Home |
Help |
Advanced search
2024-04-26 14:44:50, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001271096 1894 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens poly-U binding splicing factor 60KDa (PUF60),
transcript variant 4, mRNA.
ACCESSION NM_001271096
VERSION NM_001271096.1 GI:402794117
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1894)
AUTHORS Kajiwara,T., Matsushita,K., Itoga,S., Tamura,M., Tanaka,N.,
Tomonaga,T., Matsubara,H., Shimada,H., Habara,Y., Matsuo,M. and
Nomura,F.
TITLE SAP155-mediated c-myc suppressor far-upstream element-binding
protein-interacting repressor splicing variants are activated in
colon cancer tissues
JOURNAL Cancer Sci. 104 (2), 149-156 (2013)
PUBMED 23113893
REMARK GeneRIF: Circulating FIR variant mRNA in the peripheral blood of
cancer patients were significantly overexpressed compared to that
in healthy volunteers.
REFERENCE 2 (bases 1 to 1894)
AUTHORS Matsushita,K., Kajiwara,T., Tamura,M., Satoh,M., Tanaka,N.,
Tomonaga,T., Matsubara,H., Shimada,H., Yoshimoto,R., Ito,A.,
Kubo,S., Natsume,T., Levens,D., Yoshida,M. and Nomura,F.
TITLE SAP155-mediated splicing of FUSE-binding protein-interacting
repressor serves as a molecular switch for c-myc gene expression
JOURNAL Mol. Cancer Res. 10 (6), 787-799 (2012)
PUBMED 22496461
REMARK GeneRIF: Data indicate that altered FIR and c-myc pre-mRNA
splicing, in addition to c-Myc expression by augmented
FIR/FIRDeltaexon2-SAP155 complex, potentially contribute to
colorectal cancer development.
REFERENCE 3 (bases 1 to 1894)
AUTHORS Hsiao,H.H., Nath,A., Lin,C.Y., Folta-Stogniew,E.J., Rhoades,E. and
Braddock,D.T.
TITLE Quantitative characterization of the interactions among c-myc
transcriptional regulators FUSE, FBP, and FIR
JOURNAL Biochemistry 49 (22), 4620-4634 (2010)
PUBMED 20420426
REMARK GeneRIF: FIR is monomeric in solution but dimerizes upon DNA
binding; DNA-induced dimerization is mediated by FIR's RNA
recognition motif.
REFERENCE 4 (bases 1 to 1894)
AUTHORS Matsushita,K., Tomonaga,T., Kajiwara,T., Shimada,H., Itoga,S.,
Hiwasa,T., Kubo,S., Ochiai,T., Matsubara,H. and Nomura,F.
TITLE c-myc suppressor FBP-interacting repressor for cancer diagnosis and
therapy
JOURNAL Front. Biosci. 14, 3401-3408 (2009)
PUBMED 19273283
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1894)
AUTHORS Matsushita,K., Tomonaga,T., Shimada,H., Shioya,A., Higashi,M.,
Matsubara,H., Harigaya,K., Nomura,F., Libutti,D., Levens,D. and
Ochiai,T.
TITLE An essential role of alternative splicing of c-myc suppressor
FUSE-binding protein-interacting repressor in carcinogenesis
JOURNAL Cancer Res. 66 (3), 1409-1417 (2006)
PUBMED 16452196
REFERENCE 6 (bases 1 to 1894)
AUTHORS Poleev,A., Hartmann,A. and Stamm,S.
TITLE A trans-acting factor, isolated by the three-hybrid system, that
influences alternative splicing of the amyloid precursor protein
minigene
JOURNAL Eur. J. Biochem. 267 (13), 4002-4010 (2000)
PUBMED 10866799
REFERENCE 7 (bases 1 to 1894)
AUTHORS Liu,J., He,L., Collins,I., Ge,H., Libutti,D., Li,J., Egly,J.M. and
Levens,D.
TITLE The FBP interacting repressor targets TFIIH to inhibit activated
transcription
JOURNAL Mol. Cell 5 (2), 331-341 (2000)
PUBMED 10882074
REFERENCE 8 (bases 1 to 1894)
AUTHORS Bouffard,P., Barbar,E., Briere,F. and Boire,G.
TITLE Interaction cloning and characterization of RoBPI, a novel protein
binding to human Ro ribonucleoproteins
JOURNAL RNA 6 (1), 66-78 (2000)
PUBMED 10668799
REFERENCE 9 (bases 1 to 1894)
AUTHORS Page-McCaw,P.S., Amonlirdviman,K. and Sharp,P.A.
TITLE PUF60: a novel U2AF65-related splicing activity
JOURNAL RNA 5 (12), 1548-1560 (1999)
PUBMED 10606266
REFERENCE 10 (bases 1 to 1894)
AUTHORS Bouffard,P., Briere,F., Wellinger,R.J. and Boire,G.
TITLE Identification of ribonucleoprotein (RNP)-specific protein
interactions using a yeast RNP interaction trap assay (RITA)
JOURNAL BioTechniques 27 (4), 790-796 (1999)
PUBMED 10524322
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CN371576.1, BX418925.2,
AC105219.6, AF217197.2 and AW249619.1.
Summary: This gene encodes a nucleic acid-binding protein that
plays a role in a variety of nuclear processes, including pre-mRNA
splicing and transcriptional regulation. The encoded protein forms
a complex with the far upstream DNA element (FUSE) and FUSE-binding
protein at the myelocytomatosis oncogene (MYC) promoter. This
complex represses MYC transcription through the core-TFIIH basal
transcription factor. Alternatively spliced transcript variants
encoding multiple isoforms have been observed for this gene.
[provided by RefSeq, Aug 2012].
Transcript Variant: This variant (4) uses an alternate in-frame
splice site and lacks an alternate exon in the coding region,
compared to variant 1, but maintains the reading frame. The encoded
isoform (d) is shorter than isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
[ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-48 CN371576.1 4-51
49-124 BX418925.2 1-76
125-147 AC105219.6 4416-4438
148-973 BX418925.2 100-925
974-1852 AF217197.2 904-1782
1853-1894 AW249619.1 1-42 c
FEATURES Location/Qualifiers
source 1..1894
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q24.3"
gene 1..1894
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="poly-U binding splicing factor 60KDa"
/db_xref="GeneID:22827"
/db_xref="HGNC:17042"
/db_xref="MIM:604819"
exon 1..107
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
CDS 84..1709
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="isoform d is encoded by transcript variant 4; FBP
interacting repressor; pyrimidine tract binding splicing
factor; Ro ribonucleoprotein-binding protein 1;
FUSE-binding protein-interacting repressor;
poly(U)-binding-splicing factor PUF60; Siah binding
protein 1"
/codon_start=1
/product="poly(U)-binding-splicing factor PUF60 isoform d"
/protein_id="NP_001258025.1"
/db_xref="GI:402794118"
/db_xref="GeneID:22827"
/db_xref="HGNC:17042"
/db_xref="MIM:604819"
/translation="
MATATIALVNGQQGGGSEPAAAAAVVAAGDKWKPPQGTDSIKMENGQSTAAKLGLPPLTPEQQEALQKAKKYAMEQSIKSVLVKQTIAHQQQQLTNLQMAAQRQRALAIMCRVYVGSIYYELGEDTIRQAFAPFGPIKSIDMSWDSVTMKHKGFAFVEYEVPEAAQLALEQMNSVMLGGRNIKVGRPSNIGQAQPIIDQLAEEARAFNRIYVASVHQDLSDDDIKSVFEAFGKIKSCTLARDPTTGKHKGYGFIEYEKAQSSQDAVSSMNLFDLGGQYLRVGKAVTPPMPLLTPATPGGLPPAAAVAAAAATAKITAQEAVAGAAVLGTLGTPGLVSPALTLAQPLGTLPQAVMAAQAPGVITGVTPARPPIPVTIPSVGVVNPILASPPTLGLLEPKKEKEEEELFPESERPEMLSEQEHMSISGSSARHMVMQKLLRKQESTVMVLRNMVDPKDIDDDLEGEVTEECGKFGAVNRVIIYQEKQGEEEDAEIIVKIFVEFSIASETHKAIQALNGRWFAGRKVVAEVYDQERFDNSDLSA
"
misc_feature 417..641
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(423..425,543..545,549..551)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 633..641
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 708..932
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(714..716,834..836,840..842)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 924..932
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 1443..1664
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(1569..1571,1575..1577)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 1659..1664
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
exon 108..191
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 161
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11540342"
exon 192..287
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 288..377
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 378..539
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 464
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11540345"
exon 540..632
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 633..846
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 847..1037
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 944
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:11540343"
exon 1038..1173
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 1174..1409
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 1410..1885
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
STS 1507..1757
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/standard_name="WI-19511"
/db_xref="UniSTS:31309"
STS 1698..1841
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/standard_name="RH70666"
/db_xref="UniSTS:37443"
polyA_site 1852
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
polyA_site 1885
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
ORIGIN
tccgtgcaccggcacccagatcgcgcgagacagcggaaggagcaagagtgggaggcgcgcgcggaggccgcgacggacgcaagatggcgacggcgaccatagctctcgtcaatggccagcaaggaggggggtccgagccggcggcggcggcggcagtggtggcagcgggagacaaatggaaacctccacagggcacagactccatcaagatggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtgacagtggtccctctccccggacttgcacttgttccttgtttcctctgggttttatagtgatacagtggtgtccccggggccaggcgcgctctgcccagcccagcctacagtgcggataaaggtgcggatgctgctggccctgaacgtccgtgtgtctgccgtcggtcctgtcaccgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:22827 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:22827 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:22827 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:22827 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA
GeneID:22827 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:22827 -> Biological process: GO:0008380 [RNA splicing] evidence: IEA
GeneID:22827 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:22827 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:22827 -> Cellular component: GO:0019907 [cyclin-dependent protein kinase activating kinase holoenzyme complex] evidence: IDA
GeneID:22827 -> Cellular component: GO:0030529 [ribonucleoprotein complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.