GGRNA Home | Help | Advanced search

2019-03-25 08:26:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001257999            8161 bp    mRNA    linear   PRI 14-MAY-2013
DEFINITION  Homo sapiens ankyrin repeat and FYVE domain containing 1 (ANKFY1),
            transcript variant 3, mRNA.
ACCESSION   NM_001257999
VERSION     NM_001257999.1  GI:384367969
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8161)
  AUTHORS   Zhang,J., Reiling,C., Reinecke,J.B., Prislan,I., Marky,L.A.,
            Sorgen,P.L., Naslavsky,N. and Caplan,S.
  TITLE     Rabankyrin-5 interacts with EHD1 and Vps26 to regulate endocytic
            trafficking and retromer function
  JOURNAL   Traffic 13 (5), 745-757 (2012)
   PUBMED   22284051
  REMARK    GeneRIF: Rabankyrin-5 interacts with EHD1 and Vps26 to regulate
            endocytic trafficking and retromer function
REFERENCE   2  (bases 1 to 8161)
  AUTHORS   Bouslam,N., Bouhouche,A., Benomar,A., Hanein,S., Klebe,S.,
            Azzedine,H., Di Giandomenico,S., Boland-Auge,A., Santorelli,F.M.,
            Durr,A., Brice,A., Yahyaoui,M. and Stevanin,G.
  TITLE     A novel locus for autosomal recessive spastic ataxia on chromosome
            17p
  JOURNAL   Hum. Genet. 121 (3-4), 413-420 (2007)
   PUBMED   17273843
REFERENCE   3  (bases 1 to 8161)
  AUTHORS   Schnatwinkel,C., Christoforidis,S., Lindsay,M.R.,
            Uttenweiler-Joseph,S., Wilm,M., Parton,R.G. and Zerial,M.
  TITLE     The Rab5 effector Rabankyrin-5 regulates and coordinates different
            endocytic mechanisms
  JOURNAL   PLoS Biol. 2 (9), E261 (2004)
   PUBMED   15328530
  REMARK    GeneRIF: Rab5 regulates and coordinates different endocytic
            mechanisms through its effector Rabankyrin-5
REFERENCE   4  (bases 1 to 8161)
  AUTHORS   Kuriyama,H., Asakawa,S., Minoshima,S., Maruyama,H., Ishii,N.,
            Ito,K., Gejyo,F., Arakawa,M., Shimizu,N. and Kuwano,R.
  TITLE     Characterization and chromosomal mapping of a novel human gene,
            ANKHZN
  JOURNAL   Gene 253 (2), 151-160 (2000)
   PUBMED   10940552
REFERENCE   5  (bases 1 to 8161)
  AUTHORS   Ito,K., Ishii,N., Miyashita,A., Tominaga,K., Kuriyama,H.,
            Maruyama,H., Shirai,M., Naito,M., Arakawa,M. and Kuwano,R.
  TITLE     Molecular cloning of a novel 130-kDa cytoplasmic protein, Ankhzn,
            containing Ankyrin repeats hooked to a zinc finger motif
  JOURNAL   Biochem. Biophys. Res. Commun. 257 (1), 206-213 (1999)
   PUBMED   10092534
  REMARK    GeneRIF: Characterization of the related mouse gene
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AB033081.2 and AC087292.14.
            
            Summary: This gene encodes a cytoplasmic protein that contains a
            coiled-coil structure and a BTB/POZ domain at its N-terminus,
            ankyrin repeats in the middle portion, and a FYVE-finger motif at
            its C-terminus. This protein belongs to a subgroup of double zinc
            finger proteins which may be involved in vesicle or protein
            transport. Alternate splicing results in multiple transcript
            variants of this gene. [provided by RefSeq, Apr 2012].
            
            Transcript Variant: This variant (3) differs in the 5' UTR, has
            multiple differences in the coding region, and initiates
            translation at an alternate start codon, compared to variant 1. The
            encoded isoform (3) has a distinct N-terminus and is longer than
            isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB033081.2 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1763              AB033081.2         1-1763
            1764-1764           AC087292.14        172048-172048       c
            1765-4810           AB033081.2         1765-4810
            4811-8161           AC087292.14        150422-153772       c
FEATURES             Location/Qualifiers
     source          1..8161
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p13.3"
     gene            1..8161
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeat and FYVE domain containing 1"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
     exon            1..253
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    52..54
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="upstream in-frame stop codon"
     CDS             118..3753
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="isoform 3 is encoded by transcript variant 3;
                     ankyrin repeat hooked to zinc finger motif; Rabankyrin-5;
                     ankyrin repeat and FYVE domain-containing protein 1;
                     ankyrin repeats hooked to a zinc finger motif"
                     /codon_start=1
                     /product="ankyrin repeat and FYVE domain-containing
                     protein 1 isoform 3"
                     /protein_id="NP_001244928.1"
                     /db_xref="GI:384367970"
                     /db_xref="CCDS:CCDS58502.1"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
                     /translation="
MPTPRDCGRLRSRAGRSRAGAACSRGAPRAAREALDCRRCRDAGGKEVAKLEKHLMLLRQEYVKLQKKLAETEKRCALLAAQANKESSSESFISRLLAIVADLYEQEQYSDLKIKVGDRHISAHKFVLAARSDSWSLANLSSTKELDLSDANPEVTMTMLRWIYTDELEFREDDVFLTELMKLANRFQLQLLRERCEKGVMSLVNVRNCIRFYQTAEELNASTLMNYCAEIIASHWDDLRKEDFSSMSAQLLYKMIKSKTEYPLHKAIKVEREDVVFLYLIEMDSQLPGKLNEADHNGDLALDLALSRRLESIATTLVSHKADVDMVDKSGWSLLHKGIQRGDLFAATFLIKNGAFVNAATLGAQETPLHLVALYSSKKHSADVMSEMAQIAEALLQAGANPNMQDSKGRTPLHVSIMAGNEYVFSQLLQCKQLDLELKDHEGSTALWLAVQHITVSSDQSVNPFEDVPVVNGTSFDENSFAARLIQRGSHTDAPDTATGNCLLQRAAGAGNEAAALFLATNGAHVNHRNKWGETPLHTACRHGLANLTAELLQQGANPNLQTEEALPLPKEAASLTSLADSVHLQTPLHMAIAYNHPDVVSVILEQKANALHATNNLQIIPDFSLKDSRDQTVLGLALWTGMHTIAAQLLGSGAAINDTMSDGQTLLHMAIQRQDSKSALFLLEHQADINVRTQDGETALQLAIRNQLPLVVDAICTRGADMSVPDEKGNPPLWLALANNLEDIASTLVRHGCDATCWGPGPGGCLQTLLHRAIDENNEPTACFLIRSGCDVNSPRQPGANGEGEEEARDGQTPLHLAASWGLEETVQCLLEFGANVNAQDAEGRTPIHVAISSQHGVIIQLLVSHPDIHLNVRDRQGLTPFACAMTFKNNKSAEAILKRESGAAEQVDNKGRNFLHVAVQNSDIESVLFLISVHANVNSRVQDASKLTPLHLAVQAGSEIIVRNLLLAGAKVNELTKHRQTALHLAAQQDLPTICSVLLENGVDFAAVDENGNNALHLAVMHGRLNNIRVLLTECTVDAEAFNLRGQSPLHILGQYGKENAAAIFDLFLECMPGYPLDKPDADGSTVLLLAYMKGNANLCRAIVRSGARLGVNNNQGVNIFNYQVATKQLLFRLLDMLSKEPPWCDGSYCYECTARFGVTTRKHHCRHCGRLLCHKCSTKEIPIIKFDLNKPVRVCNICFDVLTLGGVS
"
     misc_feature    421..711
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="BTB/POZ domain; Region: BTB; pfam00651"
                     /db_xref="CDD:201372"
     misc_feature    742..>948
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="BTB And C-terminal Kelch; Region: BACK; smart00875"
                     /db_xref="CDD:197943"
     misc_feature    898..1254
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1090..1479
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1120..1437
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1432..1932
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1681..1947
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1867..2265
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1882..2196
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2089..2613
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2119..2382
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2428..2745
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2545..3021
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2839..3219
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2866..3150
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    3040..3435
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    3115..3279
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (many copies); Region: Ank_5;
                     pfam13857"
                     /db_xref="CDD:206028"
     misc_feature    3547..3732
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Protein present in Fab1, YOTB, Vac1, and EEA1;
                     Region: FYVE; smart00064"
                     /db_xref="CDD:197498"
     misc_feature    3559..3726
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="FYVE domain; Zinc-binding domain; targets proteins
                     to membrane lipids via interaction with
                     phosphatidylinositol-3-phosphate, PI3P; present in Fab1,
                     YOTB, Vac1, and EEA1; Region: FYVE; cd00065"
                     /db_xref="CDD:28947"
     misc_feature    order(3571..3573,3580..3582,3619..3621,3628..3630,
                     3643..3645,3652..3654,3709..3711,3718..3720)
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Zn binding sites [ion binding]; other site"
                     /db_xref="CDD:28947"
     misc_feature    order(3607..3624,3637..3639,3703..3705)
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="phosphatidylinositol 3-phosphate binding site
                     [chemical binding]; other site"
                     /db_xref="CDD:28947"
     exon            254..446
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            447..565
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            566..701
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            702..825
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            826..975
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            976..1141
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       1005
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369749781"
     variation       1035
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3744671"
     exon            1142..1346
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1347..1415
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1416..1615
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1616..1713
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1714..1942
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       1764
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2020118"
     variation       1881
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1973059"
     exon            1943..2041
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2042..2195
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2196..2364
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2365..2483
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2484..2640
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2641..2841
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2842..3018
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3019..3166
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3167..3257
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3258..3382
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3383..3529
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3530..3620
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3621..8161
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     STS             4596..4706
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="G54294"
                     /db_xref="UniSTS:116130"
     variation       4811
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045016"
     STS             5086..5267
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="RH103073"
                     /db_xref="UniSTS:97407"
     variation       5091
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3760471"
     variation       6967
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:3840875"
     variation       7274
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043587"
     variation       7511
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043592"
     STS             7571..7695
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="SHGC-36655"
                     /db_xref="UniSTS:81079"
     polyA_signal    7604..7609
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
     polyA_site      7625
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="The 3'-most polyA site has not been determined.
                     This is an internal polyA site."
ORIGIN      
ggccgggcgtggttgcatgggggctccgcgggtctcgcgagccttcctgtctagcctctccggagcttctcgggccggggtccggagcgcggttcctatgacaacgtccctcccgcgatgccgaccccgcgggactgcggccggctgcggagccgggctggcaggtcccgcgccggtgctgcgtgcagccgcggggccccgagggcagcacgggaggctcttgattgccggcggtgccgggacgccgggggaaaggaggtggccaagttggagaagcacttgatgcttctgcggcaggagtatgtcaagctgcagaagaagctggcggagacagagaagcgctgcgctctcttggctgcgcaggcaaacaaggagagcagcagcgagtccttcatcagccgtctgctggccatcgtggcagacctctacgagcaggagcagtacagcgatctgaagataaaggttggggacaggcacatcagtgctcacaagtttgtcctggcagcccgcagtgacagctggagtctggctaacttgtcttccactaaagagttggacctgtcagatgctaatcctgaggtgacgatgacaatgcttcgctggatctatacagatgagctggagttcagagaggatgatgtgttcctgactgaactgatgaaactagcaaatcggtttcagctacagctcctcagggagagatgtgagaagggtgttatgtctctagtgaatgtcaggaactgtattcgcttctaccagacggcagaggagctgaatgccagcacactgatgaactactgtgcagaaattattgcaagtcattgggacgacctgaggaaggaggatttcagcagcatgagcgctcagttgttatacaaaatgatcaaatccaagacagagtacccgctacataaagccatcaaagtggagagagaagacgtggtcttcctgtatctgattgaaatggattcccagctccctgggaagctgaatgaagcggatcataacggagatctggcattagatctagccctctcacgacgactggagagtattgccaccacgctggttagtcacaaagctgatgtggacatggtggacaagagtggctggagcttgttacacaaaggaatccaaagaggagatctctttgctgccactttcctcattaagaatggggcctttgtcaacgctgctacactgggtgcccaggagacaccactgcaccttgtggccttgtacagttcaaagaaacactcagcagatgtgatgtctgagatggcgcagattgcagaggcccttctgcaggctggtgccaaccccaacatgcaggacagcaaggggaggactcctttacatgtgtccatcatggccgggaatgaatatgtgttcagtcagctgctgcagtgcaaacaactagatttagaactcaaagaccacgagggcagcacggctctgtggctggcagtgcagcatatcacagtgtcttctgaccagtctgtgaaccccttcgaagatgtccccgtggtaaatgggacttcatttgatgagaacagctttgcagccagactcatccagcgcggcagccacacagacgcacctgacacggcgacaggaaactgtttactacagcgggcagctggagcaggaaacgaggcagcagctcttttcctggcaaccaacggtgcccatgtcaaccacagaaacaagtggggagaaaccccgttgcacacagcgtgtcggcatggcctggccaacctcacggcagagctcctgcagcaaggcgccaacccaaacctgcagacggaggaagctctgcctctgccaaaggaggccgcatccctgaccagcttggcggacagcgtccatctgcagacgccactgcacatggcgatcgcctataaccatccggatgtggtgtctgtcatcctggagcagaaagccaatgctcttcatgccaccaacaacttgcagatcattccggacttcagcctcaaagattcccgagaccagactgtgctgggcctggcattatggactggcatgcacacgatcgcagcccagctgctgggctctggagccgccatcaatgacaccatgtcggatgggcagacgctactgcacatggccatacagcggcaggacagcaagagcgcactcttcctgctggagcaccaggcagatataaatgtcaggactcaggacggggagacagccctccagctggccatcagaaaccagcttccactcgtagttgatgccatatgcacccgaggagctgacatgtctgtgccagatgagaaggggaaccccccgctgtggcttgcattggcaaacaatctggaggacatcgcatccactctggtcagacatggctgtgatgccacatgctggggtccgggacctggtgggtgccttcagacgctcctgcacagagccattgatgaaaacaacgagcccaccgcctgctttcttattcgcagtggctgtgacgtgaacagtcccagacaaccaggcgccaatggagaaggagaggaagaggctagagatgggcagacccctttgcatttggcagcctcttgggggctggaagagacagtacagtgtcttctggagtttggtgccaacgtgaacgcacaggatgcagaaggaagaacccccatccacgtggccatcagcagccaacacggtgtcatcattcagctgttggtttctcaccccgatatccatttgaatgtacgagacagacaagggctgaccccgtttgcctgtgccatgactttcaagaacaacaagtcagccgaggccattctcaaacgagagtccggggctgctgagcaggtggataacaagggccggaatttccttcatgtggcagttcagaactctgatattgaaagtgtgctgttcctgatcagtgtccacgctaatgtgaattcaagagtccaggatgcctccaagttgacccccctgcacctcgctgtccaagcaggctcagaaattattgtccgcaatttgcttcttgcgggagccaaagtgaacgaattaaccaagcatcgccagactgccctccatcttgctgcccagcaggacctgcccaccatctgctcagtcctcctagagaatggcgtggactttgctgccgtggatgagaatggaaacaatgctcttcatcttgctgtcatgcacggccggctcaacaacatccgggttctcctgacagagtgcacagtggacgccgaagcctttaatctcagaggccagtcaccactgcacattttgggacaatatggcaaggagaatgcagcggccatctttgatctcttcctagaatgcatgccggggtatcctctggacaagccggatgcagacggcagcacggtgctgctcctggcatacatgaaagggaacgccaacttgtgccgcgccatcgtccggtcgggggctcgcctcggggtgaataacaaccagggagtcaacatcttcaactaccaggtcgccaccaagcagctcctgttccgactgctggatatgctgtccaaggagcctccgtggtgtgacggctcctactgctatgagtgcactgccaggttcggagtcaccactcgcaaacaccactgtcgtcactgcggacgtcttctttgccataaatgctcgaccaaggagattcctattataaagtttgatctgaacaagcctgtgcgggtttgcaacatttgttttgatgtactgactctgggtggggtttcttagtgagccccccggagggtccaggccacgtccttggtcacctccccagcagctgctctgctcaccagcctgaccccacccagagcaggagctggcgggtgtcttcctgcggcaatagactggaacgattaaggaccatggtgtgatagatcccatttcaaatgattccatatgattgtcagtgtgtgtgtcagactgtgatcgatttcactagatgtctcactcatcagaccaggccattgggcctaagtggtaaatgtgattaggaattagacctctccccattctgctagcaacatacagggacacttggaaaaccatttccccttccagtagcttggtgtccatcccagagcattcatgaagtcttcccgcctgggctgactgatgaggcagagcctctcagcgtaggaagctggctgcttaatgagctggctttactctagggtaagtggctgtggacttttctgcacagtgttttcataaagataataggatcctcttgccctgaagtctttttttctttttacgctaagctgtatttttagtgagctaccccttttaaaaaggtgaaatctttcttaacagggttcaaagatgagagctgaaaaatcgtggccttaacaactgaaagctttacagtgttcatgctactgaggtgtcaggagtgcagctgggccgcttgacacctcgtagcagccgtctcattctctcgtcttgctgcgtcctgtctgtggagtcctcagtcactctgctgttggagagtgctggaggaaatgcacttttactgtgctgcactttttatagagctgcattgtcggtgattccaatttaaaaatccatattcaaaaataccctcacacatccctgcatcagtgattctaatgatcagctttgactggacctcagctcacacgaatctccaaggaaaaactctacagagcatcttttagagcaagagattcatacaggccaagtgatgagagggggagtcaccaaggcttcagccccaagggcatctccagcctcaggccggcaggtcctatgtccttgacacaaatgcttcttgctgaaatcctccctagtgatgctgcgagtgctgttggtcccagttctgtgtagcttgccctgccccatgaagggccaccagccaagggccctggccacgtgtgcgccaccttactttggaagtctctggcttgtgtgctggatgaggctgccagaacttgttgggcgttcatcgctgttagtacatatattaaccgtgaggtgttaaacttttcttttgaaggtttggccagtttctaaaaaatgcacatttaaagagaagcatctaccacggctttaaaacaaaacaactctgagatgaacaatatgtgttatactcagagattaacaatctcaatcatacatactgattctttcagacatttaataaccactacatttttttgcattaatgaagtttgactatatgtgtaaagggactaaatatttttgcaacagcctgttctttgttcattcttttctggatagtgtgtcctctgtattgcggtagatttatacattctgttgcctaaatatgtgtgtaaaatgagctgataaactggagtactacttaaaaaaaagtctgtgatttataagatgtatatgctttctatgtgaatataagcttgtgcacaatgtttaaaagaaaaacaatgaattagaagagatcccccgtcccccagtctgacatatttcatacagaatgtttaaaagaaaaactctgctagtcttggcaaacatttggccatgtgaggcatgtggtcagtttccattttctattacctggaaagggccataaggaagcaggcagggcttaggtagcttggttacctaagttagaaagtaagagaatcatgattcggatatgaattgaagtggttggtacatggatacctgttctttaaaaggaatgtgggagatgagtcaagggtgaggccgattgttctgcccatgccctaccataccaatttcaataacaatcttgcctgtcattgcactcagaatcttaagatcatgtttcaaatatgttgattcaaacttgcttctaagcctgagtccagggatagcaatggtactgaccagctatggactgggagaacattgagtcctgttttccattggcttcagggcgcatccatgtggatataggaaaagcctctttccacagacttaggaagccccccgaccacgcggacgctcgctgggctgcactcagcaggctgcttgagtgggagctgactccaacatgccctgccctggctgggactaggcatgcttccagcccttcccgtgctctccctgctgtcaacacttgcgtacaaacctgcctagctgttgtaagttttcatcagtagcttaagtactagtagcaaaaacttaaattcattcagaaagttgccacttctgaatgagtagagcaggaaaagtaaactttactgaaacataatttgctgcaacagtcaacattgttatgctgaatgtgctctcaactgccctttgctcatcgccagatttattatccagtgtattcctaacagtcttttgttgtcgttgtttttaaaacaaaggtacggaccatgtgctatatataaatcgaatggcttaaactaatttgctatgatcctctaacaccgaaatttcccataaacttaagtgcctacacttaggacttttgaactttcagtcatctttttcgtggtgtctcactgaacgatgtgttagaacatgtgttccatttggagttttgggcctgtgcacggtcaaccccaattaccaatttagttgaggctggattcgattgctcagttcacctgccacgttctctccaaggagtggggtctacgtgacctttagtcctctacctcagagccccgagtcatttctgaccaccccgttctgtgtcctcactcttgtccctgaatgggtccctgtgtggatctcagtgtgtgtgtggtttctccactcctccccgctcatgtcccacacctgccatattgaaccgtttctgcactaatcttctccacgggcacggagtggagggaacgtcttgggaaaggggagagcttgacctccatctaggtttcttttatctggagaaaaagaacacttttgaactatgtaatgcttcaccctgaaaggcaagctaacgctaacttcccaggtgacagtagcaggaacaaggaagggtaatgtttccatgacagacacttgcttcccttgggacaagtcccagaagaactacctgaagcaccaaagctccccaccccagcctggtggcagaggaagcaggtggcaccaactcaccaaagggacttgggagccaccttctcactctgtggaagtactttagtgagagctgactggcaagataaaaaccctgaaattcccagaagttacagatgccttaaagactttctttggaagatcattgcctgtactattccttttttgtgtggcataaataatatattaacctgttacaactgacaacattggttttctgcagctagggagtcttgagtcgagactgctcgccttgatgacttgctcttttttggcagatgtgtggagttggctgttacgacatccctgtgtgatcccagaggaggggcagtagctgggcagaaactgcaggcacacatttgggtggatcacctggcttccagccccttcggggtggtgctcagtgtggggtgatggtatcatagaggaccacggcgcttatcagcattgtttctttggagtctgtgtaatggaatgtatttttcaaatactgatatttgcattttctgtaacaattccttataataaaatgaagtaaaattgtgcatttaaagtggaaactttaataagacatttgtagttacttctaatgcagaagtaccaataagcattaaaaacaaattttagaaaactcctgacgtgaataagtttcttgaccagctgccctccagaaagtttgaattccaacatttttcaggaacatgctgttgacagcagtaaaagtagctattttatgtatgtatttttaatttttaaaagtttcagtaggtttttggggttcaggtggtgtttggttacgtgaggttctttagcggtgatttccaggattttggggcacccatcacccaagcagtgtacactggacccttttatccctcaccccaaccctttcccctgagcccccaaagtccactgtatcattcttaatgcctttacgtcctcatggcttagctcccgaaaagtagttattttaaacatactagctgcctgaacttactgtgcccttggcccagatttcagctcatagcaccgagcgtgatcactgaggcagtctcagtcaccgtcacctgacccctctgaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51479 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51479 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:51479 -> Cellular component: GO:0010008 [endosome membrane] evidence: ISS
            GeneID:51479 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.