GGRNA Home | Help | Advanced search

2020-10-24 07:24:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001271044            5545 bp    mRNA    linear   PRI 22-JUN-2013
DEFINITION  Homo sapiens nuclear factor I/X (CCAAT-binding transcription
            factor) (NFIX), transcript variant 3, mRNA.
ACCESSION   NM_001271044
VERSION     NM_001271044.1  GI:402534521
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5545)
  AUTHORS   Lee,H.J., Woo,H.G., Greenwood,T.A., Kripke,D.F. and Kelsoe,J.R.
  TITLE     A genome-wide association study of seasonal pattern mania
            identifies NF1A as a possible susceptibility gene for bipolar
            disorder
  JOURNAL   J Affect Disord 145 (2), 200-207 (2013)
   PUBMED   22925353
REFERENCE   2  (bases 1 to 5545)
  AUTHORS   Yoneda,Y., Saitsu,H., Touyama,M., Makita,Y., Miyamoto,A.,
            Hamada,K., Kurotaki,N., Tomita,H., Nishiyama,K., Tsurusaki,Y.,
            Doi,H., Miyake,N., Ogata,K., Naritomi,K. and Matsumoto,N.
  TITLE     Missense mutations in the DNA-binding/dimerization domain of NFIX
            cause Sotos-like features
  JOURNAL   J. Hum. Genet. 57 (3), 207-211 (2012)
   PUBMED   22301465
  REMARK    GeneRIF: missense mutations in NFIX were able to cause Sotos-like
            features.
REFERENCE   3  (bases 1 to 5545)
  AUTHORS   Lee,H., Jaffe,A.E., Feinberg,J.I., Tryggvadottir,R., Brown,S.,
            Montano,C., Aryee,M.J., Irizarry,R.A., Herbstman,J., Witter,F.R.,
            Goldman,L.R., Feinberg,A.P. and Fallin,M.D.
  TITLE     DNA methylation shows genome-wide association of NFIX, RAPGEF2 and
            MSRB3 with gestational age at birth
  JOURNAL   Int J Epidemiol 41 (1), 188-199 (2012)
   PUBMED   22422452
  REMARK    GeneRIF: DNA methylation shows genome-wide association of NFIX,
            RAPGEF2 and MSRB3 with gestational age at birth.
REFERENCE   4  (bases 1 to 5545)
  AUTHORS   Singh,S.K., Bhardwaj,R., Wilczynska,K.M., Dumur,C.I. and Kordula,T.
  TITLE     A complex of nuclear factor I-X3 and STAT3 regulates astrocyte and
            glioma migration through the secreted glycoprotein YKL-40
  JOURNAL   J. Biol. Chem. 286 (46), 39893-39903 (2011)
   PUBMED   21953450
  REMARK    GeneRIF: NFI-X3 and STAT3 control the migration of differentiating
            astrocytes as well as migration and invasion of glioma cells via
            regulating YKL-40 expression.
REFERENCE   5  (bases 1 to 5545)
  AUTHORS   Singh,S.K., Wilczynska,K.M., Grzybowski,A., Yester,J., Osrah,B.,
            Bryan,L., Wright,S., Griswold-Prenner,I. and Kordula,T.
  TITLE     The unique transcriptional activation domain of nuclear factor-I-X3
            is critical to specifically induce marker gene expression in
            astrocytes
  JOURNAL   J. Biol. Chem. 286 (9), 7315-7326 (2011)
   PUBMED   21189253
  REMARK    GeneRIF: NFI-X3 activates GFAP expression, in part, by inducing
            alterations in the nucleosome architecture that lead to the
            increased recruitment of RNA polymerase II
REFERENCE   6  (bases 1 to 5545)
  AUTHORS   Wendler,W.M., Kremmer,E., Forster,R. and Winnacker,E.L.
  TITLE     Identification of pirin, a novel highly conserved nuclear protein
  JOURNAL   J. Biol. Chem. 272 (13), 8482-8489 (1997)
   PUBMED   9079676
REFERENCE   7  (bases 1 to 5545)
  AUTHORS   Sumner,C., Shinohara,T., Durham,L., Traub,R., Major,E.O. and
            Amemiya,K.
  TITLE     Expression of multiple classes of the nuclear factor-1 family in
            the developing human brain: differential expression of two classes
            of NF-1 genes
  JOURNAL   J. Neurovirol. 2 (2), 87-100 (1996)
   PUBMED   8799200
REFERENCE   8  (bases 1 to 5545)
  AUTHORS   Qian,F., Kruse,U., Lichter,P. and Sippel,A.E.
  TITLE     Chromosomal localization of the four genes (NFIA, B, C, and X) for
            the human transcription factor nuclear factor I by FISH
  JOURNAL   Genomics 28 (1), 66-73 (1995)
   PUBMED   7590749
REFERENCE   9  (bases 1 to 5545)
  AUTHORS   Apt,D., Liu,Y. and Bernard,H.U.
  TITLE     Cloning and functional analysis of spliced isoforms of human
            nuclear factor I-X: interference with transcriptional activation by
            NFI/CTF in a cell-type specific manner
  JOURNAL   Nucleic Acids Res. 22 (19), 3825-3833 (1994)
   PUBMED   7937100
REFERENCE   10 (bases 1 to 5545)
  AUTHORS   Seisenberger,C., Winnacker,E.L. and Scherthan,H.
  TITLE     Localisation of the human nuclear factor I/X (NFI/X) gene to
            chromosome 19p13 and detection of five other related loci at
            1p21-22, 1q42-43, 5q15, 11p13 and 20q13 by FISH
  JOURNAL   Hum. Genet. 91 (6), 535-537 (1993)
   PUBMED   8340106
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP228658.1, U18759.1 and
            AC007787.1.
            
            Summary: The protein encoded by this gene is a transcription factor
            that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral
            and cellular promoters. The encoded protein can also stimulate
            adenovirus replication in vitro. Three transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Aug 2012].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and
            coding sequence and lacks an alternate 3' exon compared to variant
            1, that causes a frameshift. The resulting isoform (3) has shorter
            and distinct N- and C-termini compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U18759.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-25                BP228658.1         1-25
            26-1460             U18759.1           6-1440
            1461-5545           AC007787.1         32308-36392
FEATURES             Location/Qualifiers
     source          1..5545
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.3"
     gene            1..5545
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="nuclear factor I/X (CCAAT-binding transcription
                     factor)"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
     exon            1..64
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     CDS             62..1363
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="isoform 3 is encoded by transcript variant 3;
                     nuclear factor 1 X-type; CTF; NF1-X; NF-I/X; nuclear
                     factor 1/X; TGGCA-binding protein; CCAAT-box-binding
                     transcription factor"
                     /codon_start=1
                     /product="nuclear factor 1 X-type isoform 3"
                     /protein_id="NP_001257973.1"
                     /db_xref="GI:402534522"
                     /db_xref="CCDS:CCDS59359.1"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
                     /translation="
MDEFHPFIEALLPHVRAFSYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKPEIKQKWASRLLAKLRKDIRPEFREDFVLTITGKKPPCCVLSNPDQKGKIRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLYKSPQCSNPGLCVQPHHIGVTIKELDLYLAYFVHTPESGQSDSSNQQGDADIKPLPNGHLSFQDCFVTSGVWNVTELVRVSQTPVATASGPNFSLADLESPSYYNINQVTLGRRSITSPPSTSTTKRPKSIDDSEMESPVDDVFYPGTGRSPAAGSSQSSGWPNDVDAGPASLKKSGKLDFCSALSSQGSSPRMAFTHHPLPVLAGVRPGSPRATASALHFPSTSIIQQSSPYFTHPTIRYHHHHGQDSLKEFVQFVCSDGSGQATGQHSQRQAPPLPTGLSASDPGTATF
"
     misc_feature    65..175
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="Nuclear factor I protein pre-N-terminus; Region:
                     NfI_DNAbd_pre-N; pfam10524"
                     /db_xref="CDD:151076"
     misc_feature    239..547
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="N-terminal Mad Homology 1 (MH1) domain; Region:
                     MH1; cl00055"
                     /db_xref="CDD:241576"
     misc_feature    674..>1345
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="CTF/NF-I family transcription modulation region;
                     Region: CTF_NFI; pfam00859"
                     /db_xref="CDD:144451"
     exon            65..596
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       109
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368774795"
     variation       154
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148229471"
     variation       170
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:5827175"
     variation       178
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375719449"
     variation       190
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150443437"
     variation       216
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907254"
     variation       220
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369196245"
     STS             236..480
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="NFIX"
                     /db_xref="UniSTS:504112"
     variation       295
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375310739"
     variation       301
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373938156"
     variation       346
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376885081"
     variation       347
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370482598"
     variation       397
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369056833"
     variation       399
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:387907255"
     variation       419..420
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gggggg"
                     /db_xref="dbSNP:149894387"
     variation       426
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200603126"
     variation       430
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200313486"
     variation       505
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199762875"
     STS             527..1376
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="Nfix"
                     /db_xref="UniSTS:507089"
     variation       593
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372477615"
     exon            597..659
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       605
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907253"
     variation       637
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367591626"
     exon            660..734
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     exon            735..855
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       778
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201664313"
     variation       823
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199590032"
     variation       850
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369151512"
     exon            856..992
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       880
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201741871"
     variation       888
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113721268"
     variation       892
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047135"
     variation       936
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374776005"
     variation       970
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199631786"
     variation       979
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372881529"
     exon            993..1115
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1060
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373603800"
     variation       1061
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61754992"
     exon            1116..1291
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1177
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201174259"
     variation       1264
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374101865"
     variation       1273
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367955217"
     variation       1285
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372077833"
     exon            1292..1383
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1297
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372257657"
     variation       1338
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200499751"
     variation       1351
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287066"
     exon            1384..5545
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1471
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047144"
     variation       1556..1557
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34095276"
     STS             1589..1709
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH91530"
                     /db_xref="UniSTS:86722"
     variation       1637
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375166012"
     variation       1655
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144975330"
     variation       1676
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183935392"
     STS             1683..1890
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH18298"
                     /db_xref="UniSTS:30706"
     variation       1730
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112643821"
     variation       1957
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10416646"
     variation       2047
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57359947"
     variation       2118
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375305695"
     variation       2150
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80090842"
     variation       2250..2269
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gagggcctccttcctgccac"
                     /db_xref="dbSNP:375140220"
     variation       2263
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369047813"
     variation       2423
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145814634"
     variation       2538..2539
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34337363"
     variation       2542..2543
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:5827180"
     variation       2586
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77607471"
     variation       2645
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113027509"
     variation       2646
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111560188"
     variation       2718
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188413501"
     variation       2749
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181608618"
     variation       2811
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372616189"
     variation       2815..2816
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201158408"
     variation       2816
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35992708"
     variation       2960
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148149655"
     variation       2961..2964
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="tctc"
                     /db_xref="dbSNP:199726177"
     variation       2962..2965
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="ctct"
                     /db_xref="dbSNP:377649271"
     variation       3081
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555273"
     variation       3107
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367898239"
     variation       3117
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113396930"
     variation       3128
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184187752"
     variation       3166
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61270571"
     variation       3216
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369984914"
     variation       3219
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555274"
     variation       3332
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376300898"
     variation       3641
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:71798576"
     variation       3700
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:112879585"
     variation       3705..3706
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:71841362"
     variation       3808..3809
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:142626844"
     variation       3917
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190683071"
     variation       3937..3938
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71719751"
     variation       3937
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:112478002"
     variation       4007
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182072517"
     polyA_signal    4224..4229
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      4255
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     variation       4400
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150757731"
     variation       4472
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117198656"
     variation       4612
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75550675"
     variation       4672
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:10419483"
     variation       4718
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137978145"
     variation       5091
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186285075"
     variation       5098..5099
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34291647"
     variation       5356
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112707286"
     polyA_signal    5517..5522
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_signal    5525..5530
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      5545
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
ORIGIN      
aactcttttgagtccagaatctcagaatcgggcgttgggctttgccgggtgcttcagatcaatggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagctgctgggcgagaagcccgagatcaagcagaagtgggcatcccggctgctggccaagctgcgcaaggacatccggcccgagttccgcgaggacttcgtgctgaccatcacgggcaagaagcccccctgctgcgtgctctccaaccccgaccagaagggcaagatccggcggattgactgcctgcgccaggctgacaaggtgtggcggctggacctggtcatggtgattttgtttaaggggatccccctggaaagtactgatggggagcggctctacaagtcgcctcagtgctcgaaccccggcctgtgcgtccagccacatcacattggagtcacaatcaaagaactggatctttatctggcttactttgtccacactccggaatccggacaatcagatagttcaaaccagcaaggagatgcggacatcaaaccactgcccaacgggcacttaagtttccaggactgttttgtgacttccggggtctggaatgtgacggagctggtgagagtatcacagactcctgttgcaacagcatcagggcccaacttctccctggcggacctggagagtcccagctactacaacatcaaccaggtgaccctggggcggcggtccatcacctcccctccttccaccagcaccaccaagcgccccaagtccatcgatgacagtgagatggagagccctgttgatgacgtgttctatcccgggacaggccgttccccagcagctggcagcagccagtccagcgggtggcccaacgatgtggatgcaggcccggcttctctaaagaagtcaggaaagctggacttctgcagtgccctctcctctcagggcagctccccgcgcatggctttcacccaccacccgctgcctgtgcttgctggagtcagaccagggagcccccgggccacagcatcagccctgcacttcccctccacgtccatcatccagcagtcgagcccgtatttcacgcacccgaccatccgctaccaccaccaccacgggcaggactcactgaaggagtttgtgcagtttgtgtgctcggatggctcgggccaggccaccggacagcattcgcaacgacaggcgcctcctctgccaaccggtttgtcagcatcggaccccgggacggcaactttctgaacatcccacagcagtctcagtcctggttcctctgataagatcgacaaaagaaacaacaaaatgagaagaagaggttcctcgaaaggggggagaagaaattttgagaatggaaaaatcccccagcccagcccagccccaccgaaaagcaaaaattacacgtcgtcagccactcagcccttctctcctccagcccggggacccccgcgggccccagaagcagcccagttctcagagagcccttggaaggggtctcggtggagctgtgcaccagcagccaagcagaaagaaacacgcgacatggactctgtcaagtagaggacagaaagcaagaaaggatgcagaactgccttcctccccctgaccccgccccggccttctggggaaggaacaaagtccccaaacaaagcaaccagcacaattctgaaggggcctggcctccaccctcaccccttcctaggggaaccccaccctccacacagccggagctgccctagggagcctggagggccagcttgtaaagatgatggggtttagatccctcaggctctcccctccagactccgcccttccctccctccctccctccctccctctctgccaaggctccagcttcttcccccagctgctcccgaccaggagggggagagcagcctccacttaccccaccccacccttgggctaaaagcccccaggcgggcagggggtgacccctggagctagttgcgtgtcccagaatggagggtgttctgacaccccaccctgagccgcaagagcagtcctggggccctggacccctctgtacagtccgtaggaaaaagtcggaatgctctcgacggcctcgtcccagcctgggacaggccccctttcccctctctctgcaggccaggagggcctccttcctgccacgagggaggggagtcgggccccaggtcgcccccgcccccagccctgcatgcaggtgccctcgctccgccccatcagttcctgcccctgcccctcatgcagactgccctgctggggccgggccggagggtggagcagaaaggggaccccggagccgagcgaggaggaccaggcagccgccgctgccgcgctaagccaccacctgcgcttaggtaggcgtcctgctcgccgactttcagttccttgggagggtgttgggtgtcgtccttttcaaaagtgttttggagctttctgtgccccccgactttcccccgcctccccgccccccacgtggccacttttctctggattttagctgtaatgtctttactctttatttaggggtggggcattcattgtttgggtcttttgctgttggaatgggaactcctcctccatttgagcaacttgggaacaatttggtaacacaccacaggaagtagctctcccccccagccccctcctccctcaagggagggttggggggcctgtccagagggtcttcagaagcccccctgggagggaggggaggatgagcacgcccagctcccctccagggtgtgacttggcccctctggcttgtctttctgtgccttactcctcctcctgcgtctcccgttcctggccccttcttgagtccttgtgcctctctctttctctctctttcttaattgtatgaaaacacaaagcacaggtcaggatcctctgagagaaaatcaacattgcaccacgtaggggtgggctatgggctgtatttattgtgaatctagtttgtgaggctgtggccccgagctggcggagggagggaagaggagggagtgacgggaggggaggaggtcagcgacctggggccgtagcggcaggcgaacggtgcctgctacccagctggaagccacaaggtggctggctccaggggcggcttttgttggaagttgagtgaagccctccccctgtcctcagcgtgcagccctagaggaccccagggctgaggggcagtggatcctgcgggagtctcccggggcgtggggagtaaggccccgggggtggggggccgggtgggccgggcgtgacgcgcggtcaaagtgcaatgatttttcagttcggttggctaaacagggtcagagctgagagcgaagcagaaggggctccctgtccggcccacgtgccctttccctcgacgacagtcgagggctcgggctctgtgggactgtgggagctagggtctgcggggcgcctgcccgggcgaggtcggaagctgcaggccagctgggcccgggccggagcgtgcccggcggggctgcccgggcgggcagggggtgggggctgctcctttcccaagtggtgttgtgaggggcaatgagggcaacaggagatgtggggacgtgttaggagagaaaaaaaaaaaaacaaaaatatatatgggggaaattaacttttttttttcattgaaccaagtgcaatgcatcagagagttttcctatctttgtatgttaagagattaagaaaaaaaaattctatttttgttgtaatgtcctcgcggctctggggacgctaaaagaaccgggcctgccccgccctgcgcggggataacgaaagctgagtgtttttcccttttttttgttcgtttttagtttttttttttttaagtcgttttcctgcgttgacgaggatgatctggggtttttatttgtttcgtcgttcgttctgtttcggtgggagggctgaaggaaacgttcacattttagagtttaaaaaaaacacctcgacatttaaaaaatcaaccaacacaagatcaaaaaggaaaaggacgagagaaaaattatttttaagataattaaacataaaaccctggtgcttcttacattataaagtacgttttaaagaacccacaaactattatacataagtttatgaatcaattaaatatcctgcacttgttaggaatacgcatatcccttctttgttgagtttaacggaacgggacagcggcgtgcccccggcggctggactgctccggccgcgggtctccccgggcgcccctccctggggcccagcacccctcctcgccccatccccgtccgggtacgggggcgcggcaggggtccccggcccctcccccgcagaggtcaatgccaacgaacaaacgtcccctccctccctccctctccgccccgagcgcccttctttgagccagacgccaacttgaccctcaccagcattatcaggagcgcgctcagcaagttggtagtttcctcccccctttcccggcgcccctcccgcccccattcaacatctctcatcctatccccgaccccctccggggaacaccgggaaggctcgacgctccaggacaggaccagccacgcagacaggtcgatttgcccaggcccgcgcccgcacgcacgcacgcacacggccccgcacacagccccgccccaccccgcaaccagccctgtcgactgccttatacacccgcccccgcgctggccggccgacctagtgccttgttctcacccccgtgctggcggagcggacgccgcgctctgggtcccagaggggccgggtggctcagacgacccaccactcccccaccctgaccgtgctgaacagacccccccacacgagagaaaataaaggagcaataaagtcacgagaactttcgtcccccaatcgagagcccgaggggcaccccagccccgcctctgctcccccccaccccacccaccctcggggcgcccccctccccccgcaagccagcctgggccagccccgcttcggcccctcccgggagatccgtgcgcccgaccagcaccagcatcgcggaccgcaaaggccgcccgtcccgtcaaacaagtttcttcttaggctaagaaacgcagtatatacgagtatctctatatatagtactaatggatttggtgtgcttcccccttagcgtccccctccctctgctcctcctccttcagcctggtctccccctcttctctgccctccacccccgtctctgcactgagatacataagaaacaagggtagtttactgtctgttttgttttctgggttttcagtgtcctagcggaatgcaagtaggcagccagcccgtctgttccctctccgccccgccccgccccgcccccgtcactgcgcttctgttataccatctttgcctgactctctccggcttctccattgaatggctaatgtgtatgtgaaataaagaaataaagaaaaacaaacgcga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4784 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:4784 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Molecular function: GO:0003705 [RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0006260 [DNA replication] evidence: IEA
            GeneID:4784 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:4784 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA
            GeneID:4784 -> Biological process: GO:0021707 [cerebellar granule cell differentiation] evidence: IEA
            GeneID:4784 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0048708 [astrocyte differentiation] evidence: IEA
            GeneID:4784 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.