GGRNA Home | Help | Advanced search

2025-07-15 04:31:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001261827            3401 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
            (MS4A14), transcript variant 3, mRNA.
ACCESSION   NM_001261827
VERSION     NM_001261827.1  GI:387849346
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3401)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003127.2, DB082055.1 and AK057418.1.
            
            Transcript Variant: This variant (3) lacks an in-frame exon in the
            5' coding region, compared to variant 4, which results in a shorter
            protein (isoform 3), compared to isoform 4.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns ERS025084,
                              ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-601               AP003127.2         99935-100535
            602-975             DB082055.1         152-525
            976-976             AP003127.2         106976-106976
            977-1010            DB082055.1         527-560
            1011-3330           AK057418.1         678-2997
            3331-3401           AP003127.2         121607-121677
FEATURES             Location/Qualifiers
     source          1..3401
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..3401
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="membrane-spanning 4-domains, subfamily A, member
                     14"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     exon            1..703
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186234557"
     variation       39
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7929046"
     variation       40
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190992915"
     variation       51..52
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:377307026"
     variation       102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76333679"
     variation       110
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143358541"
     variation       149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3816270"
     variation       223
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76174817"
     variation       281
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180800488"
     variation       296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185942516"
     variation       379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141665394"
     misc_feature    410..412
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="upstream in-frame stop codon"
     variation       421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112785513"
     variation       427
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375045470"
     variation       432
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190864604"
     variation       472
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6591579"
     variation       517
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368431455"
     variation       545
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367878785"
     variation       560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592380"
     CDS             566..2653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="isoform 3 is encoded by transcript variant 3;
                     membrane-spanning 4-domains, subfamily A, member 16;
                     testes development-related NYD-SP21; MS4A13 protein;
                     testis development protein NYD-SP21"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     14 isoform 3"
                     /protein_id="NP_001248756.1"
                     /db_xref="GI:387849347"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
                     /translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIGILLILLIISIAELSISVTIASFRSKCWTQSDEVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
     misc_feature    695..>973
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:202888"
     variation       569
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462421"
     variation       577
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375301622"
     variation       589
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140226757"
     variation       601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200092161"
     variation       602
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371634910"
     variation       640
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150323558"
     variation       653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200017443"
     variation       701
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138895874"
     exon            704..832
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141700245"
     variation       731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:72514098"
     variation       732..733
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3217518"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74733740"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:77630012"
     variation       747
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147119308"
     variation       769
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138517611"
     variation       770
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368053345"
     variation       771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144076317"
     variation       794
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369576834"
     variation       796
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144248317"
     variation       802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2197234"
     variation       810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372708908"
     variation       815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148297999"
     variation       827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255532"
     variation       831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141490187"
     exon            833..982
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       833
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375760675"
     variation       834
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202236686"
     variation       846
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146613208"
     variation       847
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371907012"
     variation       856
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183715072"
     variation       876
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76136794"
     variation       881
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375247098"
     variation       891
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146035561"
     variation       910
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140270120"
     variation       960
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145354751"
     exon            983..1081
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1017
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369231964"
     variation       1022
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77038741"
     variation       1048
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186474420"
     exon            1082..3401
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371774895"
     variation       1113
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761169"
     variation       1127
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143463721"
     variation       1142
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7131283"
     variation       1143
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148391374"
     variation       1190
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024994"
     variation       1196
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142563385"
     variation       1206
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373780418"
     variation       1214
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116626186"
     variation       1219
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140195795"
     variation       1245
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142269991"
     variation       1251
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147713621"
     variation       1252
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142667482"
     variation       1263
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370208539"
     variation       1301
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373858678"
     variation       1304
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150268605"
     variation       1361
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117801657"
     variation       1364
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149338262"
     variation       1400
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187868937"
     variation       1446
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150868984"
     variation       1462
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193025815"
     variation       1463
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368158780"
     variation       1464
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375278465"
     variation       1469
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114064661"
     variation       1485
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285006"
     variation       1490
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142839945"
     variation       1510
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369608879"
     variation       1521
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185708225"
     variation       1558
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469306"
     variation       1564
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114663860"
     variation       1573
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376669252"
     variation       1584
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364741"
     variation       1590
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149681158"
     variation       1610
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784858"
     variation       1660
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370940283"
     variation       1689
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145539034"
     variation       1709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149868650"
     variation       1720
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883718"
     variation       1757
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140428922"
     variation       1793
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144301602"
     variation       1827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116345276"
     variation       1849
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112103602"
     variation       1881
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369619070"
     variation       1909
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373220783"
     variation       1921..1922
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35183103"
     variation       1965
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3802959"
     variation       1996
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143398166"
     variation       2007
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139435636"
     variation       2014
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145054362"
     variation       2052
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140456628"
     variation       2066
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376488191"
     variation       2104
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150409796"
     variation       2109
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74837900"
     variation       2125
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142892172"
     variation       2140
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145051590"
     variation       2157
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199805024"
     variation       2181
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199505839"
     variation       2184
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374402343"
     variation       2195
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201227484"
     variation       2218
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235413"
     variation       2250
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113290465"
     variation       2254
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80173276"
     variation       2255
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144635507"
     variation       2268
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372468983"
     variation       2290
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370935983"
     variation       2340
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200738251"
     variation       2341
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148489703"
     variation       2348
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897716"
     variation       2363
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3825020"
     variation       2389
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374558627"
     variation       2442
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116224124"
     variation       2449
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73481226"
     variation       2459
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200543306"
     variation       2463
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144309625"
     variation       2464
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726394"
     variation       2471
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200307761"
     variation       2478
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3016727"
     variation       2491
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147367847"
     variation       2492
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936913"
     variation       2507
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368186934"
     variation       2509
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146179294"
     variation       2521
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370794980"
     variation       2530
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375353153"
     variation       2550
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145801550"
     variation       2574
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014397"
     variation       2576
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149015522"
     variation       2634
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142968938"
     variation       2639
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151183005"
     variation       2672
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181547264"
     variation       2780
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77025492"
     variation       2890
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184474834"
     variation       2990
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375774697"
     variation       3012
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443243"
     STS             3042..3235
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="RH17567"
                     /db_xref="UniSTS:70207"
     variation       3101
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78731118"
     variation       3180
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375396734"
     STS             3198..3297
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="SGC34191"
                     /db_xref="UniSTS:21339"
     variation       3216
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75538311"
     variation       3238
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138237921"
     variation       3246
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188971082"
     variation       3337..3338
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="aacac"
                     /db_xref="dbSNP:140068962"
     variation       3378
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181921480"
ORIGIN      
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttattggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattggaattttgttaatcttactgatcatcagcatagcagagctcagcatctctgtgactattgcatcctttagaagcaagtgctggacacagtcagatgaggttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.