GGRNA Home | Help | Advanced search

2019-03-23 03:26:19, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001257967            4142 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens coiled-coil domain containing 129 (CCDC129),
            transcript variant 1, mRNA.
ACCESSION   NM_001257967
VERSION     NM_001257967.1  GI:384081584
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4142)
  AUTHORS   Rose,J.E., Behm,F.M., Drgon,T., Johnson,C. and Uhl,G.R.
  TITLE     Personalized smoking cessation: interactions between nicotine dose,
            dependence and quit-success genotype score
  JOURNAL   Mol. Med. 16 (7-8), 247-253 (2010)
   PUBMED   20379614
  REMARK    GeneRIF: Clinical trial of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
            Erratum:[Mol Med. 2012;18(1):729]
REFERENCE   2  (bases 1 to 4142)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK304387.1, AC006044.2, BC132719.1 and AK128026.1.
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK304387.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-241               AK304387.1         1-241
            242-242             AC006044.2         27302-27302
            243-1001            BC132719.1         134-892
            1002-1277           AC006044.2         52302-52577
            1278-1615           AK304387.1         1278-1615
            1616-1616           AC006044.2         117022-117022
            1617-2572           BC132719.1         1508-2463
            2573-2573           AC006044.2         117979-117979
            2574-3310           AK304387.1         2574-3310
            3311-3808           AK128026.1         3713-4210
            3809-3809           AC006044.2         127539-127539
            3810-4142           AK128026.1         4212-4544
FEATURES             Location/Qualifiers
     source          1..4142
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p14.3"
     gene            1..4142
                     /gene="CCDC129"
                     /note="coiled-coil domain containing 129"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
     exon            1..50
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     exon            51..124
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    55..57
                     /gene="CCDC129"
                     /note="upstream in-frame stop codon"
     variation       88
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117297547"
     CDS             118..3282
                     /gene="CCDC129"
                     /note="isoform 1 is encoded by transcript variant 1;
                     coiled-coil domain-containing protein 129"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 129
                     isoform 1"
                     /protein_id="NP_001244896.1"
                     /db_xref="GI:384081585"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
                     /translation="
MSVSLQNYSPMMAQKSQGSDNLQEGQEKSKREILKCTKSAWAPLDEWLPPDPEEESQSLTIPMLEDSKQESIQQWLDSGFFVSANENFQQVIDRTVSLYEQGMVQMTVKDYMRSLHQFSETPILSRGTSFNSCYSTASVPQSIPEWLEFWEIDPVEILLDLGFGADEPDICMQIPARFLGCGSAARGINIRVFLEAQKQRMDIENPNLYGRFRQLEILDHVTNAFSSLLSDVSILPNRAEEKAGGESVQRTSVSAAKEHRRRMGKLLRRASKQNIRRDCNPEVSESFKVKDEVFVPFTKPWDCGAELAATSINHKQNHLSLSVEHQSLQACDDLLPYPPHGLLSKQWPCSSMPAKQAPPSCVSEGSVKGRTQKENLFQTNKLKSLSHLAGKGPDSFEMEEVQSFEEETGNPLDMTSGTVGARVDRANSCQSDSSGFLEEPLEPLPLQMPSLPNSQSPAENGGRKPRDQSHSLVSSQDCQLESDGPDSKSRASMSFSSQEANALEQRASVSVMEEEFLLEAMEGPPELYIPDMACAKTTTRGECPRKDSHLWQLLPMPHAEYEVTRPTATSKYDHPLGFMVTHVTEMQDSFVRPEGAGKVQSHHNESQRSPGNDHTQDKFLHVDSEAPREEESSGFCPHTNHSLLVPESSSQCIPKHSEITPYATDLAQTSEKLIPHLHKLPGDPAQVKSRSGTLGQILPGTEAEMENLPLNTGSSRSVMTQMSSSLVSAAQRAVALGTGPRGTSLECTVCDPVTATETRLGTKARQLNDASIQTSALSNKTLTHGPQPLTKSVSLDSGFSSICPMGTCHAIPAHCCICCHHHPHCHGERQSPGPEPSVCRHCLCSLTGHQEAQFMTTLKALQDTTVRELCSCTVHEMEAMKTICQSFREYLEEIEQHLMGQQALFSRDMSEEEREEAEQLQTLREALRQQVAELEFQLGDRAQQIREGILLQLEVLTAEPPEHYSNLHQYNWIEESNGQTSCSKIHPGMAPRTVFPPDDGQEAPCSGGTQLAAFTPPTLENSTRMSPSSSAWAKLGPTPLSNCPVGEKDADVFL
"
     exon            125..310
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       136
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368232809"
     variation       186
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114739660"
     variation       208
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368587451"
     variation       215
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371959143"
     variation       228
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147399119"
     variation       235
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374470226"
     variation       242
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7811042"
     variation       245
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690079"
     variation       246
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372303441"
     variation       273
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371511395"
     variation       289
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112921112"
     variation       301
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376118062"
     exon            311..359
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       336
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200034335"
     exon            360..403
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       361
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372723381"
     variation       385
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377546776"
     variation       396
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2286711"
     variation       397
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201211575"
     exon            404..455
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       413
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149696374"
     variation       438
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145529826"
     variation       449
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187154"
     exon            456..542
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       456..457
                     /gene="CCDC129"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35551867"
     variation       498
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67930674"
     variation       499
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369866067"
     variation       501
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146605019"
     variation       502
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141438918"
     variation       503
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202157240"
     variation       507
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374063664"
     variation       523
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201415095"
     exon            543..745
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       544
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370418381"
     variation       550
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372753433"
     variation       571
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200366088"
     variation       598
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376020926"
     variation       649
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370670531"
     variation       688
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187352726"
     variation       715
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199790271"
     variation       731
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371060962"
     variation       739
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191694538"
     variation       740
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375679267"
     variation       744
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143370840"
     exon            746..1317
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       749
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151254328"
     variation       775
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200848834"
     variation       805
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140428776"
     variation       838
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200031625"
     variation       866
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373956174"
     variation       883
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376757677"
     variation       896
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201901788"
     variation       908
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184653370"
     variation       926
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373138016"
     variation       936
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200960115"
     variation       946
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201177934"
     variation       947
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370395768"
     variation       949
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372951947"
     variation       951
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111332081"
     variation       971
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186789215"
     variation       1002
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6945679"
     variation       1017
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368881766"
     variation       1018
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:111510506"
     variation       1028
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371421598"
     variation       1076
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373943918"
     variation       1113
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200119465"
     variation       1150
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368169623"
     variation       1175
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372420153"
     variation       1211
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192536493"
     variation       1220
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375575625"
     variation       1222
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369963496"
     variation       1239
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372373590"
     variation       1277
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10252720"
     variation       1299
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368760577"
     exon            1318..1375
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1342
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188006642"
     variation       1373
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374799170"
     exon            1376..1458
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1419
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370130726"
     variation       1429
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367919427"
     variation       1437
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373855014"
     variation       1438
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368202210"
     exon            1459..2730
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1486
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372684457"
     variation       1487
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150398844"
     variation       1488
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185577476"
     variation       1498
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369485544"
     variation       1499
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138418545"
     variation       1506
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143912195"
     variation       1546
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201060776"
     variation       1563
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146986060"
     variation       1571
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190307572"
     variation       1588
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376801262"
     variation       1589
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138066602"
     variation       1590
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143751428"
     variation       1598
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115087893"
     variation       1616
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4141001"
     variation       1622
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182124848"
     variation       1637
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148685966"
     variation       1638
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141164020"
     variation       1657
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376345625"
     variation       1658
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200626153"
     variation       1679
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377326064"
     variation       1693
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150717357"
     variation       1718
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139246994"
     variation       1733
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144022203"
     variation       1758
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76357748"
     variation       1764
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38396"
     variation       1792
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73686905"
     variation       1816
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77197319"
     variation       1838
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371473428"
     variation       1907
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287000"
     variation       1928
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368084998"
     variation       1934
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116406137"
     variation       1936
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147656859"
     variation       1986
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143660819"
     variation       1999
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199508649"
     variation       2007
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201778549"
     variation       2010
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200300960"
     variation       2016
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38397"
     variation       2049
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186727343"
     variation       2050
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375104335"
     variation       2061
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138128234"
     variation       2071
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148074341"
     variation       2090
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150134204"
     variation       2166
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200026024"
     variation       2199
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181108787"
     variation       2217
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117782044"
     variation       2289
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377002952"
     variation       2301
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185363516"
     variation       2328
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372213107"
     variation       2337
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375422464"
     variation       2403
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149320755"
     variation       2414
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141868591"
     variation       2431
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200809374"
     variation       2454
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137859522"
     variation       2494
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146267805"
     variation       2510
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369385676"
     variation       2530
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189731201"
     variation       2536
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202078186"
     variation       2545
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145959636"
     variation       2571
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139858209"
     variation       2573
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10247620"
     variation       2595
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76733226"
     variation       2596
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139431992"
     variation       2631
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150049545"
     variation       2684
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147673017"
     variation       2724
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377331865"
     variation       2729
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142323942"
     exon            2731..2858
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2735
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201917207"
     variation       2762
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200617855"
     variation       2779
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142885665"
     variation       2780
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144601428"
     variation       2806
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7799540"
     variation       2811
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148953571"
     variation       2839
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370201894"
     exon            2859..2970
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2868
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374114030"
     variation       2870
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143151561"
     variation       2878
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201354762"
     variation       2887
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148236609"
     variation       2888
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80081783"
     variation       2913
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141259951"
     exon            2971..4142
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2981
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186386347"
     variation       3020
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137892596"
     variation       3083
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142389938"
     variation       3085
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377589498"
     variation       3090
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145933301"
     variation       3108
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179579"
     variation       3109
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111514975"
     variation       3123
                     /gene="CCDC129"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:371362733"
     variation       3143
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149268880"
     variation       3147
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371944763"
     variation       3148
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115873834"
     variation       3166
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201005039"
     variation       3171
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200065011"
     variation       3182
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77915580"
     variation       3185
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374464304"
     variation       3196
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148552563"
     variation       3221
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183033798"
     variation       3230
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142016406"
     variation       3248
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34177136"
     variation       3254
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201675506"
     variation       3262
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140998733"
     variation       3291
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368704382"
     variation       3293
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768075"
     variation       3320
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371845154"
     variation       3322
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371968855"
     variation       3324
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138001179"
     variation       3333
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369807067"
     variation       3335
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143478742"
     variation       3399
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187942842"
     variation       3435
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374773487"
     variation       3504
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:60432519"
     variation       3518
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147140713"
     variation       3532
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140268517"
     variation       3608
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371842462"
     variation       3730
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77503219"
     variation       3809
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2159513"
     variation       3819
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376168188"
     variation       3905
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182206184"
     variation       3948
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202091748"
ORIGIN      
gtttccttcaggaactttcagatggctcaggagtggagcttttgtggcagttcctgacaggataaggacaagaagcaacacacagaagagaaggaaaaagaaagaaaactgaccaatatgagtgttagtttgcagaattactctcctatgatggcacagaaatcacaaggatctgacaaccttcaggaaggccaggaaaagagcaagagagagatcctgaagtgcaccaaaagcgcgtgggctccgctggatgagtggctgccccctgaccctgaggaggaaagccagagtctcaccatccccatgctggaagattccaagcaagaaagtattcagcagtggctggactctggattctttgtctctgcaaatgaaaactttcaacaagtcattgaccgcactgtttctttgtatgaacaagggatggttcaaatgactgtgaaagactacatgagatctttgcatcagttttcagaaactcccatcctatccagagggaccagtttcaactcttgctattctactgcaagtgtaccacaaagcattcctgaatggctggaattttgggagatagatccagtggagattctcttggatctggggtttggtgctgatgagccagacatctgcatgcaaatcccagccagattccttggttgtggctcagcagccagaggaatcaacatccgtgtttttcttgaagctcaaaagcagcgaatggacattgagaaccccaacttgtacggtcgtttccgacagctggaaatcctggaccatgtgaccaatgccttctcatctctgctgagtgatgtcagcatcctgccaaacagagctgaagagaaagctggaggagagagtgtgcaaagaacctcagtgagtgccgccaaagagcatcgaagaagaatgggtaaactcttaaggagagcttccaaacagaacatcaggcgggattgtaacccagaggtatcagagtccttcaaggtgaaggatgaagtttttgttccctttacaaaaccatgggattgtggagcagagctagcagcaacctcaatcaaccacaagcaaaatcatttgtctctgtcagtagaacatcagtctctccaagcctgtgatgatttgctaccttatcctcctcatggtcttctgagcaagcagtggccttgctcatctatgccggccaagcaggctcctccttcctgtgtgtctgaggggtcagtcaagggcagaactcagaaggagaacttatttcagactaacaagctcaagagcttgtctcatcttgcaggcaaaggaccagactcatttgaaatggaagaggtccaaagctttgaagaagagactggtaatcctcttgacatgacttcaggaactgtaggtgccagggtggacagagcaaatagctgccagtctgacagcagcgggttcctggaggagccgctggaaccgctgcccctccagatgccttccttgccaaacagccagagtcctgctgagaatggaggtagaaagccaagagatcagagccacagcttagtatcatcccaggactgtcagctagagtcggatgggccagattccaaaagtagggcgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagtatctgtgatggaggaagagtttctgcttgaggccatggaggggccaccagagctgtatatcccagacatggcctgtgccaagaccaccacgaggggagaatgcccaaggaaagacagccatctgtggcagcttctgccaatgccccatgctgagtatgaggtcaccagacccacagccacttccaaatatgatcatcctctggggtttatggtaacccacgtcacagaaatgcaggacagttttgtgaggcctgagggagctggcaaagtgcaaagccaccacaatgagtctcaaaggtcacctggaaatgatcatactcaagacaagttccttcatgttgactctgaggccccacgagaagaggaaagcagtggattctgtcctcacaccaaccacagcttactcgtaccagaaagctcatcacagtgtatccccaagcacagtgaaatcacaccttatgcaactgaccttgctcaaacatctgaaaagctcattccccacctccataaactgcctggagatcctgcccaggtgaagtcaaggtctggtactttgggtcagatactacctgggacagaagctgagatggaaaaccttcctctaaatactggcagctccaggtctgtaatgacccagatgtcctccagcctggtgtcggctgctcagagggctgtggccttggggactggtcccagaggaacatctttagaatgcactgtgtgtgatcctgttaccgcaacagaaacaagactggggacaaaagcaagacagttaaatgatgcttccattcagacttcagctctaagcaacaagaccttgacacatgggccccagcccctcaccaaatccgtctctctagactcaggcttctctagtatctgcccaatgggcacctgccatgctatacctgcccactgctgcatctgctgtcatcaccaccctcactgccacggggagaggcaaagccctggccctgaaccctcagtctgtaggcactgcctgtgttcactaactggtcaccaggaagcccagttcatgacgactttgaaagcccttcaggacactacagtgagggagctatgttcctgcacagtccatgagatggaagccatgaagacgatatgccaaagtttccgggagtatttagaagaaattgaacagcaccttatgggacagcaggccctcttttccagggacatgtcagaggaggaaagggaggaggccgagcaactgcaaacgttacgtgaggccctgaggcagcaggtggcagagttggaatttcagttaggagaccgggctcagcaaatcagagaagggattttactgcagctggaggttctcacagcagagccacctgaacactattcaaatctgcatcaatataactggatagaagaaagcaatgggcagacttcatgttctaaaatccacccaggcatggccccgaggactgtgtttcctcccgatgatggccaggaggctccctgttcaggtgggacccagttggctgccttcactccacccaccttggagaacagcaccaggatgtctccttcatcatcagcttgggcaaagttaggtccaacccctttgtcaaattgtcctgttggagaaaaggatgcagatgtcttcctctagatcagagcaggtttgttaaccttcatacaaaatataaaggcccagaacagatgtagcaaggaaatttcaattttccccaaggagaagggtctgccaacccattgtcagctatatctctcatattctaccctttggttaaacccaagaggagtttagaatactctaatactcattcagtatagaataactgagcacctagtatgtgcctggcacagagtatgcaacagtgactaaatagtatacggtctctgccctgctagaacttacagtgtagtgggggagatagaattgcaaacaaaaagtatctgagacagacctcagtcaatatagaagtttattttgccaaggttaaggatacacacccagaagacaggtctgtgcctttctccaaagatgattttgaggccttcaacatttagtggggaaagggtgctaatggggaaagaggtgtgggtacataggaggcaaacagttgcatttttttgagtctgatcagcttttctcatgagagaaggggtagaggaactgtcacttatgcattcacctagctcagtggatctgcacttttacagaaggtaaaataaacatagggcagaggaagcaatcagatatgcatttgtctcgggggagcagagggatggctttgagttctgttctttgtcctgtacctattaagagaagctatcaatatactttgtcaggataaaattcaacagaactgttttagactaaagattttagggaccacaaggaatttcccagtgggcaaattgtgagggaggtatttagcttttaaaaaaatctttgtagctatctcatttagaaataaaatgggaggcagattgcctgatgcagctcct
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.