2024-04-27 02:28:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001256873 1593 bp mRNA linear PRI 11-OCT-2012 DEFINITION Homo sapiens ubiquitin specific peptidase 17-like family member 1, pseudogene (USP17L1P), mRNA. ACCESSION NM_001256873 VERSION NM_001256873.1 GI:379030634 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1593) AUTHORS Ramakrishna,S., Suresh,B., Lee,E.J., Lee,H.J., Ahn,W.S. and Baek,K.H. TITLE Lys-63-specific deubiquitination of SDS3 by USP17 regulates HDAC activity JOURNAL J. Biol. Chem. 286 (12), 10505-10514 (2011) PUBMED 21239494 REFERENCE 2 (bases 1 to 1593) AUTHORS de la Vega,M., Kelvin,A.A., Dunican,D.J., McFarlane,C., Burrows,J.F., Jaworski,J., Stevenson,N.J., Dib,K., Rappoport,J.Z., Scott,C.J., Long,A. and Johnston,J.A. TITLE The deubiquitinating enzyme USP17 is essential for GTPase subcellular localization and cell motility JOURNAL Nat Commun 2, 259 (2011) PUBMED 21448158 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1593) AUTHORS Ramakrishna,S., Suresh,B., Kang,I.C. and Baek,K.H. TITLE Polyclonal and monoclonal antibodies specific for USP17, a proapoptotic deubiquitinating enzyme JOURNAL Hybridoma (Larchmt) 29 (4), 311-319 (2010) PUBMED 20715989 REFERENCE 4 (bases 1 to 1593) AUTHORS McFarlane,C., Kelvin,A.A., de la Vega,M., Govender,U., Scott,C.J., Burrows,J.F. and Johnston,J.A. TITLE The deubiquitinating enzyme USP17 is highly expressed in tumor biopsies, is cell cycle regulated, and is required for G1-S progression JOURNAL Cancer Res. 70 (8), 3329-3339 (2010) PUBMED 20388806 REFERENCE 5 (bases 1 to 1593) AUTHORS Burrows,J.F., Scott,C.J. and Johnston,J.A. TITLE The DUB/USP17 deubiquitinating enzymes: a gene family within a tandemly repeated sequence, is also embedded within the copy number variable beta-defensin cluster JOURNAL BMC Genomics 11, 250 (2010) PUBMED 20403174 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1593) AUTHORS Burrows,J.F., McGrattan,M.J., Rascle,A., Humbert,M., Baek,K.H. and Johnston,J.A. TITLE DUB-3, a cytokine-inducible deubiquitinating enzyme that blocks proliferation JOURNAL J. Biol. Chem. 279 (14), 13993-14000 (2004) PUBMED 14699124 REFERENCE 7 (bases 1 to 1593) AUTHORS Puente,X.S., Sanchez,L.M., Overall,C.M. and Lopez-Otin,C. TITLE Human and mouse proteases: a comparative genomic approach JOURNAL Nat. Rev. Genet. 4 (7), 544-558 (2003) PUBMED 12838346 REMARK Review article REFERENCE 8 (bases 1 to 1593) AUTHORS Okada,T., Gondo,Y., Goto,J., Kanazawa,I., Hadano,S. and Ikeda,J.E. TITLE Unstable transmission of the RS447 human megasatellite tandem repetitive sequence that contains the USP17 deubiquitinating enzyme gene JOURNAL Hum. Genet. 110 (4), 302-313 (2002) PUBMED 11941478 REFERENCE 9 (bases 1 to 1593) AUTHORS Saitoh,Y., Miyamoto,N., Okada,T., Gondo,Y., Showguchi-Miyata,J., Hadano,S. and Ikeda,J.E. TITLE The RS447 human megasatellite tandem repetitive sequence encodes a novel deubiquitinating enzyme with a functional promoter JOURNAL Genomics 67 (3), 291-300 (2000) PUBMED 10936051 REFERENCE 10 (bases 1 to 1593) AUTHORS Gondo,Y., Okada,T., Matsuyama,N., Saitoh,Y., Yanagisawa,Y. and Ikeda,J.E. TITLE Human megasatellite DNA RS447: copy-number polymorphisms and interspecies conservation JOURNAL Genomics 54 (1), 39-49 (1998) PUBMED 9806828 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AF228730.8. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1593 AF228730.8 292136-293728 FEATURES Location/Qualifiers source 1..1593 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8p23.1" gene 1..1593 /gene="USP17L1P" /gene_synonym="USP17L1" /note="ubiquitin specific peptidase 17-like family member 1, pseudogene" /db_xref="GeneID:401447" /db_xref="HGNC:37182" CDS 1..1593 /gene="USP17L1P" /gene_synonym="USP17L1" /note="ubiquitin specific peptidase 17-like 1 (pseudogene); ubiquitin thioesterase 17-like protein 1; deubiquitinating enzyme 17-like protein 1; ubiquitin-specific-processing protease 17-like protein 1; ubiquitin specific peptidase 17-like 1, pseudogene" /codon_start=1 /product="putative ubiquitin carboxyl-terminal hydrolase 17-like protein 1" /protein_id="NP_001243802.1" /db_xref="GI:379030635" /db_xref="GeneID:401447" /db_xref="HGNC:37182" /translation="
MGDDSLYLGGEWQFNHFSKLTSSRPDAAFAEIQRTSLPEKSPLSSETRVDLCDDLAPVARQLAPREKLPLSSRRPAAVGAGLQNMGNTCYENASLQCLTYTLPLANYMLSREHSQTCQRPKCCMLCTMQAHITWALHSPGHVIQPSQALAAGFHRGKQEDVHEFLMFTVDAMKKACLPGHKQVDHHCKDTTLIHQIFGGCWRSQIKCLHCHGISDTFDPYLDIALDIQAAQSVKQALEQLVKPEELNGENAYHCGLCLQRAPASNTLTLHTSAKVLILVLKRFSDVAGNKLAKNVQYPECLDMQPYMSQQNTGPLVYVLYAVLVHAGWSCHDGHYFSYVKAQEVQWYKMDDAEVTVCSIISVLSQQAYVLFYIQKSEWERHSESVSRGREPRALGAEDTDRRAKQGELKRDHPCLQAPELDEHLVERATQESTLDHWKFLQEQNKTKPEFNVGKVEGTLPPNALVIHQSKYKCGMKNHHPEQQSSLLNLSSTTRTDQESMNTGTLASLQGRTRRAKGKNKHSKRALLVCQ
" misc_feature 235..1119 /gene="USP17L1P" /gene_synonym="USP17L1" /note="A subfamily of Peptidase C19. Peptidase C19 contains ubiquitinyl hydrolases. They are intracellular peptidases that remove ubiquitin molecules from polyubiquinated peptides by cleavage of isopeptide bonds. They hydrolyze bonds involving the carboxyl...; Region: Peptidase_C19E; cd02661" /db_xref="CDD:73067" misc_feature 238..1116 /gene="USP17L1P" /gene_synonym="USP17L1" /note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH; pfam00443" /db_xref="CDD:201230" misc_feature order(250..252,265..267,1000..1002,1051..1053) /gene="USP17L1P" /gene_synonym="USP17L1" /note="active site" /db_xref="CDD:73067" misc_feature 1123..1362 /gene="USP17L1P" /gene_synonym="USP17L1" /note="Hyaluronan / mRNA binding family; Region: HABP4_PAI-RBP1; pfam04774" /db_xref="CDD:191086" exon 1..1593 /gene="USP17L1P" /gene_synonym="USP17L1" /inference="alignment:Splign:1.39.8" STS 1..1593 /gene="USP17L1P" /gene_synonym="USP17L1" /db_xref="UniSTS:484239" variation 9 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:201906753" variation 49 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="t" /db_xref="dbSNP:199968090" variation 71 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:200574182" STS 106..230 /gene="USP17L1P" /gene_synonym="USP17L1" /standard_name="G42601" /db_xref="UniSTS:94504" variation 146 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="t" /db_xref="dbSNP:375890828" STS 241..512 /gene="USP17L1P" /gene_synonym="USP17L1" /standard_name="SHGC-145429" /db_xref="UniSTS:183854" variation 483 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="c" /db_xref="dbSNP:201518690" variation 667 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="t" /db_xref="dbSNP:370392210" variation 795 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="g" /db_xref="dbSNP:374107377" variation 813 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:376732801" variation 837 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="c" /db_xref="dbSNP:371193184" variation 905 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="t" /db_xref="dbSNP:200139554" variation 993 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="c" /db_xref="dbSNP:374439010" variation 1011 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:368880221" variation 1012 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:200741908" variation 1027 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:117479685" variation 1031 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="g" /replace="t" /db_xref="dbSNP:371525555" variation 1104 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:199976725" variation 1234 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:201302491" variation 1288 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="g" /db_xref="dbSNP:367800475" variation 1308 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="g" /db_xref="dbSNP:202154298" variation 1320 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="g" /replace="t" /db_xref="dbSNP:372027647" STS 1346..1506 /gene="USP17L1P" /gene_synonym="USP17L1" /standard_name="G01912" /db_xref="UniSTS:16665" variation 1356 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:181949650" variation 1357 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:376292490" variation 1384 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:369451964" variation 1388 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:201803133" variation 1428 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:375768371" variation 1473 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:201341707" variation 1521 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="c" /replace="t" /db_xref="dbSNP:202118915" variation 1526 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:200405846" variation 1534 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="a" /replace="g" /db_xref="dbSNP:201246280" variation 1543 /gene="USP17L1P" /gene_synonym="USP17L1" /replace="g" /replace="t" /db_xref="dbSNP:369917106" ORIGIN
atgggggacgactcactctacttgggaggtgagtggcagttcaaccacttttcaaaactcacatcttctcggccagatgcagcttttgctgaaatccagcggacttctctccctgagaagtcaccactctcatctgagacccgtgtcgacctctgtgatgatttggctcctgtggcaagacagctcgctcccagggagaagcttcctctgagtagcaggagacctgctgcggtgggggctgggctccagaatatgggaaatacctgctacgagaacgcttccctgcagtgcctgacatacacactgccccttgccaactacatgctgtcccgggagcactctcaaacatgtcagcgtcccaagtgctgcatgctctgtactatgcaagctcacatcacatgggccctccacagtcctggccatgtcatccagccctcacaggcattggctgctggcttccatagaggcaagcaggaagatgtccatgaatttctcatgttcactgtggatgccatgaaaaaggcatgccttcccggccacaagcaggtagatcatcactgcaaggacaccaccctcatccaccaaatatttggaggctgctggagatctcaaatcaagtgtctccactgccacgggatttcagacacttttgacccttacctggacatcgccctggatatccaggcagctcagagtgtcaagcaagctttggaacagttggtgaagcccgaagaactcaatggagagaatgcctatcattgcggtctttgtctccagagggcgccggcctccaacacgttaactttacacacttctgccaaggtcctcatccttgtcttgaagagattctccgatgtcgcaggcaacaaacttgccaagaatgtgcaatatcctgagtgccttgacatgcagccatacatgtctcagcagaacacaggacctcttgtctatgtcctctatgctgtgctggtccacgctgggtggagttgtcacgacggacattacttctcctatgtcaaagctcaagaagtccagtggtataaaatggatgatgccgaggtcactgtctgtagcatcatttctgtcctgagtcaacaggcctatgtcctcttttacatccagaagagtgaatgggaaagacacagtgagagtgtgtcaagaggcagggaaccaagagccctcggcgctgaagacacagacaggcgagcaaagcaaggagagctcaagagagaccacccctgcctccaggcacccgagttggacgagcacttggtggaaagagccactcaggaaagcaccttagaccactggaaattcctgcaagagcaaaacaaaacgaagcctgagttcaacgtcggaaaagtcgaaggtaccctgcctcccaacgcacttgtgattcatcaatcaaaatacaagtgtgggatgaaaaaccatcatcctgaacagcaaagctccctgctaaacctctcttcgacgacccggacagatcaggagtccatgaacactggcacactcgcttctctgcaagggaggaccaggagagccaaagggaagaacaaacacagcaagagggctctgcttgtgtgccagtga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:401447 -> Molecular function: GO:0004221 [ubiquitin thiolesterase activity] evidence: IEA GeneID:401447 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: IEA GeneID:401447 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: IEA GeneID:401447 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:401447 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:401447 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001243802 -> EC 3.4.19.12
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.