2024-04-25 20:08:29, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001271098 1945 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens poly-U binding splicing factor 60KDa (PUF60), transcript variant 6, mRNA. ACCESSION NM_001271098 VERSION NM_001271098.1 GI:402794154 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1945) AUTHORS Kajiwara,T., Matsushita,K., Itoga,S., Tamura,M., Tanaka,N., Tomonaga,T., Matsubara,H., Shimada,H., Habara,Y., Matsuo,M. and Nomura,F. TITLE SAP155-mediated c-myc suppressor far-upstream element-binding protein-interacting repressor splicing variants are activated in colon cancer tissues JOURNAL Cancer Sci. 104 (2), 149-156 (2013) PUBMED 23113893 REMARK GeneRIF: Circulating FIR variant mRNA in the peripheral blood of cancer patients were significantly overexpressed compared to that in healthy volunteers. REFERENCE 2 (bases 1 to 1945) AUTHORS Matsushita,K., Kajiwara,T., Tamura,M., Satoh,M., Tanaka,N., Tomonaga,T., Matsubara,H., Shimada,H., Yoshimoto,R., Ito,A., Kubo,S., Natsume,T., Levens,D., Yoshida,M. and Nomura,F. TITLE SAP155-mediated splicing of FUSE-binding protein-interacting repressor serves as a molecular switch for c-myc gene expression JOURNAL Mol. Cancer Res. 10 (6), 787-799 (2012) PUBMED 22496461 REMARK GeneRIF: Data indicate that altered FIR and c-myc pre-mRNA splicing, in addition to c-Myc expression by augmented FIR/FIRDeltaexon2-SAP155 complex, potentially contribute to colorectal cancer development. REFERENCE 3 (bases 1 to 1945) AUTHORS Hsiao,H.H., Nath,A., Lin,C.Y., Folta-Stogniew,E.J., Rhoades,E. and Braddock,D.T. TITLE Quantitative characterization of the interactions among c-myc transcriptional regulators FUSE, FBP, and FIR JOURNAL Biochemistry 49 (22), 4620-4634 (2010) PUBMED 20420426 REMARK GeneRIF: FIR is monomeric in solution but dimerizes upon DNA binding; DNA-induced dimerization is mediated by FIR's RNA recognition motif. REFERENCE 4 (bases 1 to 1945) AUTHORS Matsushita,K., Tomonaga,T., Kajiwara,T., Shimada,H., Itoga,S., Hiwasa,T., Kubo,S., Ochiai,T., Matsubara,H. and Nomura,F. TITLE c-myc suppressor FBP-interacting repressor for cancer diagnosis and therapy JOURNAL Front. Biosci. 14, 3401-3408 (2009) PUBMED 19273283 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1945) AUTHORS Matsushita,K., Tomonaga,T., Shimada,H., Shioya,A., Higashi,M., Matsubara,H., Harigaya,K., Nomura,F., Libutti,D., Levens,D. and Ochiai,T. TITLE An essential role of alternative splicing of c-myc suppressor FUSE-binding protein-interacting repressor in carcinogenesis JOURNAL Cancer Res. 66 (3), 1409-1417 (2006) PUBMED 16452196 REFERENCE 6 (bases 1 to 1945) AUTHORS Poleev,A., Hartmann,A. and Stamm,S. TITLE A trans-acting factor, isolated by the three-hybrid system, that influences alternative splicing of the amyloid precursor protein minigene JOURNAL Eur. J. Biochem. 267 (13), 4002-4010 (2000) PUBMED 10866799 REFERENCE 7 (bases 1 to 1945) AUTHORS Liu,J., He,L., Collins,I., Ge,H., Libutti,D., Li,J., Egly,J.M. and Levens,D. TITLE The FBP interacting repressor targets TFIIH to inhibit activated transcription JOURNAL Mol. Cell 5 (2), 331-341 (2000) PUBMED 10882074 REFERENCE 8 (bases 1 to 1945) AUTHORS Bouffard,P., Barbar,E., Briere,F. and Boire,G. TITLE Interaction cloning and characterization of RoBPI, a novel protein binding to human Ro ribonucleoproteins JOURNAL RNA 6 (1), 66-78 (2000) PUBMED 10668799 REFERENCE 9 (bases 1 to 1945) AUTHORS Page-McCaw,P.S., Amonlirdviman,K. and Sharp,P.A. TITLE PUF60: a novel U2AF65-related splicing activity JOURNAL RNA 5 (12), 1548-1560 (1999) PUBMED 10606266 REFERENCE 10 (bases 1 to 1945) AUTHORS Bouffard,P., Briere,F., Wellinger,R.J. and Boire,G. TITLE Identification of ribonucleoprotein (RNP)-specific protein interactions using a yeast RNP interaction trap assay (RITA) JOURNAL BioTechniques 27 (4), 790-796 (1999) PUBMED 10524322 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN371576.1, AL522753.3, AC105219.6, AF217197.2 and AW249619.1. Summary: This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]. Transcript Variant: This variant (6) uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (f) is shorter than isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-55 CN371576.1 4-58 56-146 AL522753.3 6-96 147-147 AC105219.6 4438-4438 148-826 AL522753.3 98-776 827-1903 AF217197.2 706-1782 1904-1945 AW249619.1 1-42 c FEATURES Location/Qualifiers source 1..1945 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q24.3" gene 1..1945 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="poly-U binding splicing factor 60KDa" /db_xref="GeneID:22827" /db_xref="HGNC:17042" /db_xref="MIM:604819" exon 1..107 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" CDS 84..1760 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="isoform f is encoded by transcript variant 6; FBP interacting repressor; pyrimidine tract binding splicing factor; Ro ribonucleoprotein-binding protein 1; FUSE-binding protein-interacting repressor; poly(U)-binding-splicing factor PUF60; Siah binding protein 1" /codon_start=1 /product="poly(U)-binding-splicing factor PUF60 isoform f" /protein_id="NP_001258027.1" /db_xref="GI:402794155" /db_xref="GeneID:22827" /db_xref="HGNC:17042" /db_xref="MIM:604819" /translation="
MATATIALVNGQQGGGSEPAAAAAVVAAGDKWKPPQGTDSIKMENGQSTAAKLGLPPLTPEQQEALQKAKKYAMEQSIKSVLVKQTIAHQQQQLTNLQMAAVTMGFGDPLSPLQSMAAQRQRALAIMCRVYVGSIYYELGEDTIRQAFAPFGPIKSIDMSWDSVTMKHKGFAFVEYEVPEAAQLALEQMNSVMLGGRNIKVGRPSNIGQAQPIIDQLAEEARAFNRIYVASVHQDLSDDDIKSVFEAFGKIKSCTLARDPTTGKHKGYGFIEYEKAQSSQDAVSSMNLFDLGGQYLRVGKAVTPPMPLLTPATPGGLPPAAAVAAAAATAKITAQEAVAGAAVLGTLGTPGLVSPALTLAQPLGTLPQAVMAAQAPGVITGVTPARPPIPVTIPSVGVVNPILASPPTLGLLEPKKEKEEEELFPESERPEMLSEQEHMSISGSSARHMVMQKLLRKQESTVMVLRNMVDPKDIDDDLEGEVTEECGKFGAVNRVIIYQEKQGEEEDAEIIVKIFVEFSIASETHKAIQALNGRWFAGRKVVAEVYDQERFDNSDLSA
" misc_feature 258..260 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature <264..>539 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="P-loop containing Nucleoside Triphosphate Hydrolases; Region: P-loop_NTPase; cl09099" /db_xref="CDD:213113" misc_feature 309..1757 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); Region: Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction" misc_feature 414..416 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature 468..692 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(474..476,594..596,600..602) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 684..692 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" misc_feature 759..983 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(765..767,885..887,891..893) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 831..833 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); acetylation site" misc_feature 975..983 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" misc_feature 1020..1022 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature 1440..1442 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); acetylation site" misc_feature 1494..1715 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(1620..1622,1626..1628) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 1710..1715 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" exon 108..191 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 161 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="a" /replace="g" /db_xref="dbSNP:11540342" exon 192..287 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 288..377 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 378..428 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 419 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="g" /replace="t" /db_xref="dbSNP:11540341" exon 429..590 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 515 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="c" /replace="t" /db_xref="dbSNP:11540345" exon 591..683 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 684..897 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 898..1088 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 995 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="c" /replace="g" /db_xref="dbSNP:11540343" exon 1089..1224 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 1225..1460 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 1461..1936 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" STS 1558..1808 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /standard_name="WI-19511" /db_xref="UniSTS:31309" STS 1749..1892 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /standard_name="RH70666" /db_xref="UniSTS:37443" polyA_site 1903 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" polyA_site 1936 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" ORIGIN
tccgtgcaccggcacccagatcgcgcgagacagcggaaggagcaagagtgggaggcgcgcgcggaggccgcgacggacgcaagatggcgacggcgaccatagctctcgtcaatggccagcaaggaggggggtccgagccggcggcggcggcggcagtggtggcagcgggagacaaatggaaacctccacagggcacagactccatcaagatggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcagcagtgacaatgggctttggagatcctctctcacctttgcaatcgatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtgacagtggtccctctccccggacttgcacttgttccttgtttcctctgggttttatagtgatacagtggtgtccccggggccaggcgcgctctgcccagcccagcctacagtgcggataaaggtgcggatgctgctggccctgaacgtccgtgtgtctgccgtcggtcctgtcaccgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:22827 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:22827 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:22827 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:22827 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA GeneID:22827 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:22827 -> Biological process: GO:0008380 [RNA splicing] evidence: IEA GeneID:22827 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:22827 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:22827 -> Cellular component: GO:0019907 [cyclin-dependent protein kinase activating kinase holoenzyme complex] evidence: IDA GeneID:22827 -> Cellular component: GO:0030529 [ribonucleoprotein complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.