduces incorrect disulfide bonds in misfolded
            glycoproteins. Alternatively spliced transcript variants encoding
            multiple isoforms have been observed for this gene. [provided by
            RefSeq, Oct 2012].
            
            Transcript Variant: This variant (2) lacks an alternate in-frame
            exon in the coding region, compared to variant 1. The encoded
            isoform (2) is shorter, compared to isoform (1).
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY358577.1, AF490904.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-231               DA106532.1         1-231
            232-1255            AK027647.1         1-1024
            1256-2445           AY358577.1         1013-2202
            2446-2749           AK027647.1         2353-2656
            2750-3658           AY358577.1         2507-3415
            3659-4286           AK027647.1         3566-4193
            4287-5326           AC105396.2         41627-42666
            5327-5783           AA651917.1         6-462               c
FEATURES             Location/Qualifiers
     source          1..5783
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q32.1"
     gene            1..5783
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ (Hsp40) homolog, subfamily C, member 10"
                     /db_xref="GeneID:54431"
                     /db_xref="HGNC:24637"
                     /db_xref="MIM:607987"
     exon            1..443
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       51
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28384497"
     variation       59
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369230902"
     variation       85
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372516008"
     variation       101
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138490102"
     variation       115
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111936226"
     variation       145
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74340991"
     variation       151
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113735743"
     variation       158
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112287906"
     variation       353
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143023681"
     variation       358
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377576688"
     exon            444..500
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       469
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139649379"
     variation       484
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11547938"
     exon            501..850
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       558
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186958516"
     variation       607
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371727615"
     misc_feature    620..622
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="upstream in-frame stop codon"
     variation       637
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375953838"
     CDS             647..2890
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; J-domain-containing protein disulfide
                     isomerase-like protein; ER-resident protein ERdj5; dnaJ
                     homolog subfamily C member 10; macrothioredoxin; protein
                     disulfide isomerase family A, member 19"
                     /codon_start=1
                     /product="dnaJ homolog subfamily C member 10 isoform 2
                     precursor"
                     /protein_id="NP_001258510.1"
                     /db_xref="GI:409971397"
                     /db_xref="GeneID:54431"
                     /db_xref="HGNC:24637"
                     /db_xref="MIM:607987"
                     /translation="
MGVWLNKDDYIRDLKRIILCFLIVYMAILVGTDQDFYSLLGVSKTASSREIRQAFKKLALKLHPDKNPNNPNAHGDFLKINRAYEVLKDEDLRKKYDKYGEKGLEDNQGGQYESWNYYRYDFGIYDDDPEIITLERREFDAAVNSGELWFVNFYSPGCSHCHDLAPTWRDFAKEVDGLLRIGAVNCGDDRMLCRMKGVNSYPSLFIFRSGMAPVKYHGDRSKESLVSFAMQHVRSTVTELWTGNFVNSIQTAFAAGIGWLITFCSKGGDCLTSQTRLRLSGMLFLNSLDAKEIYLEVIHNLPDFELLSANTLEDRLAHHRWLLFFHFGKNENSNDPELKKLKTLLKNDHIQVGRFDCSSAPDICSNLYVFQPSLAVFKGQGTKEYEIHHGKKILYDILAFAKESVNSHVTTLGPQNFPANDKEPWLVDFFAPWCPPCRALLPELRRASNLLYGQLKFGTLDCTVHEGLCNMYNIQAYPTTVVFNQSNIHEYEGHHSAEQILEFIEDLMNPSVVSLTPTTFNELVTQRKHNEVWMVDFYSPWCHPCQVLMPEWKRMARTLTGLINVGSIDCQQYHSFCAQENVQRYPEIRFFPPKSNKAYHYHSYNGWNRDAYSLRIWGLGFLPQVSTDLTPQTFSEKVLQGKNHWVIDFYAPWCGPCQNFAPEFELLARMIKGKVKAGKVDCQAYAQTCQKAGIRAYPTVKFYFYERAKRNFQEEQINTRDAKAIAALISEKLETLRNQGKRNKDEL
"
     sig_peptide     647..742
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /product="dnaJ homolog subfamily C member 10"
     mat_peptide     743..2887
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /product="dnaJ homolog subfamily C member 10 isoform 2"
     misc_feature    746..>1027
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ-class molecular chaperone with C-terminal Zn
                     finger domain [Posttranslational modification, protein
                     turnover, chaperones]; Region: DnaJ; COG0484"
                     /db_xref="CDD:30832"
     misc_feature    749..913
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock
                     protein 40) proteins are highly conserved and play crucial
                     roles in protein translation, folding, unfolding,
                     translocation, and degradation. They act primarily by
                     stimulating the ATPase activity of Hsp70s; Region: DnaJ;
                     cd06257"
                     /db_xref="CDD:99751"
     misc_feature    order(833..841,866..868,875..880,887..892)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="HSP70 interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:99751"
     misc_feature    1031..1333
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, N-terminal ERdj5 subfamily; ERdj5,
                     also known as JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is comprised of the first TRX
                     domain of ERdj5 located after the...; Region:
                     PDI_a_ERdj5_N; cd03003"
                     /db_xref="CDD:48552"
     misc_feature    1034..2161
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="protein disulfide isomerases, eukaryotic; Region:
                     ER_PDI_fam; TIGR01130"
                     /db_xref="CDD:162215"
     misc_feature    order(1118..1120,1127..1129,1304..1306)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48552"
     misc_feature    <1652..1849
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="Protein Disulfide Isomerase (PDIa) family, redox
                     active TRX domains; composed of eukaryotic proteins
                     involved in oxidative protein folding in the endoplasmic
                     reticulum (ER) by acting as catalysts and folding
                     assistants. Members of this family include PDI...; Region:
                     PDI_a_family; cd02961"
                     /db_xref="CDD:48510"
     misc_feature    1865..2158
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(1946..1948,1955..1957)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     misc_feature    2174..2497
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(2270..2272,2279..2281)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     misc_feature    2516..2833
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(2606..2608,2615..2617)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     variation       676
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191725153"
     variation       701
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140037014"
     variation       738
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369988252"
     variation       746
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373204672"
     variation       766
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373542036"
     variation       768
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151277356"
     variation       780
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373934752"
     exon            851..1013
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       857
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200695145"
     variation       871
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150009047"
     variation       872
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6729801"
     variation       951
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199619368"
     variation       954
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377549612"
     variation       962
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141135661"
     variation       971
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201955943"
     variation       991
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201607521"
     exon            1014..1064
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     exon            1065..1147
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1073
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375772609"
     variation       1092
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373693809"
     variation       1110
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201353295"
     variation       1112
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368656790"
     variation       1125
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78227790"
     variation       1126
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76313543"
     exon            1148..1279
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1163
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200031184"
     variation       1173
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141717303"
     variation       1177
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184116987"
     variation       1196
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141962408"
     variation       1255
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:288280"
     variation       1262
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376885680"
     variation       1268
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372451587"
     exon            1280..1373
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1289
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936889"
     variation       1295
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374998022"
     variation       1311..1312
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11460187"
     variation       1326
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61748252"
     variation       1334
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369375869"
     variation       1341
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372625469"
     variation       1352
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141906022"
     variation       1371
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191829754"
     exon            1374..1451
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1410
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372447298"
     exon            1452..1495
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1494..1495
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34783249"
     exon            1496..1585
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1510
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202044858"
     variation       1545
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144910042"
     variation       1547
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13414223"
     variation       1569
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201843743"
     variation       1570
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200295491"
     variation       1574
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200062649"
     exon            1586..1699
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1590
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201121755"
     variation       1598
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138024183"
     variation       1622
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77732049"
     variation       1666
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372562169"
     variation       1682
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199498703"
     exon            1700..1814
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1700
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201689661"
     variation       1726
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142705407"
     variation       1749
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11681366"
     exon            1815..1942
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1828
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61748253"
     variation       1868
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199796017"
     variation       1878
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377272109"
     variation       1879
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376426410"
     variation       1889
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75109237"
     variation       1891
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2304603"
     variation       1905
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144717687"
     variation       1925
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370356949"
     exon            1943..2059
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1950
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376095496"
     variation       1951
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142988259"
     variation       1956
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151108303"
     variation       1959
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149656732"
     variation       1970
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190143789"
     variation       1982
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368684952"
     variation       1991
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935982"
     variation       2023
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376254344"
     variation       2034
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369183539"
     variation       2057
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61748254"
     exon            2060..2161
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2105
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369866299"
     variation       2117
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200304373"
     variation       2152
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375589522"
     exon            2162..2317
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2164
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111236031"
     variation       2168
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200740800"
     variation       2179
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189379421"
     variation       2180
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199500215"
     variation       2193
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065612"
     variation       2194
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148262147"
     variation       2199
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368012044"
     variation       2209
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150626904"
     variation       2217
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112380483"
     variation       2237
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371494397"
     variation       2242
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143144951"
     variation       2259
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376768488"
     variation       2265
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367849311"
     exon            2318..2451
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2389
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201677957"
     variation       2404
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140104007"
     variation       2405
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139539130"
     variation       2446
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:288334"
     exon            2452..2505
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2470
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187476677"
     variation       2505
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373979148"
     exon            2506..2653
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2522
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148785458"
     variation       2535
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372508150"
     variation       2574
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200891337"
     variation       2578
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140227116"
     variation       2597
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61738722"
     exon            2654..2773
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2686
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144060054"
     variation       2749
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192618"
     exon            2774..2878
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2823
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202022153"
     variation       2843
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112232193"
     variation       2852
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199932502"
     variation       2854
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200259717"
     variation       2856
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375455316"
     exon            2879..5783
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       3037
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151315452"
     variation       3076
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371237109"
     variation       3142
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115063714"
     variation       3239
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141961638"
     variation       3277
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369480504"
     variation       3287
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13011976"
     variation       3302
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145736834"
     variation       3415
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188389581"
     variation       3458
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191694878"
     variation       3501
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184332767"
     variation       3588
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141262861"
     variation       3605
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114629112"
     variation       3609..3610
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369565323"
     variation       3659
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:288283"
     variation       3708
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112473306"
     variation       3748
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190160806"
     variation       3756
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182329645"
     variation       3800
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187328259"
     variation       3848
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190691010"
     variation       3905
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146950872"
     variation       3909
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13509"
     variation       4026
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:180696166"
     variation       4108
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138060233"
     STS             4133..4263
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="WI-13407"
                     /db_xref="UniSTS:1749"
     variation       4159..4160
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35638870"
     variation       4162
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113561329"
     variation       4210
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185315237"
     polyA_signal    4244..4249
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      4271
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     variation       4336
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:367839634"
     variation       4339..4340
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="gctca"
                     /db_xref="dbSNP:142218995"
     variation       4341
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113727757"
     variation       4341
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="gctca"
                     /db_xref="dbSNP:11278039"
     variation       4342
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113744659"
     variation       4345
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:111394482"
     variation       4425
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190221532"
     variation       4682
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11547935"
     variation       4693
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72898754"
     STS             4714..4836
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH104078"
                     /db_xref="UniSTS:98403"
     variation       4760
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182817109"
     variation       4776..4777
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:112963526"
     variation       4860
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186900818"
     variation       4920
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3738945"
     variation       4927
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117734438"
     variation       4936
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:288241"
     variation       4987
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191698826"
     STS             5074..5195
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH92924"
                     /db_xref="UniSTS:87599"
     variation       5075
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77789280"
     variation       5222
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:288240"
     variation       5244
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183754646"
     polyA_signal    5342..5347
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      5365
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     variation       5406
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6705867"
     variation       5474
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373525159"
     variation       5561
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188642906"
     variation       5566..5567
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:139499424"
     STS             5573..5708
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH48757"
                     /db_xref="UniSTS:89848"
     variation       5585
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190929452"
     variation       5620
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144154457"
     variation       5621
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148261139"
     variation       5625
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141980780"
     variation       5637
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377450245"
     polyA_signal    5761..5766
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      5783
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
ORIGIN      
gcattggtgagggggcgcgggctgcttggccagggcagttccctcagctccgggttggagccggagccggagccggatcccgcgcacaccgccacgtcaacctaaacctacaccgccctctccaccccaccgccgcagcgcccgctgggcccgcagcgggtctccccaggcagcgtcctccacgcctttcccacaatgctccgcgccaggccccgccccggctcgccgtggagaccggcgcgtgaggaacctaccggtaccggccgcgcgctggtagtcgccggtgtggctgcacctcaccaatcccgtgcgccgcggctgggccgtcggagagtgcgtgtgcttctctcctgcacgcggtgcttgggctcggccaggcggggtccgccgccagggtttgaggatgggggagtagctacaggaagcgaccccgcgatggcaaggtatatttttgtggaatgaaaaggaagtattagaaatgagctgaagaccattcacagattaatatttttggggacagatttgtgatgcttgattcacccttgaagtaatgtagacagaagttctcaaatttgcatattacatcaactggaaccagcagtgaatcttaatgttcacttaaatcagaacttgcataagaaagagaatgggagtctggttaaataaagatgactatatcagagacttgaaaaggatcattctctgttttctgatagtgtatatggccattttagtgggcacagatcaggatttttacagtttacttggagtgtccaaaactgcaagcagtagagaaataagacaagctttcaagaaattggcattgaagttacatcctgataaaaacccgaataacccaaatgcacatggcgattttttaaaaataaatagagcatatgaagtactcaaagatgaagatctacggaaaaagtatgacaaatatggagaaaagggacttgaggataatcaaggtggccagtatgaaagctggaactattatcgttatgattttggtatttatgatgatgatcctgaaatcataacattggaaagaagagaatttgatgctgctgttaattctggagaactgtggtttgtaaatttttactccccaggctgttcacactgccatgatttagctcccacatggagagactttgctaaagaagtggatgggttacttcgaattggagctgttaactgtggtgatgatagaatgctttgccgaatgaaaggagtcaacagctatcccagcctcttcatttttcggtctggaatggccccagtgaaatatcatggagacagatcaaaggagagtttagtgagttttgcaatgcagcatgttagaagtacagtgacagaactttggacaggaaattttgtcaactccatacaaactgcttttgctgctggtattggctggctgatcactttttgttcaaaaggaggagattgtttgacttcacagacacgactcaggcttagtggcatgttgtttctcaactcattggatgctaaagaaatatatttggaagtaatacataatcttccagattttgaactactttcggcaaacacactagaggatcgtttggctcatcatcggtggctgttattttttcattttggaaaaaatgaaaattcaaatgatcctgagctgaaaaaactaaaaactctacttaaaaatgatcatattcaagttggcaggtttgactgttcctctgcaccagacatctgtagtaatctgtatgtttttcagccgtctctagcagtatttaaaggacaaggaaccaaagaatatgaaattcatcatggaaagaagattctatatgatatacttgcctttgccaaagaaagtgtgaattctcatgttaccacgcttggacctcaaaattttcctgccaatgacaaagaaccatggcttgttgatttctttgccccctggtgtccaccatgtcgagctttactaccagagttacgaagagcatcaaatcttctttatggtcagcttaagtttggtacactagattgtacagttcatgagggactctgtaacatgtataacattcaggcttatccaacaacagtggtattcaaccagtccaacattcatgagtatgaaggacatcactctgctgaacaaatcttggagttcatagaggatcttatgaatccttcagtggtctcccttacacccaccaccttcaacgaactagttacacaaagaaaacacaacgaagtctggatggttgatttctattctccgtggtgtcatccttgccaagtcttaatgccagaatggaaaagaatggcccggacattaactggactgatcaacgtgggcagtatagattgccaacagtatcattctttttgtgcccaggaaaacgttcaaagataccctgagataagattttttcccccaaaatcaaataaagcttatcattatcacagttacaatggttggaatagggatgcttattccctgagaatctggggtctaggatttttacctcaagtatccacagatctaacacctcagactttcagtgaaaaagttctacaagggaaaaatcattgggtgattgatttctatgctccttggtgtggaccttgccagaattttgctccagaatttgagctcttggctaggatgattaaaggaaaagtgaaagctggaaaagtagactgtcaggcttatgctcagacatgccagaaagctgggatcagggcctatccaactgttaaattttatttctacgaaagagcaaagagaaattttcaagaagagcagataaataccagagatgcaaaagcaatcgctgccttaataagtgaaaaattggaaactctccgaaatcaaggcaagaggaataaggatgaactttgataatgttgaagatgaagaaaaagtttaaaagaaattctgacagatgacatcagaagacacctatttagaatgttacatttatgatgggaatgaatgaacattatcttagacttgcagttgtactgccagaattatctacagcactggtgtaaaagaagggtctgcaaactttttctgtaaagggccggtttataaatattttagactttgcaggctataatatatggttcacacatgagaacaagaatagagtcatcatgtattctttgttatttgcttttaacaacctttaaaaaatattaaaacgattcttagctcagagccatacaaaagtaggctggattcagtccatggaccatagattgctgtccccctcgacggacttataatgtttcaggtggctggcttgaacatgagtctgctgtgctatctacataaatgtctaagttgtataaagtccactttcccttcacgttttttggctgacctgaaaagaggtaacttagtttttggtcacttgttctcctaaaaatgctatccctaaccatatatttatatttcgttttaaaaacacccatgatgtggcacagtaaacaaaccctgttatgctgtattattatgaggagattcttcattgttttctttccttctcaaaggttgaaaaaatgcttttaatttttcacagccgagaaacagtgcagcagtatatgtgcacacagtaagtacacaaatttgagcaacagtaagtgcacaaattctgtagtttgccgtatcatccaggaaaacctgagggaaaaaaattatagcaattaactgggcattgtagagtatcctaaatatgttatcaagtatttagagttctatattttaaagatatatgtgttcatgtattttctgaaattgctttcatagaaattttcccactgatagttgatttttgaggcatctaatatttacatatttgccttctgaactttgttttgacctgtatcctttatttacattgggtttttctttcgtagttttggtttttcactcctgtccagtctatttattattcaaataggaaaaattactttacaggttgttttactgtagcttataatgatactgtagttattccagttactagtttactgtcagagggctgcctttttcagataaatattgacataataactgaagttatttttataagaaaatcaagtatataaatctaggaaagggatcttctagtttctgtgttgtttagactcaaagaatcacaaatttgtcagtaacatgtagttgtttagttataattcagagtgtacagaatggtaaaaattccaatcagtcaaaagaggtcaatgaattaaaaggcttgcaactttttcaaaaacctgttagaatatgctttattgtgttttgaggagttttcctttttttcttttcaatatcactttatcctgctcaccagtatttcctcataagggttattatagccataattaatgttaaaatagactttgttcttcatattctcccatctttttcgctactatatactctgtctggattctgctgtatgcctgttggcatatatggaacagtcaccacttgtcacacttaacaccagctttttgaattatgatcagtaatggcaagagcctttcattctcgaatgtttaaagcctaggagttctacaaaattggcttctttctacaagaatcccaaaatggaatgcctaaagaagtcttacttgggtaaatacttactaaaatatactggttatgtgcatatcaccacactggacactgaggagtgttcaaaaggaatctaagacatggtccccatcttccaactgtctgtaattcactgttttgtcattgagctcataaggtacttacattactacctataaatgtttcctgtacttgttagttgttgagaaacattttaggcagtaaataaaatagtaaatattatgtgtcctataatttgacctaagctgtgtgcctttggaatcagctctaagccagggccccctgggagtcatgttaagaaacacgtatcataaagtgacatacatcaaggttatcttatatagtcataacagtattattgggtctttcaaaaacagctggcagattgagcttttaatggctatattgatacagtagatagagcacctctaaggagtaccaggtataatgtgccatttctctcagcaacaccatttttgtgtgcagctgaccctctaacatggtatcaattctagctgaccaaagcacattctatcaggcagccaggcttggaaattaggtccatttaaagtatgtggcttacagtcaggtatggtggtgtgcgcctattgtcccatctacttgagaggctgaggcaggagggattgcttgggctcaggattttgaatccagcctgggcaacatagcaagaccccatctctaataaataaattatgttttgggcattaatgatgtttgtctattctgatttctcaaattttatttaggtctttcatagcttttttatttaaaggtatatgattaagataaaggaaaagtaaaatgaaatgtttatgtaattttatattctcaaaattttctttaaatttgctctgttttctgacagtgctcaaagtgggaatttttttagaagtacggttatcaaaaaaacacatttcctatgggacacacatttcaaagatgtttagtacgataaaatttttagtaaaagggtagcacttttaagtcatttgaatagaatatttgtgtaatatttagtctagtgttagtccttaaatctgccaacaaaaccagatagatgtcttaaagtaggcacatttattccattgtgactgttaagaaataataaaagattaaattaacaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:54431 -> Molecular function: GO:0001671 [ATPase activator activity] evidence: ISS
            GeneID:54431 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:54431 -> Molecular function: GO:0009055 [electron carrier activity] evidence: IEA
            GeneID:54431 -> Molecular function: GO:0015035 [protein disulfide oxidoreductase activity] evidence: IEA
            GeneID:54431 -> Molecular function: GO:0015036 [disulfide oxidoreductase activity] evidence: ISS
            GeneID:54431 -> Molecular function: GO:0051087 [chaperone binding] evidence: IDA
            GeneID:54431 -> Molecular function: GO:0051117 [ATPase binding] evidence: IPI
            GeneID:54431 -> Molecular function: GO:0051787 [misfolded protein binding] evidence: IDA
            GeneID:54431 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
            GeneID:54431 -> Biological process: GO:0006662 [glycerol ether metabolic process] evidence: IEA
            GeneID:54431 -> Biological process: GO:0030433 [ER-associated protein catabolic process] evidence: IMP
            GeneID:54431 -> Biological process: GO:0032781 [positive regulation of ATPase activity] evidence: ISS
            GeneID:54431 -> Biological process: GO:0034976 [response to endoplasmic reticulum stress] evidence: IDA
            GeneID:54431 -> Biological process: GO:0045454 [cell redox homeostasis] evidence: IEA
            GeneID:54431 -> Biological process: GO:0070059 [intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress] evidence: IDA
            GeneID:54431 -> Cellular component: GO:0005576 [extracellular region] evidence: IEA
            GeneID:54431 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
            GeneID:54431 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: IEA
            GeneID:54431 -> Cellular component: GO:0034663 [endoplasmic reticulum chaperone complex] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.