GGRNA Home | Help | Advanced search

2020-10-24 07:23:34, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001271043            5733 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens nuclear factor I/X (CCAAT-binding transcription
            factor) (NFIX), transcript variant 1, mRNA.
ACCESSION   NM_001271043
VERSION     NM_001271043.1  GI:402534519
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5733)
  AUTHORS   Lee,H.J., Woo,H.G., Greenwood,T.A., Kripke,D.F. and Kelsoe,J.R.
  TITLE     A genome-wide association study of seasonal pattern mania
            identifies NF1A as a possible susceptibility gene for bipolar
            disorder
  JOURNAL   J Affect Disord 145 (2), 200-207 (2013)
   PUBMED   22925353
REFERENCE   2  (bases 1 to 5733)
  AUTHORS   Yoneda,Y., Saitsu,H., Touyama,M., Makita,Y., Miyamoto,A.,
            Hamada,K., Kurotaki,N., Tomita,H., Nishiyama,K., Tsurusaki,Y.,
            Doi,H., Miyake,N., Ogata,K., Naritomi,K. and Matsumoto,N.
  TITLE     Missense mutations in the DNA-binding/dimerization domain of NFIX
            cause Sotos-like features
  JOURNAL   J. Hum. Genet. 57 (3), 207-211 (2012)
   PUBMED   22301465
  REMARK    GeneRIF: missense mutations in NFIX were able to cause Sotos-like
            features.
REFERENCE   3  (bases 1 to 5733)
  AUTHORS   Lee,H., Jaffe,A.E., Feinberg,J.I., Tryggvadottir,R., Brown,S.,
            Montano,C., Aryee,M.J., Irizarry,R.A., Herbstman,J., Witter,F.R.,
            Goldman,L.R., Feinberg,A.P. and Fallin,M.D.
  TITLE     DNA methylation shows genome-wide association of NFIX, RAPGEF2 and
            MSRB3 with gestational age at birth
  JOURNAL   Int J Epidemiol 41 (1), 188-199 (2012)
   PUBMED   22422452
  REMARK    GeneRIF: DNA methylation shows genome-wide association of NFIX,
            RAPGEF2 and MSRB3 with gestational age at birth.
REFERENCE   4  (bases 1 to 5733)
  AUTHORS   Singh,S.K., Bhardwaj,R., Wilczynska,K.M., Dumur,C.I. and Kordula,T.
  TITLE     A complex of nuclear factor I-X3 and STAT3 regulates astrocyte and
            glioma migration through the secreted glycoprotein YKL-40
  JOURNAL   J. Biol. Chem. 286 (46), 39893-39903 (2011)
   PUBMED   21953450
  REMARK    GeneRIF: NFI-X3 and STAT3 control the migration of differentiating
            astrocytes as well as migration and invasion of glioma cells via
            regulating YKL-40 expression.
REFERENCE   5  (bases 1 to 5733)
  AUTHORS   Singh,S.K., Wilczynska,K.M., Grzybowski,A., Yester,J., Osrah,B.,
            Bryan,L., Wright,S., Griswold-Prenner,I. and Kordula,T.
  TITLE     The unique transcriptional activation domain of nuclear factor-I-X3
            is critical to specifically induce marker gene expression in
            astrocytes
  JOURNAL   J. Biol. Chem. 286 (9), 7315-7326 (2011)
   PUBMED   21189253
  REMARK    GeneRIF: NFI-X3 activates GFAP expression, in part, by inducing
            alterations in the nucleosome architecture that lead to the
            increased recruitment of RNA polymerase II
REFERENCE   6  (bases 1 to 5733)
  AUTHORS   Wendler,W.M., Kremmer,E., Forster,R. and Winnacker,E.L.
  TITLE     Identification of pirin, a novel highly conserved nuclear protein
  JOURNAL   J. Biol. Chem. 272 (13), 8482-8489 (1997)
   PUBMED   9079676
REFERENCE   7  (bases 1 to 5733)
  AUTHORS   Sumner,C., Shinohara,T., Durham,L., Traub,R., Major,E.O. and
            Amemiya,K.
  TITLE     Expression of multiple classes of the nuclear factor-1 family in
            the developing human brain: differential expression of two classes
            of NF-1 genes
  JOURNAL   J. Neurovirol. 2 (2), 87-100 (1996)
   PUBMED   8799200
REFERENCE   8  (bases 1 to 5733)
  AUTHORS   Qian,F., Kruse,U., Lichter,P. and Sippel,A.E.
  TITLE     Chromosomal localization of the four genes (NFIA, B, C, and X) for
            the human transcription factor nuclear factor I by FISH
  JOURNAL   Genomics 28 (1), 66-73 (1995)
   PUBMED   7590749
REFERENCE   9  (bases 1 to 5733)
  AUTHORS   Apt,D., Liu,Y. and Bernard,H.U.
  TITLE     Cloning and functional analysis of spliced isoforms of human
            nuclear factor I-X: interference with transcriptional activation by
            NFI/CTF in a cell-type specific manner
  JOURNAL   Nucleic Acids Res. 22 (19), 3825-3833 (1994)
   PUBMED   7937100
REFERENCE   10 (bases 1 to 5733)
  AUTHORS   Seisenberger,C., Winnacker,E.L. and Scherthan,H.
  TITLE     Localisation of the human nuclear factor I/X (NFI/X) gene to
            chromosome 19p13 and detection of five other related loci at
            1p21-22, 1q42-43, 5q15, 11p13 and 20q13 by FISH
  JOURNAL   Hum. Genet. 91 (6), 535-537 (1993)
   PUBMED   8340106
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK295290.1 and AC007787.1.
            
            Summary: The protein encoded by this gene is a transcription factor
            that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral
            and cellular promoters. The encoded protein can also stimulate
            adenovirus replication in vitro. Three transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Aug 2012].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK295290.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1692              AK295290.1         1-1692
            1693-5733           AC007787.1         32352-36392
FEATURES             Location/Qualifiers
     source          1..5733
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.3"
     gene            1..5733
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="nuclear factor I/X (CCAAT-binding transcription
                     factor)"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
     exon            1..104
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    48..50
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="upstream in-frame stop codon"
     CDS             54..1586
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="isoform 1 is encoded by transcript variant 1;
                     nuclear factor 1 X-type; CTF; NF1-X; NF-I/X; nuclear
                     factor 1/X; TGGCA-binding protein; CCAAT-box-binding
                     transcription factor"
                     /codon_start=1
                     /product="nuclear factor 1 X-type isoform 1"
                     /protein_id="NP_001257972.1"
                     /db_xref="GI:402534520"
                     /db_xref="GeneID:4784"
                     /db_xref="HGNC:7788"
                     /db_xref="MIM:164005"
                     /translation="
MEMSWARQSLAGIPAACDEFHPFIEALLPHVRAFSYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKPEIKQKWASRLLAKLRKDIRPEFREDFVLTITGKKPPCCVLSNPDQKGKIRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLYKSPQCSNPGLCVQPHHIGVTIKELDLYLAYFVHTPESGQSDSSNQQGDADIKPLPNGHLSFQDCFVTSGVWNVTELVRVSQTPVATASGPNFSLADLESPSYYNINQVTLGRRSITSPPSTSTTKRPKSIDDSEMESPVDDVFYPGTGRSPAAGSSQSSGWPNDVDAGPASLKKSGKLDFCSALSSQGSSPRMAFTHHPLPVLAGVRPGSPRATASALHFPSTSIIQQSSPYFTHPTIRYHHHHGQDSLKEFVQFVCSDGSGQATGQPNGSGQGKVPGSFLLPPPPPVARPVPLPMPDSKSTSTAPDGAALTPPSPSFATTGASSANRFVSIGPRDGNFLNIPQQSQSWFL
"
     misc_feature    87..215
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="Nuclear factor I protein pre-N-terminus; Region:
                     NfI_DNAbd_pre-N; pfam10524"
                     /db_xref="CDD:151076"
     misc_feature    279..587
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="N-terminal Mad Homology 1 (MH1) domain; Region:
                     MH1; cl00055"
                     /db_xref="CDD:241576"
     misc_feature    714..1583
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /note="CTF/NF-I family transcription modulation region;
                     Region: CTF_NFI; pfam00859"
                     /db_xref="CDD:144451"
     exon            105..636
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       149
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368774795"
     variation       194
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148229471"
     variation       210
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:5827175"
     variation       218
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375719449"
     variation       230
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150443437"
     variation       256
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907254"
     variation       260
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369196245"
     STS             276..520
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="NFIX"
                     /db_xref="UniSTS:504112"
     variation       335
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375310739"
     variation       341
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373938156"
     variation       386
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376885081"
     variation       387
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370482598"
     variation       437
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369056833"
     variation       439
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:387907255"
     variation       459..460
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gggggg"
                     /db_xref="dbSNP:149894387"
     variation       466
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200603126"
     variation       470
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200313486"
     variation       545
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199762875"
     STS             567..1564
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="Nfix"
                     /db_xref="UniSTS:507089"
     variation       633
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372477615"
     exon            637..699
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       645
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907253"
     variation       677
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367591626"
     exon            700..774
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     exon            775..895
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       818
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201664313"
     variation       863
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199590032"
     variation       890
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369151512"
     exon            896..1032
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       920
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201741871"
     variation       928
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113721268"
     variation       932
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047135"
     variation       976
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374776005"
     variation       1010
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199631786"
     variation       1019
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372881529"
     exon            1033..1155
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1100
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373603800"
     variation       1101
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61754992"
     exon            1156..1331
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1217
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201174259"
     variation       1304
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374101865"
     variation       1313
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367955217"
     variation       1325
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372077833"
     exon            1332..1479
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     exon            1480..1571
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1485
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372257657"
     variation       1526
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200499751"
     variation       1539
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287066"
     exon            1572..5733
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /inference="alignment:Splign:1.39.8"
     variation       1659
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047144"
     variation       1744..1745
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34095276"
     STS             1777..1897
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH91530"
                     /db_xref="UniSTS:86722"
     variation       1825
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375166012"
     variation       1843
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144975330"
     variation       1864
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183935392"
     STS             1871..2078
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /standard_name="RH18298"
                     /db_xref="UniSTS:30706"
     variation       1918
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112643821"
     variation       2145
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10416646"
     variation       2235
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57359947"
     variation       2306
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375305695"
     variation       2338
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80090842"
     variation       2438..2457
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="gagggcctccttcctgccac"
                     /db_xref="dbSNP:375140220"
     variation       2451
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369047813"
     variation       2611
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145814634"
     variation       2726..2727
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34337363"
     variation       2730..2731
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:5827180"
     variation       2774
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77607471"
     variation       2833
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113027509"
     variation       2834
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111560188"
     variation       2906
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188413501"
     variation       2937
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181608618"
     variation       2999
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372616189"
     variation       3003..3004
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201158408"
     variation       3004
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35992708"
     variation       3148
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148149655"
     variation       3149..3152
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="tctc"
                     /db_xref="dbSNP:199726177"
     variation       3150..3153
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="ctct"
                     /db_xref="dbSNP:377649271"
     variation       3269
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555273"
     variation       3295
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367898239"
     variation       3305
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113396930"
     variation       3316
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184187752"
     variation       3354
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61270571"
     variation       3404
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369984914"
     variation       3407
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11555274"
     variation       3520
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376300898"
     variation       3829
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:71798576"
     variation       3888
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:112879585"
     variation       3893..3894
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:71841362"
     variation       3996..3997
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:142626844"
     variation       4105
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190683071"
     variation       4125..4126
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71719751"
     variation       4125
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:112478002"
     variation       4195
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182072517"
     polyA_signal    4412..4417
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      4443
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     variation       4588
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150757731"
     variation       4660
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117198656"
     variation       4800
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75550675"
     variation       4860
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:10419483"
     variation       4906
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137978145"
     variation       5279
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186285075"
     variation       5286..5287
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34291647"
     variation       5544
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112707286"
     polyA_signal    5705..5710
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_signal    5713..5718
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
     polyA_site      5733
                     /gene="NFIX"
                     /gene_synonym="MRSHSS; NF1A; SOTOS2"
ORIGIN      
agacggacactgtgccggggcgagctgacaggagttcacggctgcgatagaacatggagatgtcatgggcgcgacagagcctggcggggataccagcagcgtgtgatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagctgctgggcgagaagcccgagatcaagcagaagtgggcatcccggctgctggccaagctgcgcaaggacatccggcccgagttccgcgaggacttcgtgctgaccatcacgggcaagaagcccccctgctgcgtgctctccaaccccgaccagaagggcaagatccggcggattgactgcctgcgccaggctgacaaggtgtggcggctggacctggtcatggtgattttgtttaaggggatccccctggaaagtactgatggggagcggctctacaagtcgcctcagtgctcgaaccccggcctgtgcgtccagccacatcacattggagtcacaatcaaagaactggatctttatctggcttactttgtccacactccggaatccggacaatcagatagttcaaaccagcaaggagatgcggacatcaaaccactgcccaacgggcacttaagtttccaggactgttttgtgacttccggggtctggaatgtgacggagctggtgagagtatcacagactcctgttgcaacagcatcagggcccaacttctccctggcggacctggagagtcccagctactacaacatcaaccaggtgaccctggggcggcggtccatcacctcccctccttccaccagcaccaccaagcgccccaagtccatcgatgacagtgagatggagagccctgttgatgacgtgttctatcccgggacaggccgttccccagcagctggcagcagccagtccagcgggtggcccaacgatgtggatgcaggcccggcttctctaaagaagtcaggaaagctggacttctgcagtgccctctcctctcagggcagctccccgcgcatggctttcacccaccacccgctgcctgtgcttgctggagtcagaccagggagcccccgggccacagcatcagccctgcacttcccctccacgtccatcatccagcagtcgagcccgtatttcacgcacccgaccatccgctaccaccaccaccacgggcaggactcactgaaggagtttgtgcagtttgtgtgctcggatggctcgggccaggccaccggacagcccaacggtagcggccagggcaaagtcccggggtcatttttgctaccgccgccgcctccagtggccagacctgtgccccttcctatgcctgattccaaatccaccagcactgccccagacggcgccgccttgactcctccatcaccttcattcgcaacgacaggcgcctcctctgccaaccggtttgtcagcatcggaccccgggacggcaactttctgaacatcccacagcagtctcagtcctggttcctctgataagatcgacaaaagaaacaacaaaatgagaagaagaggttcctcgaaaggggggagaagaaattttgagaatggaaaaatcccccagcccagcccagccccaccgaaaagcaaaaattacacgtcgtcagccactcagcccttctctcctccagcccggggacccccgcgggccccagaagcagcccagttctcagagagcccttggaaggggtctcggtggagctgtgcaccagcagccaagcagaaagaaacacgcgacatggactctgtcaagtagaggacagaaagcaagaaaggatgcagaactgccttcctccccctgaccccgccccggccttctggggaaggaacaaagtccccaaacaaagcaaccagcacaattctgaaggggcctggcctccaccctcaccccttcctaggggaaccccaccctccacacagccggagctgccctagggagcctggagggccagcttgtaaagatgatggggtttagatccctcaggctctcccctccagactccgcccttccctccctccctccctccctccctctctgccaaggctccagcttcttcccccagctgctcccgaccaggagggggagagcagcctccacttaccccaccccacccttgggctaaaagcccccaggcgggcagggggtgacccctggagctagttgcgtgtcccagaatggagggtgttctgacaccccaccctgagccgcaagagcagtcctggggccctggacccctctgtacagtccgtaggaaaaagtcggaatgctctcgacggcctcgtcccagcctgggacaggccccctttcccctctctctgcaggccaggagggcctccttcctgccacgagggaggggagtcgggccccaggtcgcccccgcccccagccctgcatgcaggtgccctcgctccgccccatcagttcctgcccctgcccctcatgcagactgccctgctggggccgggccggagggtggagcagaaaggggaccccggagccgagcgaggaggaccaggcagccgccgctgccgcgctaagccaccacctgcgcttaggtaggcgtcctgctcgccgactttcagttccttgggagggtgttgggtgtcgtccttttcaaaagtgttttggagctttctgtgccccccgactttcccccgcctccccgccccccacgtggccacttttctctggattttagctgtaatgtctttactctttatttaggggtggggcattcattgtttgggtcttttgctgttggaatgggaactcctcctccatttgagcaacttgggaacaatttggtaacacaccacaggaagtagctctcccccccagccccctcctccctcaagggagggttggggggcctgtccagagggtcttcagaagcccccctgggagggaggggaggatgagcacgcccagctcccctccagggtgtgacttggcccctctggcttgtctttctgtgccttactcctcctcctgcgtctcccgttcctggccccttcttgagtccttgtgcctctctctttctctctctttcttaattgtatgaaaacacaaagcacaggtcaggatcctctgagagaaaatcaacattgcaccacgtaggggtgggctatgggctgtatttattgtgaatctagtttgtgaggctgtggccccgagctggcggagggagggaagaggagggagtgacgggaggggaggaggtcagcgacctggggccgtagcggcaggcgaacggtgcctgctacccagctggaagccacaaggtggctggctccaggggcggcttttgttggaagttgagtgaagccctccccctgtcctcagcgtgcagccctagaggaccccagggctgaggggcagtggatcctgcgggagtctcccggggcgtggggagtaaggccccgggggtggggggccgggtgggccgggcgtgacgcgcggtcaaagtgcaatgatttttcagttcggttggctaaacagggtcagagctgagagcgaagcagaaggggctccctgtccggcccacgtgccctttccctcgacgacagtcgagggctcgggctctgtgggactgtgggagctagggtctgcggggcgcctgcccgggcgaggtcggaagctgcaggccagctgggcccgggccggagcgtgcccggcggggctgcccgggcgggcagggggtgggggctgctcctttcccaagtggtgttgtgaggggcaatgagggcaacaggagatgtggggacgtgttaggagagaaaaaaaaaaaaacaaaaatatatatgggggaaattaacttttttttttcattgaaccaagtgcaatgcatcagagagttttcctatctttgtatgttaagagattaagaaaaaaaaattctatttttgttgtaatgtcctcgcggctctggggacgctaaaagaaccgggcctgccccgccctgcgcggggataacgaaagctgagtgtttttcccttttttttgttcgtttttagtttttttttttttaagtcgttttcctgcgttgacgaggatgatctggggtttttatttgtttcgtcgttcgttctgtttcggtgggagggctgaaggaaacgttcacattttagagtttaaaaaaaacacctcgacatttaaaaaatcaaccaacacaagatcaaaaaggaaaaggacgagagaaaaattatttttaagataattaaacataaaaccctggtgcttcttacattataaagtacgttttaaagaacccacaaactattatacataagtttatgaatcaattaaatatcctgcacttgttaggaatacgcatatcccttctttgttgagtttaacggaacgggacagcggcgtgcccccggcggctggactgctccggccgcgggtctccccgggcgcccctccctggggcccagcacccctcctcgccccatccccgtccgggtacgggggcgcggcaggggtccccggcccctcccccgcagaggtcaatgccaacgaacaaacgtcccctccctccctccctctccgccccgagcgcccttctttgagccagacgccaacttgaccctcaccagcattatcaggagcgcgctcagcaagttggtagtttcctcccccctttcccggcgcccctcccgcccccattcaacatctctcatcctatccccgaccccctccggggaacaccgggaaggctcgacgctccaggacaggaccagccacgcagacaggtcgatttgcccaggcccgcgcccgcacgcacgcacgcacacggccccgcacacagccccgccccaccccgcaaccagccctgtcgactgccttatacacccgcccccgcgctggccggccgacctagtgccttgttctcacccccgtgctggcggagcggacgccgcgctctgggtcccagaggggccgggtggctcagacgacccaccactcccccaccctgaccgtgctgaacagacccccccacacgagagaaaataaaggagcaataaagtcacgagaactttcgtcccccaatcgagagcccgaggggcaccccagccccgcctctgctcccccccaccccacccaccctcggggcgcccccctccccccgcaagccagcctgggccagccccgcttcggcccctcccgggagatccgtgcgcccgaccagcaccagcatcgcggaccgcaaaggccgcccgtcccgtcaaacaagtttcttcttaggctaagaaacgcagtatatacgagtatctctatatatagtactaatggatttggtgtgcttcccccttagcgtccccctccctctgctcctcctccttcagcctggtctccccctcttctctgccctccacccccgtctctgcactgagatacataagaaacaagggtagtttactgtctgttttgttttctgggttttcagtgtcctagcggaatgcaagtaggcagccagcccgtctgttccctctccgccccgccccgccccgcccccgtcactgcgcttctgttataccatctttgcctgactctctccggcttctccattgaatggctaatgtgtatgtgaaataaagaaataaagaaaaacaaacgcga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4784 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:4784 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Molecular function: GO:0003705 [RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:4784 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0006260 [DNA replication] evidence: IEA
            GeneID:4784 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:4784 -> Biological process: GO:0021680 [cerebellar Purkinje cell layer development] evidence: IEA
            GeneID:4784 -> Biological process: GO:0021707 [cerebellar granule cell differentiation] evidence: IEA
            GeneID:4784 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4784 -> Biological process: GO:0048708 [astrocyte differentiation] evidence: IEA
            GeneID:4784 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.