GGRNA Home | Help | Advanced search

2020-10-24 06:32:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001256850          104301 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens titin (TTN), transcript variant N2BA, mRNA.
ACCESSION   NM_001256850
VERSION     NM_001256850.1  GI:378925624
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 104301)
  AUTHORS   LeWinter,M.M. and Granzier,H.L.
  TITLE     Titin is a major human disease gene
  JOURNAL   Circulation 127 (8), 938-944 (2013)
   PUBMED   23439446
  REMARK    GeneRIF: [review] Signal pathways of titin isoforms are described
            in a major human cardiovascular disease.
            Review article
REFERENCE   2  (bases 1 to 104301)
  AUTHORS   Hamdani,N., Krysiak,J., Kreusser,M.M., Neef,S., Dos Remedios,C.G.,
            Maier,L.S., Kruger,M., Backs,J. and Linke,W.A.
  TITLE     Crucial role for Ca2(+)/calmodulin-dependent protein kinase-II in
            regulating diastolic stress of normal and failing hearts via titin
            phosphorylation
  JOURNAL   Circ. Res. 112 (4), 664-674 (2013)
   PUBMED   23283722
  REMARK    GeneRIF: Human end-stage failing hearts revealed higher CaMKII
            expression/activity & phosphorylation at PEVK/titin N2B-unique
            sequence sites than donor hearts. Deranged CaMKII-dependent titin
            phosphorylation contributes to altered diastolic stress.
REFERENCE   3  (bases 1 to 104301)
  AUTHORS   Somkuti,J., Martonfalvi,Z., Kellermayer,M.S. and Smeller,L.
  TITLE     Different pressure-temperature behavior of the structured and
            unstructured regions of titin
  JOURNAL   Biochim. Biophys. Acta 1834 (1), 112-118 (2013)
   PUBMED   23063534
  REMARK    GeneRIF: Different pressure-temperature behavior of the structured
            and unstructured regions of titin.
REFERENCE   4  (bases 1 to 104301)
  AUTHORS   Tskhovrebova,L. and Trinick,J.
  TITLE     Roles of titin in the structure and elasticity of the sarcomere
  JOURNAL   J. Biomed. Biotechnol. 2010, 612482 (2010)
   PUBMED   20625501
  REMARK    GeneRIF: Recent titin data is reviewed and its implications for
            sarcomere architecture and elasticity, are discussed.
            Review article
REFERENCE   5  (bases 1 to 104301)
  AUTHORS   Labeit,S., Lahmers,S., Burkart,C., Fong,C., McNabb,M., Witt,S.,
            Witt,C., Labeit,D. and Granzier,H.
  TITLE     Expression of distinct classes of titin isoforms in striated and
            smooth muscles by alternative splicing, and their conserved
            interaction with filamins
  JOURNAL   J. Mol. Biol. 362 (4), 664-681 (2006)
   PUBMED   16949617
  REMARK    GeneRIF: This suggests that the titin Z2-Zis1 domain can link
            filamins and alpha-actinin together in the periphery of the
            Z-line/dense bodies in a fashion that is conserved in smooth and
            striated muscles.
REFERENCE   6  (bases 1 to 104301)
  AUTHORS   Bang,M.L., Centner,T., Fornoff,F., Geach,A.J., Gotthardt,M.,
            McNabb,M., Witt,C.C., Labeit,D., Gregorio,C.C., Granzier,H. and
            Labeit,S.
  TITLE     The complete gene sequence of titin, expression of an unusual
            approximately 700-kDa titin isoform, and its interaction with
            obscurin identify a novel Z-line to I-band linking system
  JOURNAL   Circ. Res. 89 (11), 1065-1072 (2001)
   PUBMED   11717165
REFERENCE   7  (bases 1 to 104301)
  AUTHORS   Freiburg,A., Trombitas,K., Hell,W., Cazorla,O., Fougerousse,F.,
            Centner,T., Kolmerer,B., Witt,C., Beckmann,J.S., Gregorio,C.C.,
            Granzier,H. and Labeit,S.
  TITLE     Series of exon-skipping events in the elastic spring region of
            titin as the structural basis for myofibrillar elastic diversity
  JOURNAL   Circ. Res. 86 (11), 1114-1121 (2000)
   PUBMED   10850961
REFERENCE   8  (bases 1 to 104301)
  AUTHORS   Labeit,S. and Kolmerer,B.
  TITLE     Titins: giant proteins in charge of muscle ultrastructure and
            elasticity
  JOURNAL   Science 270 (5234), 293-296 (1995)
   PUBMED   7569978
REFERENCE   9  (bases 1 to 104301)
  AUTHORS   Furst,D.O., Vinkemeier,U. and Weber,K.
  TITLE     Mammalian skeletal muscle C-protein: purification from bovine
            muscle, binding to titin and the characterization of a full-length
            human cDNA
  JOURNAL   J. Cell. Sci. 102 (PT 4), 769-778 (1992)
   PUBMED   1429890
REFERENCE   10 (bases 1 to 104301)
  AUTHORS   Labeit,S., Gautel,M., Lakey,A. and Trinick,J.
  TITLE     Towards a molecular understanding of titin
  JOURNAL   EMBO J. 11 (5), 1711-1716 (1992)
   PUBMED   1582406
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023270.7, AC010680.10,
            FJ695199.1 and AC009948.3.
            
            Summary: This gene encodes a large abundant protein of striated
            muscle. The product of this gene is divided into two regions, a
            N-terminal I-band and a C-terminal A-band. The I-band, which is the
            elastic part of the molecule, contains two regions of tandem
            immunoglobulin domains on either side of a PEVK region that is rich
            in proline, glutamate, valine and lysine. The A-band, which is
            thought to act as a protein-ruler, contains a mixture of
            immunoglobulin and fibronectin repeats, and possesses kinase
            activity. An N-terminal Z-disc region and a C-terminal M-line
            region bind to the Z-line and M-line of the sarcomere,
            respectively, so that a single titin molecule spans half the length
            of a sarcomere. Titin also contains binding sites for muscle
            associated proteins so it serves as an adhesion template for the
            assembly of contractile machinery in muscle cells. It has also been
            identified as a structural protein for chromosomes. Alternative
            splicing of this gene results in multiple transcript variants.
            Considerable variability exists in the I-band, the M-line and the
            Z-disc regions of titin. Variability in the I-band region
            contributes to the differences in elasticity of different titin
            isoforms and, therefore, to the differences in elasticity of
            different muscle types. Mutations in this gene are associated with
            familial hypertrophic cardiomyopathy 9, and autoantibodies to titin
            are produced in patients with the autoimmune disease scleroderma.
            [provided by RefSeq, Feb 2012].
            
            Transcript Variant: This variant (N2BA) encodes another major
            cardiac isoform (N2BA). It includes the N2A and N2B exons, and also
            the PEVK region. This variant is supported by annotation on DNA
            accession AJ277892.2 and by accompanying data in PMIDs 10850961 and
            11717165.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               AC023270.7         65697-65908         c
            213-316             AC023270.7         63037-63140         c
            317-520             AC023270.7         60623-60826         c
            521-808             AC023270.7         58880-59167         c
            809-894             AC023270.7         58310-58395         c
            895-1139            AC023270.7         57972-58216         c
            1140-1470           AC023270.7         53407-53737         c
            1471-1623           AC023270.7         52884-53036         c
            1624-1761           AC023270.7         51889-52026         c
            1762-1887           AC023270.7         50557-50682         c
            1888-2025           AC023270.7         49193-49330         c
            2026-2163           AC023270.7         48463-48600         c
            2164-2301           AC023270.7         47845-47982         c
            2302-2595           AC023270.7         44333-44626         c
            2596-2718           AC023270.7         44105-44227         c
            2719-3000           AC023270.7         42555-42836         c
            3001-3066           AC023270.7         42205-42270         c
            3067-3325           AC023270.7         41291-41549         c
            3326-3389           AC023270.7         41024-41087         c
            3390-3605           AC023270.7         40697-40912         c
            3606-3748           AC023270.7         39606-39748         c
            3749-3954           AC023270.7         38485-38690         c
            3955-4188           AC023270.7         37714-37947         c
            4189-4433           AC023270.7         37359-37603         c
            4434-4705           AC023270.7         36189-36460         c
            4706-4870           AC023270.7         35905-36069         c
            4871-5039           AC023270.7         35634-35802         c
            5040-6733           AC023270.7         33841-35534         c
            6734-7015           AC023270.7         33406-33687         c
            7016-7282           AC023270.7         32692-32958         c
            7283-7555           AC023270.7         32323-32595         c
            7556-7819           AC023270.7         31947-32210         c
            7820-8080           AC023270.7         31594-31854         c
            8081-8341           AC023270.7         29696-29956         c
            8342-8605           AC023270.7         28897-29160         c
            8606-8866           AC023270.7         28545-28805         c
            8867-9127           AC023270.7         28164-28424         c
            9128-9388           AC023270.7         27158-27418         c
            9389-9530           AC023270.7         26499-26640         c
            9531-9696           AC023270.7         26244-26409         c
            9697-9928           AC023270.7         24866-25097         c
            9929-10213          AC023270.7         23012-23296         c
            10214-10339         AC023270.7         22662-22787         c
            10340-10528         AC023270.7         17469-17657         c
            10529-10585         AC023270.7         11609-11665         c
            10586-10991         AC023270.7         1-406               c
            10992-13366         AC010680.10        173102-175476       c
            13367-13645         AC010680.10        172043-172321       c
            13646-14209         AC010680.10        169472-170035       c
            14210-14491         AC010680.10        168668-168949       c
            14492-14770         AC010680.10        168289-168567       c
            14771-15049         AC010680.10        167575-167853       c
            15050-15328         AC010680.10        167200-167478       c
            15329-15616         AC010680.10        166795-167082       c
            15617-15895         AC010680.10        166401-166679       c
            15896-16177         AC010680.10        166027-166308       c
            16178-16456         AC010680.10        165654-165932       c
            16457-16735         AC010680.10        165266-165544       c
            16736-17014         AC010680.10        164886-165164       c
            17015-17302         AC010680.10        164466-164753       c
            17303-17581         AC010680.10        164054-164332       c
            17582-17863         AC010680.10        163625-163906       c
            17864-18142         AC010680.10        163249-163527       c
            18143-18421         AC010680.10        162852-163130       c
            18422-18700         AC010680.10        162461-162739       c
            18701-18988         AC010680.10        162071-162358       c
            18989-19267         AC010680.10        161546-161824       c
            19268-19549         AC010680.10        161051-161332       c
            19550-19828         AC010680.10        159729-160007       c
            19829-20110         AC010680.10        159329-159610       c
            20111-20389         AC010680.10        158221-158499       c
            20390-20677         AC010680.10        157817-158104       c
            20678-20956         AC010680.10        157379-157657       c
            20957-21235         AC010680.10        157007-157285       c
            21236-21514         AC010680.10        156620-156898       c
            21515-21802         AC010680.10        156220-156507       c
            21803-22090         AC010680.10        155808-156095       c
            22091-22372         AC010680.10        154882-155163       c
            22373-22651         AC010680.10        154346-154624       c
            22652-22933         AC010680.10        153944-154225       c
            22934-23212         AC010680.10        153515-153793       c
            23213-23500         AC010680.10        153125-153412       c
            23501-23779         AC010680.10        152656-152934       c
            23780-24058         AC010680.10        152283-152561       c
            24059-24337         AC010680.10        151904-152182       c
            24338-24625         AC010680.10        151484-151771       c
            24626-24913         AC010680.10        151056-151343       c
            24914-25195         AC010680.10        149454-149735       c
            25196-25474         AC010680.10        148947-149225       c
            25475-25756         AC010680.10        148253-148534       c
            25757-26035         AC010680.10        147858-148136       c
            26036-26323         AC010680.10        147046-147333       c
            26324-26602         AC010680.10        146658-146936       c
            26603-26881         AC010680.10        146276-146554       c
            26882-27160         AC010680.10        145905-146183       c
            27161-27448         AC010680.10        145023-145310       c
            27449-27736         AC010680.10        144596-144883       c
            27737-28027         AC010680.10        143527-143817       c
            28028-28315         AC010680.10        141487-141774       c
            28316-28408         AC010680.10        140823-140915       c
            28409-28694         AC010680.10        140415-140700       c
            28695-28878         AC010680.10        139135-139318       c
            28879-28968         AC010680.10        138838-138927       c
            28969-29236         AC010680.10        138471-138738       c
            29237-29497         AC010680.10        138108-138368       c
            29498-29707         AC010680.10        136415-136624       c
            29708-29785         AC010680.10        136129-136206       c
            29786-29812         AC010680.10        136001-136027       c
            29813-29872         AC010680.10        135489-135548       c
            29873-29956         AC010680.10        135081-135164       c
            29957-30028         AC010680.10        132804-132875       c
            30029-30076         AC010680.10        131082-131129       c
            30077-30481         AC010680.10        129826-130230       c
            30482-30544         AC010680.10        129309-129371       c
            30545-30622         AC010680.10        128790-128867       c
            30623-30700         AC010680.10        128560-128637       c
            30701-30787         AC010680.10        127883-127969       c
            30788-30868         AC010680.10        127570-127650       c
            30869-30952         AC010680.10        126458-126541       c
            30953-31036         AC010680.10        125977-126060       c
            31037-31120         AC010680.10        123774-123857       c
            31121-31201         AC010680.10        123476-123556       c
            31202-31285         AC010680.10        123251-123334       c
            31286-31369         AC010680.10        123014-123097       c
            31370-31471         AC010680.10        122638-122739       c
            31472-31585         AC010680.10        122072-122185       c
            31586-31666         AC010680.10        119479-119559       c
            31667-31744         AC010680.10        119214-119291       c
            31745-31828         AC010680.10        118867-118950       c
            31829-31912         AC010680.10        118627-118710       c
            31913-31996         AC010680.10        118291-118374       c
            31997-32080         AC010680.10        117960-118043       c
            32081-32161         AC010680.10        117172-117252       c
            32162-32368         AC010680.10        116658-116864       c
            32369-32446         AC010680.10        115622-115699       c
            32447-32521         AC010680.10        115337-115411       c
            32522-32614         AC010680.10        115040-115132       c
            32615-32692         AC010680.10        114215-114292       c
            32693-32854         AC010680.10        113855-114016       c
            32855-32938         AC010680.10        113560-113643       c
            32939-33016         AC010680.10        113300-113377       c
            33017-33100         AC010680.10        112708-112791       c
            33101-33184         AC010680.10        112375-112458       c
            33185-33268         AC010680.10        112086-112169       c
            33269-33565         AC010680.10        111582-111878       c
            33566-33640         AC010680.10        109882-109956       c
            33641-33715         AC010680.10        109000-109074       c
            33716-33811         AC010680.10        108275-108370       c
            33812-33889         AC010680.10        107594-107671       c
            33890-33958         AC010680.10        106596-106664       c
            33959-34033         AC010680.10        106368-106442       c
            34034-34330         AC010680.10        105932-106228       c
            34331-34411         AC010680.10        105051-105131       c
            34412-34489         AC010680.10        104179-104256       c
            34490-34579         AC010680.10        96927-97016         c
            34580-34663         AC010680.10        93133-93216         c
            34664-34747         AC010680.10        92966-93049         c
            34748-34831         AC010680.10        86419-86502         c
            34832-34915         AC010680.10        86225-86308         c
            34916-34999         AC010680.10        86057-86140         c
            35000-35083         AC010680.10        85845-85928         c
            35084-35167         AC010680.10        85627-85710         c
            35168-35251         AC010680.10        85414-85497         c
            35252-35329         AC010680.10        85204-85281         c
            35330-35413         AC010680.10        84712-84795         c
            35414-35521         AC010680.10        84125-84232         c
            35522-35599         AC010680.10        83778-83855         c
            35600-35710         AC010680.10        79881-79991         c
            35711-35779         AC010680.10        78509-78577         c
            35780-35860         AC010680.10        76198-76278         c
            35861-35935         AC010680.10        75202-75276         c
            35936-36025         AC010680.10        74502-74591         c
            36026-36088         AC010680.10        74009-74071         c
            36089-36178         AC010680.10        73660-73749         c
            36179-36229         AC010680.10        71330-71380         c
            36230-36631         AC010680.10        70359-70760         c
            36632-36910         AC010680.10        69924-70202         c
            36911-37186         AC010680.10        69401-69676         c
            37187-37326         AC010680.10        69126-69265         c
            37327-37453         AC010680.10        68684-68810         c
            37454-37717         AC010680.10        68327-68590         c
            37718-37984         AC010680.10        67778-68044         c
            37985-38248         AC010680.10        67374-67637         c
            38249-38388         AC010680.10        67148-67287         c
            38389-38515         AC010680.10        66879-67005         c
            38516-38782         AC010680.10        66487-66753         c
            38783-39049         AC010680.10        66108-66374         c
            39050-39316         AC010680.10        64995-65261         c
            39317-39456         AC010680.10        64765-64904         c
            39457-39583         AC010680.10        64202-64328         c
            39584-39726         AC010680.10        63262-63404         c
            39727-39850         AC010680.10        59234-59357         c
            39851-40117         AC010680.10        58426-58692         c
            40118-40215         AC010680.10        56631-56728         c
            40216-40384         AC010680.10        55801-55969         c
            40385-40651         AC010680.10        55436-55702         c
            40652-40918         AC010680.10        55063-55329         c
            40919-41197         AC010680.10        54676-54954         c
            41198-41606         AC010680.10        54178-54586         c
            41607-41731         AC010680.10        53949-54073         c
            41732-41998         AC010680.10        53582-53848         c
            41999-42268         AC010680.10        52545-52814         c
            42269-42571         AC010680.10        52150-52452         c
            42572-42874         AC010680.10        51740-52042         c
            42875-43062         AC010680.10        51286-51473         c
            43063-43177         AC010680.10        51081-51195         c
            43178-43462         AC010680.10        50690-50974         c
            43463-43614         AC010680.10        50440-50591         c
            43615-43762         AC010680.10        49602-49749         c
            43763-43940         AC010680.10        49268-49445         c
            43941-44062         AC010680.10        48808-48929         c
            44063-44350         AC010680.10        48427-48714         c
            44351-44647         AC010680.10        48013-48309         c
            44648-44834         AC010680.10        47712-47898         c
            44835-44950         AC010680.10        47122-47237         c
            44951-45250         AC010680.10        46734-47033         c
            45251-45550         AC010680.10        46238-46537         c
            45551-45656         AC010680.10        46018-46123         c
            45657-45853         AC010680.10        45719-45915         c
            45854-46159         AC010680.10        45333-45638         c
            46160-46438         AC010680.10        44954-45232         c
            46439-46738         AC010680.10        44051-44350         c
            46739-47041         AC010680.10        43645-43947         c
            47042-47404         AC010680.10        43169-43531         c
            47405-47707         AC010680.10        42567-42869         c
            47708-48007         AC010680.10        42139-42438         c
            48008-48304         AC010680.10        41746-42042         c
            48305-48589         AC010680.10        41362-41646         c
            48590-48883         AC010680.10        40982-41275         c
            48884-49183         AC010680.10        39375-39674         c
            49184-49492         AC010680.10        38948-39256         c
            49493-49683         AC010680.10        38669-38859         c
            49684-50113         AC010680.10        37837-38266         c
            50114-50422         AC010680.10        36243-36551         c
            50423-50571         AC010680.10        35963-36111         c
            50572-50604         AC010680.10        35843-35875         c
            50605-50734         AC010680.10        35619-35748         c
            50735-51034         AC010680.10        35226-35525         c
            51035-51352         AC010680.10        34815-35132         c
            51353-51649         AC010680.10        33515-33811         c
            51650-51949         AC010680.10        33107-33406         c
            51950-52264         AC010680.10        32709-33023         c
            52265-52413         AC010680.10        32467-32615         c
            52414-52564         AC010680.10        31869-32019         c
            52565-52716         AC010680.10        31629-31780         c
            52717-52846         FJ695199.1         64-193              c
            52847-53149         AC010680.10        29469-29771         c
            53150-53452         AC010680.10        28306-28608         c
            53453-53734         AC010680.10        27923-28204         c
            53735-54034         AC010680.10        27530-27829         c
            54035-54337         AC010680.10        27135-27437         c
            54338-54646         AC010680.10        26737-27045         c
            54647-54928         AC010680.10        26341-26622         c
            54929-55228         AC010680.10        25940-26239         c
            55229-55522         AC010680.10        25561-25854         c
            55523-58489         AC010680.10        22500-25466         c
            58490-58810         AC010680.10        21861-22181         c
            58811-59095         AC010680.10        21478-21762         c
            59096-59395         AC010680.10        21080-21379         c
            59396-59698         AC010680.10        20467-20769         c
            59699-59974         AC010680.10        19034-19309         c
            59975-60274         AC010680.10        18631-18930         c
            60275-60577         AC010680.10        18238-18540         c
            60578-60877         AC010680.10        17569-17868         c
            60878-61165         AC010680.10        16902-17189         c
            61166-61462         AC010680.10        16258-16554         c
            61463-61765         AC010680.10        15868-16170         c
            61766-62071         AC010680.10        15461-15766         c
            62072-62359         AC010680.10        14284-14571         c
            62360-62650         AC010680.10        13901-14191         c
            62651-62938         AC010680.10        13523-13810         c
            62939-63526         AC010680.10        12768-13355         c
            63527-63631         AC010680.10        12573-12677         c
            63632-63829         AC010680.10        11950-12147         c
            63830-64126         AC010680.10        11564-11860         c
            64127-64714         AC010680.10        10885-11472         c
            64715-65017         AC010680.10        10491-10793         c
            65018-75395         AC010680.10        1-10378             c
            75396-82123         AC009948.3         165901-172628       c
            82124-82420         AC009948.3         164931-165227       c
            82421-83008         AC009948.3         164238-164825       c
            83009-83311         AC009948.3         163843-164145       c
            83312-83608         AC009948.3         163438-163734       c
            83609-83896         AC009948.3         161455-161742       c
            83897-84196         AC009948.3         161043-161342       c
            84197-84499         AC009948.3         160504-160806       c
            84500-84805         AC009948.3         160092-160397       c
            84806-86572         AC009948.3         158220-159986       c
            86573-86866         AC009948.3         157557-157850       c
            86867-87154         AC009948.3         156576-156863       c
            87155-87454         AC009948.3         156160-156459       c
            87455-89521         AC009948.3         153997-156063       c
            89522-89824         AC009948.3         153593-153895       c
            89825-90130         AC009948.3         153190-153495       c
            90131-90421         AC009948.3         152802-153092       c
            90422-90718         AC009948.3         152410-152706       c
            90719-91024         AC009948.3         151978-152283       c
            91025-91330         AC009948.3         150791-151096       c
            91331-91612         AC009948.3         150424-150705       c
            91613-92206         AC009948.3         149659-150252       c
            92207-92494         AC009948.3         149252-149539       c
            92495-92794         AC009948.3         148854-149153       c
            92795-93097         AC009948.3         147872-148174       c
            93098-93400         AC009948.3         146658-146960       c
            93401-93985         AC009948.3         145972-146556       c
            93986-94291         AC009948.3         145536-145841       c
            94292-94591         AC009948.3         145130-145429       c
            94592-95167         AC009948.3         143932-144507       c
            95168-95473         AC009948.3         143528-143833       c
            95474-96067         AC009948.3         142572-143165       c
            96068-101676        AC009948.3         136831-142439       c
            101677-101833       AC009948.3         136550-136706       c
            101834-102525       AC009948.3         135118-135809       c
            102526-102679       AC009948.3         134864-135017       c
            102680-102982       AC009948.3         134036-134338       c
            102983-104301       AC009948.3         132579-133897       c
FEATURES             Location/Qualifiers
     source          1..104301
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31"
     gene            1..104301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="titin"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
     exon            1..212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647840"
     misc_feature    202..204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="upstream in-frame stop codon"
     exon            213..316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     CDS             226..103278
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /EC_number="2.7.11.1"
                     /note="isoform N2BA is encoded by transcript variant N2BA;
                     connectin; rhabdomyosarcoma antigen MU-RMS-40.14"
                     /codon_start=1
                     /product="titin isoform N2BA"
                     /protein_id="NP_001243779.1"
                     /db_xref="GI:378925625"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
                     /translation="
MTTQAPTFTQPLQSVVVLEGSTATFEAHISGFPVPEVSWFRDGQVISTSTLPGVQISFSDGRAKLTIPAVTKANSGRYSLKATNGSGQATSTAELLVKAETAPPNFVQRLQSMTVRQGSQVRLQVRVTGIPTPVVKFYRDGAEIQSSLDFQISQEGDLYSLLIAEAYPEDSGTYSVNATNSVGRATSTAELLVQGEEEVPAKKTKTIVSTAQISESRQTRIEKKIEAHFDARSIATVEMVIDGAAGQQLPHKTPPRIPPKPKSRSPTPPSIAAKAQLARQQSPSPIRHSPSPVRHVRAPTPSPVRSVSPAARISTSPIRSVRSPLLMRKTQASTVATGPEVPPPWKQEGYVASSSEAEMRETTLTTSTQIRTEERWEGRYGVQEQVTISGAAGAAASVSASASYAAEAVATGAKEVKQDADKSAAVATVVAAVDMARVREPVISAVEQTAQRTTTTAVHIQPAQEQVRKEAEKTAVTKVVVAADKAKEQELKSRTKEVITTKQEQMHVTHEQIRKETEKTFVPKVVISAAKAKEQETRISEEITKKQKQVTQEAIRQETEITAASMVVVATAKSTKLETVPGAQEETTTQQDQMHLSYEKIMKETRKTVVPKVIVATPKVKEQDLVSRGREGITTKREQVQITQEKMRKEAEKTALSTIAVATAKAKEQETILRTRETMATRQEQIQVTHGKVDVGKKAEAVATVVAAVDQARVREPREPGHLEESYAQQTTLEYGYKERISAAKVAEPPQRPASEPHVVPKAVKPRVIQAPSETHIKTTDQKGMHISSQIKKTTDLTTERLVHVDKRPRTASPHFTVSKISVPKTEHGYEASIAGSAIATLQKELSATSSAQKITKSVKAPTVKPSETRVRAEPTPLPQFPFADTPDTYKSEAGVEVKKEVGVSITGTTVREERFEVLHGREAKVTETARVPAPVEIPVTPPTLVSGLKNVTVIEGESVTLECHISGYPSPTVTWYREDYQIESSIDFQITFQSGIARLMIREAFAEDSGRFTCSAVNEAGTVSTSCYLAVQVSEEFEKETTAVTEKFTTEEKRFVESRDVVMTDTSLTEEQAGPGEPAAPYFITKPVVQKLVEGGSVVFGCQVGGNPKPHVYWKKSGVPLTTGYRYKVSYNKQTGECKLVISMTFADDAGEYTIVVRNKHGETSASASLLEEADYELLMKSQQEMLYQTQVTAFVQEPKVGETAPGFVYSEYEKEYEKEQALIRKKMAKDTVVVRTYVEDQEFHISSFEERLIKEIEYRIIKTTLEELLEEDGEEKMAVDISESEAVESGFDSRIKNYRILEGMGVTFHCKMSGYPLPKIAWYKDGKRIKHGERYQMDFLQDGRASLRIPVVLPEDEGIYTAFASNIKGNAICSGKLYVEPAAPLGAPTYIPTLEPVSRIRSLSPRSVSRSPIRMSPARMSPARMSPARMSPARMSPGRRLEETDESQLERLYKPVFVLKPVSFKCLEGQTARFDLKVVGRPMPETFWFHDGQQIVNDYTHKVVIKEDGTQSLIIVPATPSDSGEWTVVAQNRAGRSSISVILTVEAVEHQVKPMFVEKLKNVNIKEGSRLEMKVRATGNPNPDIVWLKNSDIIVPHKYPKIRIEGTKGEAALKIDSTVSQDSAWYTATAINKAGRDTTRCKVNVEVEFAEPEPERKLIIPRGTYRAKEIAAPELEPLHLRYGQEQWEEGDLYDKEKQQKPFFKKKLTSLRLKRFGPAHFECRLTPIGDPTMVVEWLHDGKPLEAANRLRMINEFGYCSLDYGVAYSRDSGIITCRATNKYGTDHTSATLIVKDEKSLVEESQLPEGRKGLQRIEELERMAHEGALTGVTTDQKEKQKPDIVLYPEPVRVLEGETARFRCRVTGYPQPKVNWYLNGQLIRKSKRFRVRYDGIHYLDIVDCKSYDTGEVKVTAENPEGVIEHKVKLEIQQREDFRSVLRRAPEPRPEFHVHEPGKLQFEVQKVDRPVDTTETKEVVKLKRAERITHEKVPEESEELRSKFKRRTEEGYYEAITAVELKSRKKDESYEELLRKTKDELLHWTKELTEEEKKALAEEGKITIPTFKPDKIELSPSMEAPKIFERIQSQTVGQGSDAHFRVRVVGKPDPECEWYKNGVKIERSDRIYWYWPEDNVCELVIRDVTAEDSASIMVKAINIAGETSSHAFLLVQAKQLITFTQELQDVVAKEKDTMATFECETSEPFVKVKWYKDGMEVHEGDKYRMHSDRKVHFLSILTIDTSDAEDYSCVLVEDENVKTTAKLIVEGAVVEFVKELQDIEVPESYSGELECIVSPENIEGKWYHNDVELKSNGKYTITSRRGRQNLTVKDVTKEDQGEYSFVIDGKKTTCKLKMKPRPIAILQGLSDQKVCEGDIVQLEVKVSLESVEGVWMKDGQEVQPSDRVHIVIDKQSHMLLIEDMTKEDAGNYSFTIPALGLSTSGRVSVYSVDVITPLKDVNVIEGTKAVLECKVSVPDVTSVKWYLNDEQIKPDDRVQAIVKGTKQRLVINRTHASDEGPYKLIVGRVETNCNLSVEKIKIIRGLRDLTCTETQNVVFEVELSHSGIDVLWNFKDKEIKPSSKYKIEAHGKIYKLTVLNMMKDDEGKYTFYAGENMTSGKLTVAGGAISKPLTDQTVAESQEAVFECEVANPDSKGEWLRDGKHLPLTNNIRSESDGHKRRLIIAATKLDDIGEYTYKVATSKTSAKLKVEAVKIKKTLKNLTVTETQDAVFTVELTHPNVKGVQWIKNGVVLESNEKYAISVKGTIYSLRIKNCAIVDESVYGFRLGRLGASARLHVETVKIIKKPKDVTALENATVAFEVSVSHDTVPVKWFHKSVEIKPSDKHRLVSERKVHKLMLQNISPSDAGEYTAVVGQLECKAKLFVETLHITKTMKNIEVPETKTASFECEVSHFNVPSMWLKNGVEIEMSEKFKIVVQGKLHQLIIMNTSTEDSAEYTFVCGNDQVSATLTVTPIMITSMLKDINAEEKDTITFEVTVNYEGISYKWLKNGVEIKSTDKCQMRTKKLTHSLNIRNVHFGDAADYTFVAGKATSTATLYVEARHIEFRKHIKDIKVLEKKRAMFECEVSEPDITVQWMKDDQELQITDRIKIQKEKYVHRLLIPSTRMSDAGKYTVVAGGNVSTAKLFVEGRDVRIRSIKKEVQVIEKQRAVVEFEVNEDDVDAHWYKDGIEINFQVQERHKYVVERRIHRMFISETRQSDAGEYTFVAGRNRSSVTLYVNAPEPPQVLQELQPVTVQSGKPARFCAVISGRPQPKISWYKEEQLLSTGFKCKFLHDGQEYTLLLIEAFPEDAAVYTCEAKNDYGVATTSASLSVEVPEVVSPDQEMPVYPPAIITPLQDTVTSEGQPARFQCRVSGTDLKVSWYSKDKKIKPSRFFRMTQFEDTYQLEIAEAYPEDEGTYTFVASNAVGQVSSTANLSLEAPESILHERIEQEIEMEMKEFSSSFLSAEEEGLHSAELQLSKINETLELLSESPVYPTKFDSEKEGTGPIFIKEVSNADISMGDVATLSVTVIGIPKPKIQWFFNGVLLTPSADYKFVFDGDDHSLIILFTKLEDEGEYTCMASNDYGKTICSAYLKINSKGEGHKDTETESAVAKSLEKLGGPCPPHFLKELKPIRCAQGLPAIFEYTVVGEPAPTVTWFKENKQLCTSVYYTIIHNPNGSGTFIVNDPQREDSGLYICKAENMLGESTCAAELLVLLEDTDMTDTPCKAKSTPEAPEDFPQTPLKGPAVEALDSEQEIATFVKDTILKAALITEENQQLSYEHIAKANELSSQLPLGAQELQSILEQDKLTPESTREFLCINGSIHFQPLKEPSPNLQLQIVQSQKTFSKEGILMPEEPETQAVLSDTEKIFPSAMSIEQINSLTVEPLKTLLAEPEGNYPQSSIEPPMHSYLTSVAEEVLSPKEKTVSDTNREQRVTLQKQEAQSALILSQSLAEGHVESLQSPDVMISQVNYEPLVPSEHSCTEGGKILIESANPLENAGQDSAVRIEEGKSLRFPLALEEKQVLLKEEHSDNVVMPPDQIIESKREPVAIKKVQEVQGRDLLSKESLLSGIPEEQRLNLKIQICRALQAAVASEQPGLFSEWLRNIEKVEVEAVNITQEPRHIMCMYLVTSAKSVTEEVTIIIEDVDPQMANLKMELRDALCAIIYEEIDILTAEGPRIQQGAKTSLQEEMDSFSGSQKVEPITEPEVESKYLISTEEVSYFNVQSRVKYLDATPVTKGVASAVVSDEKQDESLKPSEEKEESSSESGTEEVATVKIQEAEGGLIKEDGPMIHTPLVDTVSEEGDIVHLTTSITNAKEVNWYFENKLVPSDEKFKCLQDQNTYTLVIDKVNTEDHQGEYVCEALNDSGKTATSAKLTVVKRAAPVIKRKIEPLEVALGHLAKFTCEIQSAPNVRFQWFKAGREIYESDKCSIRSSKYISSLEILRTQVVDCGEYTCKASNEYGSVSCTATLTVTEAYPPTFLSRPKSLTTFVGKAAKFICTVTGTPVIETIWQKDGAALSPSPNWRISDAENKHILELSNLTIQDRGVYSCKASNKFGADICQAELIIIDKPHFIKELEPVQSAINKKVHLECQVDEDRKVTVTWSKDGQKLPPGKDYKICFEDKIATLEIPLAKLKDSGTYVCTASNEAGSSSCSATVTVREPPSFVKKVDPSYLMLPGESARLHCKLKGSPVIQVTWFKNNKELSESNTVRMYFVNSEAILDITDVKVEDSGSYSCEAVNDVGSDSCSTEIVIKEPPSFIKTLEPADIVRGTNALLQCEVSGTGPFEISWFKDKKQIRSSKKYRLFSQKSLVCLEIFSFNSADVGEYECVVANEVGKCGCMATHLLKEPPTFVKKVDDLIALGGQTVTLQAAVRGSEPISVTWMKGQEVIREDGKIKMSFSNGVAVLIIPDVQISFGGKYTCLAENEAGSQTSVGELIVKEPAKIIERAELIQVTAGDPATLEYTVAGTPELKPKWYKDGRPLVASKKYRISFKNNVAQLKFYSAELHDSGQYTFEISNEVGSSSCETTFTVLDRDIAPFFTKPLRNVDSVVNGTCRLDCKIAGSLPMRVSWFKDGKEIAASDRYRIAFVEGTASLEIIRVDMNDAGNFTCRATNSVGSKDSSGALIVQEPPSFVTKPGSKDVLPGSAVCLKSTFQGSTPLTIRWFKGNKELVSGGSCYITKEALESSLELYLVKTSDSGTYTCKVSNVAGGVECSANLFVKEPATFVEKLEPSQLLKKGDATQLACKVTGTPPIKITWFANDREIKESSKHRMSFVESTAVLRLTDVGIEDSGEYMCEAQNEAGSDHCSSIVIVKESPYFTKEFKPIEVLKEYDVMLLAEVAGTPPFEITWFKDNTILRSGRKYKTFIQDHLVSLQILKFVAADAGEYQCRVTNEVGSSICSARVTLREPPSFIKKIESTSSLRGGTAAFQATLKGSLPITVTWLKDSDEITEDDNIRMTFENNVASLYLSGIEVKHDGKYVCQAKNDAGIQRCSALLSVKEPATITEEAVSIDVTQGDPATLQVKFSGTKEITAKWFKDGQELTLGSKYKISVTDTVSILKIISTEKKDSGEYTFEVQNDVGRSSCKARINVLDLIIPPSFTKKLKKMDSIKGSFIDLECIVAGSHPISIQWFKDDQEISASEKYKFSFHDNTAFLEISQLEGTDSGTYTCSATNKAGHNQCSGHLTVKEPPYFVEKPQSQDVNPNTRVQLKALVGGTAPMTIKWFKDNKELHSGAARSVWKDDTSTSLELFAAKATDSGTYICQLSNDVGTATSKATLFVKEPPQFIKKPSPVLVLRNGQSTTFECQITGTPKIRVSWYLDGNEITAIQKHGISFIDGLATFQISGARVENSGTYVCEARNDAGTASCSIELKVKEPPTFIRELKPVEVVKYSDVELECEVTGTPPFEVTWLKNNREIRSSKKYTLTDRVSVFNLHITKCDPSDTGEYQCIVSNEGGSCSCSTRVALKEPPSFIKKIENTTTVLKSSATFQSTVAGSPPISITWLKDDQILDEDDNVYISFVDSVATLQIRSVDNGHSGRYTCQAKNESGVERCYAFLLVQEPAQIVEKAKSVDVTEKDPMTLECVVAGTPELKVKWLKDGKQIVPSRYFSMSFENNVASFRIQSVMKQDSGQYTFKVENDFGSSSCDAYLRVLDQNIPPSFTKKLTKMDKVLGSSIHMECKVSGSLPISAQWFKDGKEISTSAKYRLVCHERSVSLEVNNLELEDTANYTCKVSNVAGDDACSGILTVKEPPSFLVKPGRQQAIPDSTVEFKAILKGTPPFKIKWFKDDVELVSGPKCFIGLEGSTSFLNLYSVDASKTGQYTCHVTNDVGSDSCTTMLLVTEPPKFVKKLEASKIVKAGDSSRLECKIAGSPEIRVVWFRNEHELPASDKYRMTFIDSVAVIQMNNLSTEDSGDFICEAQNPAGSTSCSTKVIVKEPPVFSSFPPIVETLKNAEVSLECELSGTPPFEVVWYKDKRQLRSSKKYKIASKNFHTSIHILNVDTSDIGEYHCKAQNEVGSDTCVCTVKLKEPPRFVSKLNSLTVVAGEPAELQASIEGAQPIFVQWLKEKEEVIRESENIRITFVENVATLQFAKAEPANAGKYICQIKNDGGMRENMATLMVLEPAVIVEKAGPMTVTVGETCTLECKVAGTPELSVEWYKDGKLLTSSQKHKFSFYNKISSLRILSVERQDAGTYTFQVQNNVGKSSCTAVVDVSDRAVPPSFTRRLKNTGGVLGASCILECKVAGSSPISVAWFHEKTKIVSGAKYQTTFSDNVCTLQLNSLDSSDMGNYTCVAANVAGSDECRAVLTVQEPPSFVKEPEPLEVLPGKNVTFTSVIRGTPPFKVNWFRGARELVKGDRCNIYFEDTVAELELFNIDISQSGEYTCVVSNNAGQASCTTRLFVKEPAAFLKRLSDHSVEPGKSIILESTYTGTLPISVTWKKDGFNITTSEKCNIVTTEKTCILEILNSTKRDAGQYSCEIENEAGRDVCGALVSTLEPPYFVTELEPLEAAVGDSVSLQCQVAGTPEITVSWYKGDTKLRPTPEYRTYFTNNVATLVFNKVNINDSGEYTCKAENSIGTASSKTVFRIQERQLPPSFARQLKDIEQTVGLPVTLTCRLNGSAPIQVCWYRDGVLLRDDENLQTSFVDNVATLKILQTDLSHSGQYSCSASNPLGTASSSARLTAREPKKSPFFDIKPVSIDVIAGESADFECHVTGAQPMRITWSKDNKEIRPGGNYTITCVGNTPHLRILKVGKGDSGQYTCQATNDVGKDMCSAQLSVKEPPKFVKKLEASKVAKQGESIQLECKISGSPEIKVSWFRNDSELHESWKYNMSFINSVALLTINEASAEDSGDYICEAHNGVGDASCSTALTVKAPPVFTQKPSPVGALKGSDVILQCEISGTPPFEVVWVKDRKQVRNSKKFKITSKHFDTSLHILNLEASDVGEYHCKATNEVGSDTCSCSVKFKEPPRFVKKLSDTSTLIGDAVELRAIVEGFQPISVVWLKDRGEVIRESENTRISFIDNIATLQLGSPEASNSGKYICQIKNDAGMRECSAVLTVLEPARIIEKPEPMTVTTGNPFALECVVTGTPELSAKWFKDGRELSADSKHHITFINKVASLKIPCAEMSDKGLYSFEVKNSVGKSNCTVSVHVSDRIVPPSFIRKLKDVNAILGASVVLECRVSGSAPISVGWFQDGNEIVSGPKCQSSFSENVCTLNLSLLEPSDTGIYTCVAANVAGSDECSAVLTVQEPPSFEQTPDSVEVLPGMSLTFTSVIRGTPPFKVKWFKGSRELVPGESCNISLEDFVTELELFEVQPLESGDYSCLVTNDAGSASCTTHLFVKEPATFVKRLADFSVETGSPIVLEATYTGTPPISVSWIKDEYLISQSERCSITMTEKSTILEILESTIEDYAQYSCLIENEAGQDICEALVSVLEPPYFIEPLEHVEAVIGEPATLQCKVDGTPEIRISWYKEHTKLRSAPAYKMQFKNNVASLVINKVDHSDVGEYSCKADNSVGAVASSAVLVIKARKLPPFFARKLKDVHETLGFPVAFECRINGSEPLQVSWYKDGVLLKDDANLQTSFVHNVATLQILQTDQSHIGQYNCSASNPLGTASSSAKLILSEHEVPPFFDLKPVSVDLALGESGTFKCHVTGTAPIKITWAKDNREIRPGGNYKMTLVENTATLTVLKVGKGDAGQYTCYASNIAGKDSCSAQLGVQEPPRFIKKLEPSRIVKQDEFTRYECKIGGSPEIKVLWYKDETEIQESSKFRMSFVDSVAVLEMHNLSVEDSGDYTCEAHNAAGSASSSTSLKVKEPPIFRKKPHPIETLKGADVHLECELQGTPPFHVSWYKDKRELRSGKKYKIMSENFLTSIHILNVDAADIGEYQCKATNDVGSDTCVGSIALKAPPRFVKKLSDISTVVGKEVQLQTTIEGAEPISVVWFKDKGEIVRESDNIWISYSENIATLQFSRVEPANAGKYTCQIKNDAGMQECFATLSVLEPATIVEKPESIKVTTGDTCTLECTVAGTPELSTKWFKDGKELTSDNKYKISFFNKVSGLKIINVAPSDSGVYSFEVQNPVGKDSCTASLQVSDRTVPPSFTRKLKETNGLSGSSVVMECKVYGSPPISVSWFHEGNEISSGRKYQTTLTDNTCALTVNMLEESDSGDYTCIATNMAGSDECSAPLTVREPPSFVQKPDPMDVLTGTNVTFTSIVKGTPPFSVSWFKGSSELVPGDRCNVSLEDSVAELELFDVDTSQSGEYTCIVSNEAGKASCTTHLYIKAPAKFVKRLNDYSIEKGKPLILEGTFTGTPPISVTWKKNGINVTPSQRCNITTTEKSAILEIPSSTVEDAGQYNCYIENASGKDSCSAQILILEPPYFVKQLEPVKVSVGDSASLQCQLAGTPEIGVSWYKGDTKLRPTTTYKMHFRNNVATLVFNQVDINDSGEYICKAENSVGEVSASTFLTVQEQKLPPSFSRQLRDVQETVGLPVVFDCAISGSEPISVSWYKDGKPLKDSPNVQTSFLDNTATLNIFKTDRSLAGQYSCTATNPIGSASSSARLILTEGKNPPFFDIRLAPVDAVVGESADFECHVTGTQPIKVSWAKDSREIRSGGKYQISYLENSAHLTVLKVDKGDSGQYTCYAVNEVGKDSCTAQLNIKERLIPPSFTKRLSETVEETEGNSFKLEGRVAGSQPITVAWYKNNIEIQPTSNCEITFKNNTLVLQVRKAGMNDAGLYTCKVSNDAGSALCTSSIVIKEPKKPPVFDQHLTPVTVSEGEYVQLSCHVQGSEPIRIQWLKAGREIKPSDRCSFSFASGTAVLELRDVAKADSGDYVCKASNVAGSDTTKSKVTIKDKPAVAPATKKAAVDGRLFFVSEPQSIRVVEKTTATFIAKVGGDPIPNVKWTKGKWRQLNQGGRVFIHQKGDEAKLEIRDTTKTDSGLYRCVAFNEHGEIESNVNLQVDERKKQEKIEGDLRAMLKKTPILKKGAGEEEEIDIMELLKNVDPKEYEKYARMYGITDFRGLLQAFELLKQSQEEETHRLEIEEIERSERDEKEFEELVSFIQQRLSQTEPVTLIKDIENQTVLKDNDAVFEIDIKINYPEIKLSWYKGTEKLEPSDKFEISIDGDRHTLRVKNCQLKDQGNYRLVCGPHIASAKLTVIEPAWERHLQDVTLKEGQTCTMTCQFSVPNVKSEWFRNGRILKPQGRHKTEVEHKVHKLTIADVRAEDQGQYTCKYEDLETSAELRIEAEPIQFTKRIQNIVVSEHQSATFECEVSFDDAIVTWYKGPTELTESQKYNFRNDGRCHYMTIHNVTPDDEGVYSVIARLEPRGEARSTAELYLTTKEIKLELKPPDIPDSRVPIPTMPIRAVPPEEIPPVVAPPIPLLLPTPEEKKPPPKRIEVTKKAVKKDAKKVVAKPKEMTPREEIVKKPPPPTTLIPAKAPEIIDVSSKAEEVKIMTITRKKEVQKEKEAVYEKKQAVHKEKRVFIESFEEPYDELEVEPYTEPFEQPYYEEPDEDYEEIKVEAKKEVHEEWEEDFEEGQEYYEREEGYDEGEEEWEEAYQEREVIQVQKEVYEESHERKVPAKVPEKKAPPPPKVIKKPVIEKIEKTSRRMEEEKVQVTKVPEVSKKIVPQKPSRTPVQEEVIEVKVPAVHTKKMVISEEKMFFASHTEEEVSVTVPEVQKEIVTEEKIHVAISKRVEPPPKVPELPEKPAPEEVAPVPIPKKVEPPAPKVPEVPKKPVPEEKKPVPVPKKEPAAPPKVPEVPKKPVPEEKIPVPVAKKKEAPPAKVPEVQKGVVTEEKITIVTQREESPPPAVPEIPKKKVPEERKPVPRKEEEVPPPPKVPALPKKPVPEEKVAVPVPVAKKAPPPRAEVSKKTVVEEKRFVAEEKLSFAVPQRVEVTRHEVSAEEEWSYSEEEEGVSISVYREEEREEEEEAEVTEYEVMEEPEEYVVEEKLHIISKRVEAEPAEVTERQEKKIVLKPKIPAKIEEPPPAKVPEAPKKIVPEKKVPAPVPKKEKVPPPKVPEEPKKPVPEKKVPPKVIKMEEPLPAKVTERHMQITQEEKVLVAVTKKEAPPKARVPEEPKRAVPEEKVLKLKPKREEEPPAKVTEFRKRVVKEEKVSIEAPKREPQPIKEVTIMEEKERAYTLEEEAVSVQREEEYEEYEEYDYKEFEEYEPTEEYDQYEEYEEREYERYEEHEEYITEPEKPIPVKPVPEEPVPTKPKAPPAKVLKKAVPEEKVPVPIPKKLKPPPPKVPEEPKKVFEEKIRISITKREKEQVTEPAAKVPMKPKRVVAEEKVPVPRKEVAPPVRVPEVPKELEPEEVAFEEEVVTHVEEYLVEEEEEYIHEEEEFITEEEVVPVIPVKVPEVPRKPVPEEKKPVPVPKKKEAPPAKVPEVPKKPEEKVPVLIPKKEKPPPAKVPEVPKKPVPEEKVPVPVPKKVEAPPAKVPEVPKKPVPEKKVPVPAPKKVEAPPAKVPEVPKKLIPEEKKPTPVPKKVEAPPPKVPKKREPVPVPVALPQEEEVLFEEEIVPEEEVLPEEEEVLPEEEEVLPEEEEVLPEEEEIPPEEEEVPPEEEYVPEEEEFVPEEEVLPEVKPKVPVPAPVPEIKKKVTEKKVVIPKKEEAPPAKVPEVPKKVEEKRIILPKEEEVLPVEVTEEPEEEPISEEEIPEEPPSIEEVEEVAPPRVPEVIKKAVPEAPTPVPKKVEAPPAKVSKKIPEEKVPVPVQKKEAPPAKVPEVPKKVPEKKVLVPKKEAVPPAKGRTVLEEKVSVAFRQEVVVKERLELEVVEAEVEEIPEEEEFHEVEEYFEEGEFHEVEEFIKLEQHRVEEEHRVEKVHRVIEVFEAEEVEVFEKPKAPPKGPEISEKIIPPKKPPTKVVPRKEPPAKVPEVPKKIVVEEKVRVPEEPRVPPTKVPEVLPPKEVVPEKKVPVPPAKKPEAPPPKVPEAPKEVVPEKKVPVPPPKKPEVPPTKVPEVPKAAVPEKKVPEAIPPKPESPPPEVPEAPKEVVPEKKVPAAPPKKPEVTPVKVPEAPKEVVPEKKVPVPPPKKPEVPPTKVPEVPKVAVPEKKVPEAIPPKPESPPPEVFEEPEEVALEEPPAEVVEEPEPAAPPQVTVPPKKPVPEKKAPAVVAKKPELPPVKVPEVPKEVVPEKKVPLVVPKKPEAPPAKVPEVPKEVVPEKKVAVPKKPEVPPAKVPEVPKKPVLEEKPAVPVPERAESPPPEVYEEPEEIAPEEEIAPEEEKPVPVAEEEEPEVPPPAVPEEPKKIIPEKKVPVIKKPEAPPPKEPEPEKVIEKPKLKPRPPPPPPAPPKEDVKEKIFQLKAIPKKKVPEKPQVPEKVELTPLKVPGGEKKVRKLLPERKPEPKEEVVLKSVLRKRPEEEEPKVEPKKLEKVKKPAVPEPPPPKPVEEVEVPTVTKRERKIPEPTKVPEIKPAIPLPAPEPKPKPEAEVKTIKPPPVEPEPTPIAAPVTVPVVGKKAEAKAPKEEAAKPKGPIKGVPKKTPSPIEAERRKLRPGSGGEKPPDEAPFTYQLKAVPLKFVKEIKDIILTESEFVGSSAIFECLVSPSTAITTWMKDGSNIRESPKHRFIADGKDRKLHIIDVQLSDAGEYTCVLRLGNKEKTSTAKLVVEELPVRFVKTLEEEVTVVKGQPLYLSCELNKERDVVWRKDGKIVVEKPGRIVPGVIGLMRALTINDADDTDAGTYTVTVENANNLECSSCVKVVEVIRDWLVKPIRDQHVKPKGTAIFACDIAKDTPNIKWFKGYDEIPAEPNDKTEILRDGNHLYLKIKNAMPEDIAEYAVEIEGKRYPAKLTLGEREVELLKPIEDVTIYEKESASFDAEISEADIPGQWKLKGELLRPSPTCEIKAEGGKRFLTLHKVKLDQAGEVLYQALNAITTAILTVKEIELDFAVPLKDVTVPERRQARFECVLTREANVIWSKGPDIIKSSDKFDIIADGKKHILVINDSQFDDEGVYTAEVEGKKTSARLFVTGIRLKFMSPLEDQTVKEGETATFVCELSHEKMHVVWFKNDAKLHTSRTVLISSEGKTHKLEMKEVTLDDISQIKAQVKELSSTAQLKVLEADPYFTVKLHDKTAVEKDEITLKCEVSKDVPVKWFKDGEEIVPSPKYSIKADGLRRILKIKKADLKDKGEYVCDCGTDKTKANVTVEARLIKVEKPLYGVEVFVGETAHFEIELSEPDVHGQWKLKGQPLTASPDCEIIEDGKKHILILHNCQLGMTGEVSFQAANAKSAANLKVKELPLIFITPLSDVKVFEKDEAKFECEVSREPKTFRWLKGTQEITGDDRFELIKDGTKHSMVIKSAAFEDEAKYMFEAEDKHTSGKLIIEGIRLKFLTPLKDVTAKEKESAVFTVELSHDNIRVKWFKNDQRLHTTRSVSMQDEGKTHSITFKDLSIDDTSQIRVEAMGMSSEAKLTVLEGDPYFTGKLQDYTGVEKDEVILQCEISKADAPVKWFKDGKEIKPSKNAVIKADGKKRMLILKKALKSDIGQYTCDCGTDKTSGKLDIEDREIKLVRPLHSVEVMETETARFETEISEDDIHANWKLKGEALLQTPDCEIKEEGKIHSLVLHNCRLDQTGGVDFQAANVKSSAHLRVKPRVIGLLRPLKDVTVTAGETATFDCELSYEDIPVEWYLKGKKLEPSDKVVPRSEGKVHTLTLRDVKLEDAGEVQLTAKDFKTHANLFVKEPPVEFTKPLEDQTVEEGATAVLECEVSRENAKVKWFKNGTEILKSKKYEIVADGRVRKLVIHDCTPEDIKTYTCDAKDFKTSCNLNVVPPHVEFLRPLTDLQVREKEMARFECELSRENAKVKWFKDGAEIKKGKKYDIISKGAVRILVINKCLLDDEAEYSCEVRTARTSGMLTVLEEEAVFTKNLANIEVSETDTIKLVCEVSKPGAEVIWYKGDEEIIETGRYEILTEGRKRILVIQNAHLEDAGNYNCRLPSSRTDGKVKVHELAAEFISKPQNLEILEGEKAEFVCSISKESFPVQWKRDDKTLESGDKYDVIADGKKRVLVVKDATLQDMGTYVVMVGAARAAAHLTVIEKLRIVVPLKDTRVKEQQEVVFNCEVNTEGAKAKWFRNEEAIFDSSKYIILQKDLVYTLRIRDAHLDDQANYNVSLTNHRGENVKSAANLIVEEEDLRIVEPLKDIETMEKKSVTFWCKVNRLNVTLKWTKNGEEVPFDNRVSYRVDKYKHMLTIKDCGFPDEGEYIVTAGQDKSVAELLIIEAPTEFVEHLEDQTVTEFDDAVFSCQLSREKANVKWYRNGREIKEGKKYKFEKDGSIHRLIIKDCRLDDECEYACGVEDRKSRARLFVEEIPVEIIRPPQDILEAPGADVVFLAELNKDKVEVQWLRNNMVVVQGDKHQMMSEGKIHRLQICDIKPRDQGEYRFIAKDKEARAKLELAAAPKIKTADQDLVVDVGKPLTMVVPYDAYPKAEAEWFKENEPLSTKTIDTTAEQTSFRILEAKKGDKGRYKIVLQNKHGKAEGFINLKVIDVPGPVRNLEVTETFDGEVSLAWEEPLTDGGSKIIGYVVERRDIKRKTWVLATDRAESCEFTVTGLQKGGVEYLFRVSARNRVGTGEPVETDNPVEARSKYDVPGPPLNVTITDVNRFGVSLTWEPPEYDGGAEITNYVIELRDKTSIRWDTAMTVRAEDLSATVTDVVEGQEYSFRVRAQNRIGVGKPSAATPFVKVADPIERPSPPVNLTSSDQTQSSVQLKWEPPLKDGGSPILGYIIERCEEGKDNWIRCNMKLVPELTYKVTGLEKGNKYLYRVSAENKAGVSDPSEILGPLTADDAFVEPTMDLSAFKDGLEVIVPNPITILVPSTGYPRPTATWCFGDKVLETGDRVKMKTLSAYAELVISPSERSDKGIYTLKLENRVKTISGEIDVNVIARPSAPKELKFGDITKDSVHLTWEPPDDDGGSPLTGYVVEKREVSRKTWTKVMDFVTDLEFTVPDLVQGKEYLFKVCARNKCGPGEPAYVDEPVNMSTPATVPDPPENVKWRDRTANSIFLTWDPPKNDGGSRIKGYIVERCPRGSDKWVACGEPVAETKMEVTGLEEGKWYAYRVKALNRQGASKPSRPTEEIQAVDTQEAPEIFLDVKLLAGLTVKAGTKIELPATVTGKPEPKITWTKADMILKQDKRITIENVPKKSTVTIVDSKRSDTGTYIIEAVNVCGRATAVVEVNVLDKPGPPAAFDITDVTNESCLLTWNPPRDDGGSKITNYVVERRATDSEVWHKLSSTVKDTNFKATKLIPNKEYIFRVAAENMYGVGEPVQASPITAKYQFDPPGPPTRLEPSDITKDAVTLTWCEPDDDGGSPITGYWVERLDPDTDKWVRCNKMPVKDTTYRVKGLTNKKKYRFRVLAENLAGPGKPSKSTEPILIKDPIDPPWPPGKPTVKDVGKTSVRLNWTKPEHDGGAKIESYVIEMLKTGTDEWVRVAEGVPTTQHLLPGLMEGQEYSFRVRAVNKAGESEPSEPSDPVLCREKLYPPSPPRWLEVINITKNTADLKWTVPEKDGGSPITNYIVEKRDVRRKGWQTVDTTVKDTKCTVTPLTEGSLYVFRVAAENAIGQSDYTEIEDSVLAKDTFTTPGPPYALAVVDVTKRHVDLKWEPPKNDGGRPIQRYVIEKKERLGTRWVKAGKTAGPDCNFRVTDVIEGTEVQFQVRAENEAGVGHPSEPTEILSIEDPTSPPSPPLDLHVTDAGRKHIAIAWKPPEKNGGSPIIGYHVEMCPVGTEKWMRVNSRPIKDLKFKVEEGVVPDKEYVLRVRAVNAIGVSEPSEISENVVAKDPDCKPTIDLETHDIIVIEGEKLSIPVPFRAVPVPTVSWHKDGKEVKASDRLTMKNDHISAHLEVPKSVRADAGIYTITLENKLGSATASINVKVIGLPGPCKDIKASDITKSSCKLTWEPPEFDGGTPILHYVLERREAGRRTYIPVMSGENKLSWTVKDLIPNGEYFFRVKAVNKVGGGEYIELKNPVIAQDPKQPPDPPVDVEVHNPTAEAMTITWKPPLYDGGSKIMGYIIEKIAKGEERWKRCNEHLVPILTYTAKGLEEGKEYQFRVRAENAAGISEPSRATPPTKAVDPIDAPKVILRTSLEVKRGDEIALDASISGSPYPTITWIKDENVIVPEEIKKRAAPLVRRRKGEVQEEEPFVLPLTQRLSIDNSKKGESQLRVRDSLRPDHGLYMIKVENDHGIAKAPCTVSVLDTPGPPINFVFEDIRKTSVLCKWEPPLDDGGSEIINYTLEKKDKTKPDSEWIVVTSTLRHCKYSVTKLIEGKEYLFRVRAENRFGPGPPCVSKPLVAKDPFGPPDAPDKPIVEDVTSNSMLVKWNEPKDNGSPILGYWLEKREVNSTHWSRVNKSLLNALKANVDGLLEGLTYVFRVCAENAAGPGKFSPPSDPKTAHDPISPPGPPIPRVTDTSSTTIELEWEPPAFNGGGEIVGYFVDKQLVGTNEWSRCTEKMIKVRQYTVKEIREGADYKLRVSAVNAAGEGPPGETQPVTVAEPQEPPAVELDVSVKGGIQIMAGKTLRIPAVVTGRPVPTKVWTKEEGELDKDRVVIDNVGTKSELIIKDALRKDHGRYVITATNSCGSKFAAARVEVFDVPGPVLDLKPVVTNRKMCLLNWSDPEDDGGSEITGFIIERKDAKMHTWRQPIETERSKCDITGLLEGQEYKFRVIAKNKFGCGPPVEIGPILAVDPLGPPTSPERLTYTERTKSTITLDWKEPRSNGGSPIQGYIIEKRRHDKPDFERVNKRLCPTTSFLVENLDEHQMYEFRVKAVNEIGESEPSLPLNVVIQDDEVPPTIKLRLSVRGDTIKVKAGEPVHIPADVTGLPMPKIEWSKNETVIEKPTDALQITKEEVSRSEAKTELSIPKAVREDKGTYTVTASNRLGSVFRNVHVEVYDRPSPPRNLAVTDIKAESCYLTWDAPLDNGGSEITHYVIDKRDASRKKAEWEEVTNTAVEKRYGIWKLIPNGQYEFRVRAVNKYGISDECKSDKVVIQDPYRLPGPPGKPKVLARTKGSMLVSWTPPLDNGGSPITGYWLEKREEGSPYWSRVSRAPITKVGLKGVEFNVPRLLEGVKYQFRAMAINAAGIGPPSEPSDPEVAGDPIFPPGPPSCPEVKDKTKSSISLGWKPPAKDGGSPIKGYIVEMQEEGTTDWKRVNEPDKLITTCECVVPNLKELRKYRFRVKAVNEAGESEPSDTTGEIPATDIQEEPEVFIDIGAQDCLVCKAGSQIRIPAVIKGRPTPKSSWEFDGKAKKAMKDGVHDIPEDAQLETAENSSVIIIPECKRSHTGKYSITAKNKAGQKTANCRVKVMDVPGPPKDLKVSDITRGSCRLSWKMPDDDGGDRIKGYVIEKRTIDGKAWTKVNPDCGSTTFVVPDLLSEQQYFFRVRAENRFGIGPPVETIQRTTARDPIYPPDPPIKLKIGLITKNTVHLSWKPPKNDGGSPVTHYIVECLAWDPTGTKKEAWRQCNKRDVEELQFTVEDLVEGGEYEFRVKAVNAAGVSKPSATVGPVTVKDQTCPPSIDLKEFMEVEEGTNVNIVAKIKGVPFPTLTWFKAPPKKPDNKEPVLYDTHVNKLVVDDTCTLVIPQSRRSDTGLYTITAVNNLGTASKEMRLNVLGRPGPPVGPIKFESVSADQMTLSWFPPKDDGGSKITNYVIEKREANRKTWVHVSSEPKECTYTIPKLLEGHEYVFRIMAQNKYGIGEPLDSEPETARNLFSVPGAPDKPTVSSVTRNSMTVNWEEPEYDGGSPVTGYWLEMKDTTSKRWKRVNRDPIKAMTLGVSYKVTGLIEGSDYQFRVYAINAAGVGPASLPSDPATARDPIAPPGPPFPKVTDWTKSSADLEWSPPLKDGGSKVTGYIVEYKEEGKEEWEKGKDKEVRGTKLVVTGLKEGAFYKFRVRAVNIAGIGEPGEVTDVIEMKDRLVSPDLQLDASVRDRIVVHAGGVIRIIAYVSGKPPPTVTWNMNERTLPQEATIETTAISSSMVIKNCQRSHQGVYSLLAKNEAGERKKTIIVDVLDVPGPVGTPFLAHNLTNESCKLTWFSPEDDGGSPITNYVIEKRESDRRAWTPVTYTVTRQNATVQGLIQGKAYFFRIAAENSIGMGPFVETSEALVIREPITVPERPEDLEVKEVTKNTVTLTWNPPKYDGGSEIINYVLESRLIGTEKFHKVTNDNLLSRKYTVKGLKEGDTYEYRVSAVNIVGQGKPSFCTKPITCKDELAPPTLHLDFRDKLTIRVGEAFALTGRYSGKPKPKVSWFKDEADVLEDDRTHIKTTPATLALEKIKAKRSDSGKYCVVVENSTGSRKGFCQVNVVDRPGPPVGPVSFDEVTKDYMVISWKPPLDDGGSKITNYIIEKKEVGKDVWMPVTSASAKTTCKVSKLLEGKDYIFRIHAENLYGISDPLVSDSMKAKDRFRVPDAPDQPIVTEVTKDSALVTWNKPHDGGKPITNYILEKRETMSKRWARVTKDPIHPYTKFRVPDLLEGCQYEFRVSAENEIGIGDPSPPSKPVFAKDPIAKPSPPVNPEAIDTTCNSVDLTWQPPRHDGGSKILGYIVEYQKVGDEEWRRANHTPESCPETKYKVTGLRDGQTYKFRVLAVNAAGESDPAHVPEPVLVKDRLEPPELILDANMAREQHIKVGDTLRLSAIIKGVPFPKVTWKKEDRDAPTKARIDVTPVGSKLEIRNAAHEDGGIYSLTVENPAGSKTVSVKVLVLDKPGPPRDLEVSEIRKDSCYLTWKEPLDDGGSVITNYVVERRDVASAQWSPLSATSKKKSHFAKHLNEGNQYLFRVAAENQYGRGPFVETPKPIKALDPLHPPGPPKDLHHVDVDKTEVSLVWNKPDRDGGSPITGYLVEYQEEGTQDWIKFKTVTNLECVVTGLQQGKTYRFRVKAENIVGLGLPDTTIPIECQEKLVPPSVELDVKLIEGLVVKAGTTVRFPAIIRGVPVPTAKWTTDGSEIKTDEHYTVETDNFSSVLTIKNCLRRDTGEYQITVSNAAGSKTVAVHLTVLDVPGPPTGPINILDVTPEHMTISWQPPKDDGGSPVINYIVEKQDTRKDTWGVVSSGSSKTKLKIPHLQKGCEYVFRVRAENKIGVGPPLDSTPTVAKHKFSPPSPPGKPVVTDITENAATVSWTLPKSDGGSPITGYYMERREVTGKWVRVNKTPIADLKFRVTGLYEGNTYEFRVFAENLAGLSKPSPSSDPIKACRPIKPPGPPINPKLKDKSRETADLVWTKPLSDGGSPILGYVVECQKPGTAQWNRINKDELIRQCAFRVPGLIEGNEYRFRIKAANIVGEGEPRELAESVIAKDILHPPEVELDVTCRDVITVRVGQTIRILARVKGRPEPDITWTKEGKVLVREKRVDLIQDLPRVELQIKEAVRADHGKYIISAKNSSGHAQGSAIVNVLDRPGPCQNLKVTNVTKENCTISWENPLDNGGSEITNFIVEYRKPNQKGWSIVASDVTKRLIKANLLANNEYYFRVCAENKVGVGPTIETKTPILAINPIDRPGEPENLHIADKGKTFVYLKWRRPDYDGGSPNLSYHVERRLKGSDDWERVHKGSIKETHYMVDRCVENQIYEFRVQTKNEGGESDWVKTEEVVVKEDLQKPVLDLKLSGVLTVKAGDTIRLEAGVRGKPFPEVAWTKDKDATDLTRSPRVKIDTRADSSKFSLTKAKRSDGGKYVVTATNTAGSFVAYATVNVLDKPGPVRNLKIVDVSSDRCTVCWDPPEDDGGCEIQNYILEKCETKRMVWSTYSATVLTPGTTVTRLIEGNEYIFRVRAENKIGTGPPTESKPVIAKTKYDKPGRPDPPEVTKVSKEEMTVVWNPPEYDGGKSITGYFLEKKEKHSTRWVPVNKSAIPERRMKVQNLLPDHEYQFRVKAENEIGIGEPSLPSRPVVAKDPIEPPGPPTNFRVVDTTKHSITLGWGKPVYDGGAPIIGYVVEMRPKIADASPDEGWKRCNAAAQLVRKEFTVTSLDENQEYEFRVCAQNQVGIGRPAELKEAIKPKEILEPPEIDLDASMRKLVIVRAGCPIRLFAIVRGRPAPKVTWRKVGIDNVVRKGQVDLVDTMAFLVIPNSTRDDSGKYSLTLVNPAGEKAVFVNVRVLDTPGPVSDLKVSDVTKTSCHVSWAPPENDGGSQVTHYIVEKREADRKTWSTVTPEVKKTSFHVTNLVPGNEYYFRVTAVNEYGPGVPTDVPKPVLASDPLSEPDPPRKLEVTEMTKNSATLAWLPPLRDGGAKIDGYITSYREEEQPADRWTEYSVVKDLSLVVTGLKEGKKYKFRVAARNAVGVSLPREAEGVYEAKEQLLPPKILMPEQITIKAGKKLRIEAHVYGKPHPTCKWKKGEDEVVTSSHLAVHKADSSSILIIKDVTRKDSGYYSLTAENSSGTDTQKIKVVVMDAPGPPQPPFDISDIDADACSLSWHIPLEDGGSNITNYIVEKCDVSRGDWVTALASVTKTSCRVGKLIPGQEYIFRVRAENRFGISEPLTSPKMVAQFPFGVPSEPKNARVTKVNKDCIFVAWDRPDSDGGSPIIGYLIERKERNSLLWVKANDTLVRSTEYPCAGLVEGLEYSFRIYALNKAGSSPPSKPTEYVTARMPVDPPGKPEVIDVTKSTVSLIWARPKHDGGSKIIGYFVEACKLPGDKWVRCNTAPHQIPQEEYTATGLEEKAQYQFRAIARTAVNISPPSEPSDPVTILAENVPPRIDLSVAMKSLLTVKAGTNVCLDATVFGKPMPTVSWKKDGTLLKPAEGIKMAMQRNLCTLELFSVNRKDSGDYTITAENSSGSKSATIKLKVLDKPGPPASVKINKMYSDRAMLSWEPPLEDGGSEITNYIVDKRETSRPNWAQVSATVPITSCSVEKLIEGHEYQFRICAENKYGVGDPVFTEPAIAKNPYDPPGRCDPPVISNITKDHMTVSWKPPADDGGSPITGYLLEKRETQAVNWTKVNRKPIIERTLKATGLQEGTEYEFRVTAINKAGPGKPSDASKAAYARDPQYPPGPPAFPKVYDTTRSSVSLSWGKPAYDGGSPIIGYLVEVKRADSDNWVRCNLPQNLQKTRFEVTGLMEDTQYQFRVYAVNKIGYSDPSDVPDKHYPKDILIPPEGELDADLRKTLILRAGVTMRLYVPVKGRPPPKITWSKPNVNLRDRIGLDIKSTDFDTFLRCENVNKYDAGKYILTLENSCGKKEYTIVVKVLDTPGPPVNVTVKEISKDSAYVTWEPPIIDGGSPIINYVVQKRDAERKSWSTVTTECSKTSFRVANLEEGKSYFFRVFAENEYGIGDPGETRDAVKASQTPGPVVDLKVRSVSKSSCSIGWKKPHSDGGSRIIGYVVDFLTEENKWQRVMKSLSLQYSAKDLTEGKEYTFRVSAENENGEGTPSEITVVARDDVVAPDLDLKGLPDLCYLAKENSNFRLKIPIKGKPAPSVSWKKGEDPLATDTRVSVESSAVNTTLIVYDCQKSDAGKYTITLKNVAGTKEGTISIKVVGKPGIPTGPIKFDEVTAEAMTLKWAPPKDDGGSEITNYILEKRDSVNNKWVTCASAVQKTTFRVTRLHEGMEYTFRVSAENKYGVGEGLKSEPIVARHPFDVPDAPPPPNIVDVRHDSVSLTWTDPKKTGGSPITGYHLEFKERNSLLWKRANKTPIRMRDFKVTGLTEGLEYEFRVMAINLAGVGKPSLPSEPVVALDPIDPPGKPEVINITRNSVTLIWTEPKYDGGHKLTGYIVEKRDLPSKSWMKANHVNVPECAFTVTDLVEGGKYEFRIRAKNTAGAISAPSESTETIICKDEYEAPTIVLDPTIKDGLTIKAGDTIVLNAISILGKPLPKSSWSKAGKDIRPSDITQITSTPTSSMLTIKYATRKDAGEYTITATNPFGTKVEHVKVTVLDVPGPPGPVEISNVSAEKATLTWTPPLEDGGSPIKSYILEKRETSRLLWTVVSEDIQSCRHVATKLIQGNEYIFRVSAVNHYGKGEPVQSEPVKMVDRFGPPGPPEKPEVSNVTKNTATVSWKRPVDDGGSEITGYHVERREKKSLRWVRAIKTPVSDLRCKVTGLQEGSTYEFRVSAENRAGIGPPSEASDSVLMKDAAYPPGPPSNPHVTDTTKKSASLAWGKPHYDGGLEITGYVVEHQKVGDEAWIKDTTGTALRITQFVVPDLQTKEKYNFRISAINDAGVGEPAVIPDVEIVEREMAPDFELDAELRRTLVVRAGLSIRIFVPIKGRPAPEVTWTKDNINLKNRANIENTESFTLLIIPECNRYDTGKFVMTIENPAGKKSGFVNVRVLDTPGPVLNLRPTDITKDSVTLHWDLPLIDGGSRITNYIVEKREATRKSYSTATTKCHKCTYKVTGLSEGCEYFFRVMAENEYGIGEPTETTEPVKASEAPSPPDSLNIMDITKSTVSLAWPKPKHDGGSKITGYVIEAQRKGSDQWTHITTVKGLECVVRNLTEGEEYTFQVMAVNSAGRSAPRESRPVIVKEQTMLPELDLRGIYQKLVIAKAGDNIKVEIPVLGRPKPTVTWKKGDQILKQTQRVNFETTATSTILNINECVRSDSGPYPLTARNIVGEVGDVITIQVHDIPGPPTGPIKFDEVSSDFVTFSWDPPENDGGVPISNYVVEMRQTDSTTWVELATTVIRTTYKATRLTTGLEYQFRVKAQNRYGVGPGITSACIVANYPFKVPGPPGTPQVTAVTKDSMTISWHEPLSDGGSPILGYHVERKERNGILWQTVSKALVPGNIFKSSGLTDGIAYEFRVIAENMAGKSKPSKPSEPMLALDPIDPPGKPVPLNITRHTVTLKWAKPEYTGGFKITSYIVEKRDLPNGRWLKANFSNILENEFTVSGLTEDAAYEFRVIAKNAAGAISPPSEPSDAITCRDDVEAPKIKVDVKFKDTVILKAGEAFRLEADVSGRPPPTMEWSKDGKELEGTAKLEIKIADFSTNLVNKDSTRRDSGAYTLTATNPGGFAKHIFNVKVLDRPGPPEGPLAVTEVTSEKCVLSWFPPLDDGGAKIDHYIVQKRETSRLAWTNVASEVQVTKLKVTKLLKGNEYIFRVMAVNKYGVGEPLESEPVLAVNPYGPPDPPKNPEVTTITKDSMVVCWGHPDSDGGSEIINYIVERRDKAGQRWIKCNKKTLTDLRYKVSGLTEGHEYEFRIMAENAAGISAPSPTSPFYKACDTVFKPGPPGNPRVLDTSRSSISIAWNKPIYDGGSEITGYMVEIALPEEDEWQIVTPPAGLKATSYTITGLTENQEYKIRIYAMNSEGLGEPALVPGTPKAEDRMLPPEIELDADLRKVVTIRACCTLRLFVPIKGRPAPEVKWARDHGESLDKASIESTSSYTLLIVGNVNRFDSGKYILTVENSSGSKSAFVNVRVLDTPGPPQDLKVKEVTKTSVTLTWDPPLLDGGSKIKNYIVEKRESTRKAYSTVATNCHKTSWKVDQLQEGCSYYFRVLAENEYGIGLPAETAESVKASERPLPPGKITLMDVTRNSVSLSWEKPEHDGGSRILGYIVEMQTKGSDKWATCATVKVTEATITGLIQGEEYSFRVSAQNEKGISDPRQLSVPVIAKDLVIPPAFKLLFNTFTVLAGEDLKVDVPFIGRPTPAVTWHKDNVPLKQTTRVNAESTENNSLLTIKDACREDVGHYVVKLTNSAGEAIETLNVIVLDKPGPPTGPVKMDEVTADSITLSWGPPKYDGGSSINNYIVEKRDTSTTTWQIVSATVARTTIKACRLKTGCEYQFRIAAENRYGKSTYLNSEPTVAQYPFKVPGPPGTPVVTLSSRDSMEVQWNEPISDGGSRVIGYHLERKERNSILWVKLNKTPIPQTKFKTTGLEEGVEYEFRVSAENIVGIGKPSKVSECYVARDPCDPPGRPEAIIVTRNSVTLQWKKPTYDGGSKITGYIVEKKELPEGRWMKASFTNIIDTHFEVTGLVEDHRYEFRVIARNAAGVFSEPSESTGAITARDEVDPPRISMDPKYKDTIVVHAGESFKVDADIYGKPIPTIQWIKGDQELSNTARLEIKSTDFATSLSVKDAVRVDSGNYILKAKNVAGERSVTVNVKVLDRPGPPEGPVVISGVTAEKCTLAWKPPLQDGGSDIINYIVERRETSRLVWTVVDANVQTLSCKVTKLLEGNEYTFRIMAVNKYGVGEPLESEPVVAKNPFVVPDAPKAPEVTTVTKDSMIVVWERPASDGGSEILGYVLEKRDKEGIRWTRCHKRLIGELRLRVTGLIENHDYEFRVSAENAAGLSEPSPPSAYQKACDPIYKPGPPNNPKVIDITRSSVFLSWSKPIYDGGCEIQGYIVEKCDVSVGEWTMCTPPTGINKTNIEVEKLLEKHEYNFRICAINKAGVGEHADVPGPIIVEEKLEAPDIDLDLELRKIINIRAGGSLRLFVPIKGRPTPEVKWGKVDGEIRDAAIIDVTSSFTSLVLDNVNRYDSGKYTLTLENSSGTKSAFVTVRVLDTPSPPVNLKVTEITKDSVSITWEPPLLDGGSKIKNYIVEKREATRKSYAAVVTNCHKNSWKIDQLQEGCSYYFRVTAENEYGIGLPAQTADPIKVAEVPQPPGKITVDDVTRNSVSLSWTKPEHDGGSKIIQYIVEMQAKHSEKWSECARVKSLQAVITNLTQGEEYLFRVVAVNEKGRSDPRSLAVPIVAKDLVIEPDVKPAFSSYSVQVGQDLKIEVPISGRPKPTITWTKDGLPLKQTTRINVTDSLDLTTLSIKETHKDDGGQYGITVANVVGQKTASIEIVTLDKPDPPKGPVKFDDVSAESITLSWNPPLYTGGCQITNYIVQKRDTTTTVWDVVSATVARTTLKVTKLKTGTEYQFRIFAENRYGQSFALESDPIVAQYPYKEPGPPGTPFATAISKDSMVIQWHEPVNNGGSPVIGYHLERKERNSILWTKVNKTIIHDTQFKAQNLEEGIEYEFRVYAENIVGVGKASKNSECYVARDPCDPPGTPEPIMVKRNEITLQWTKPVYDGGSMITGYIVEKRDLPDGRWMKASFTNVIETQFTVSGLTEDQRYEFRVIAKNAAGAISKPSDSTGPITAKDEVELPRISMDPKFRDTIVVNAGETFRLEADVHGKPLPTIEWLRGDKEIEESARCEIKNTDFKALLIVKDAIRIDGGQYILRASNVAGSKSFPVNVKVLDRPGPPEGPVQVTGVTSEKCSLTWSPPLQDGGSDISHYVVEKRETSRLAWTVVASEVVTNSLKVTKLLEGNEYVFRIMAVNKYGVGEPLESAPVLMKNPFVLPGPPKSLEVTNIAKDSMTVCWNRPDSDGGSEIIGYIVEKRDRSGIRWIKCNKRRITDLRLRVTGLTEDHEYEFRVSAENAAGVGEPSPATVYYKACDPVFKPGPPTNAHIVDTTKNSITLAWGKPIYDGGSEILGYVVEICKADEEEWQIVTPQTGLRVTRFEISKLTEHQEYKIRVCALNKVGLGEATSVPGTVKPEDKLEAPELDLDSELRKGIVVRAGGSARIHIPFKGRPTPEITWSREEGEFTDKVQIEKGVNYTQLSIDNCDRNDAGKYILKLENSSGSKSAFVTVKVLDTPGPPQNLAVKEVRKDSAFLVWEPPIIDGGAKVKNYVIDKRESTRKAYANVSSKCSKTSFKVENLTEGAIYYFRVMAENEFGVGVPVETVDAVKAAEPPSPPGKVTLTDVSQTSASLMWEKPEHDGGSRVLGYVVEMQPKGTEKWSIVAESKVCNAVVTGLSSGQEYQFRVKAYNEKGKSDPRVLGVPVIAKDLTIQPSLKLPFNTYSIQAGEDLKIEIPVIGRPRPNISWVKDGEPLKQTTRVNVEETATSTVLHIKEGNKDDFGKYTVTATNSAGTATENLSVIVLEKPGPPVGPVRFDEVSADFVVISWEPPAYTGGCQISNYIVEKRDTTTTTWHMVSATVARTTIKITKLKTGTEYQFRIFAENRYGKSAPLDSKAVIVQYPFKEPGPPGTPFVTSISKDQMLVQWHEPVNDGGTKIIGYHLEQKEKNSILWVKLNKTPIQDTKFKTTGLDEGLEYEFKVSAENIVGIGKPSKVSECFVARDPCDPPGRPEAIVITRNNVTLKWKKPAYDGGSKITGYIVEKKDLPDGRWMKASFTNVLETEFTVSGLVEDQRYEFRVIARNAAGNFSEPSDSSGAITARDEIDAPNASLDPKYKDVIVVHAGETFVLEADIRGKPIPDVVWSKDGKELEETAARMEIKSTIQKTTLVVKDCIRTDGGQYILKLSNVGGTKSIPITVKVLDRPGPPEGPLKVTGVTAEKCYLAWNPPLQDGGANISHYIIEKRETSRLSWTQVSTEVQALNYKVTKLLPGNEYIFRVMAVNKYGIGEPLESGPVTACNPYKPPGPPSTPEVSAITKDSMVVTWARPVDDGGTEIEGYILEKRDKEGVRWTKCNKKTLTDLRLRVTGLTEGHSYEFRVAAENAAGVGEPSEPSVFYRACDALYPPGPPSNPKVTDTSRSSVSLAWSKPIYDGGAPVKGYVVEVKEAAADEWTTCTPPTGLQGKQFTVTKLKENTEYNFRICAINSEGVGEPATLPGSVVAQERIEPPEIELDADLRKVVVLRASATLRLFVTIKGRPEPEVKWEKAEGILTDRAQIEVTSSFTMLVIDNVTRFDSGRYNLTLENNSGSKTAFVNVRVLDSPSAPVNLTIREVKKDSVTLSWEPPLIDGGAKITNYIVEKRETTRKAYATITNNCTKTTFRIENLQEGCSYYFRVLASNEYGIGLPAETTEPVKVSEPPLPPGRVTLVDVTRNTATIKWEKPESDGGSKITGYVVEMQTKGSEKWSTCTQVKTLEATISGLTAGEEYVFRVAAVNEKGRSDPRQLGVPVIARDIEIKPSVELPFHTFNVKAREQLKIDVPFKGRPQATVNWRKDGQTLKETTRVNVSSSKTVTSLSIKEASKEDVGTYELCVSNSAGSITVPITIIVLDRPGPPGPIRIDEVSCDSITISWNPPEYDGGCQISNYIVEKKETTSTTWHIVSQAVARTSIKIVRLTTGSEYQFRVCAENRYGKSSYSESSAVVAEYPFSPPGPPGTPKVVHATKSTMLVTWQVPVNDGGSRVIGYHLEYKERSSILWSKANKILIADTQMKVSGLDEGLMYEYRVYAENIAGIGKCSKSCEPVPARDPCDPPGQPEVTNITRKSVSLKWSKPHYDGGAKITGYIVERRELPDGRWLKCNYTNIQETYFEVTELTEDQRYEFRVFARNAADSVSEPSESTGPIIVKDDVEPPRVMMDVKFRDVIVVKAGEVLKINADIAGRPLPVISWAKDGIEIEERARTEIISTDNHTLLTVKDCIRRDTGQYVLTLKNVAGTRSVAVNCKVLDKPGPPAGPLEINGLTAEKCSLSWGRPQEDGGADIDYYIVEKRETSHLAWTICEGELQMTSCKVTKLLKGNEYIFRVTGVNKYGVGEPLESVAIKALDPFTVPSPPTSLEITSVTKESMTLCWSRPESDGGSEISGYIIERREKNSLRWVRVNKKPVYDLRVKSTGLREGCEYEYRVYAENAAGLSLPSETSPLIRAEDPVFLPSPPSKPKIVDSGKTTITIAWVKPLFDGGAPITGYTVEYKKSDDTDWKTSIQSLRGTEYTISGLTTGAEYVFRVKSVNKVGASDPSDSSDPQIAKEREEEPLFDIDSEMRKTLIVKAGASFTMTVPFRGRPVPNVLWSKPDTDLRTRAYVDTTDSRTSLTIENANRNDSGKYTLTIQNVLSAASLTLVVKVLDTPGPPTNITVQDVTKESAVLSWDVPENDGGAPVKNYHIEKREASKKAWVSVTNNCNRLSYKVTNLQEGAIYYFRVSGENEFGVGIPAETKEGVKITEKPSPPEKLGVTSISKDSVSLTWLKPEHDGGSRIVHYVVEALEKGQKNWVKCAVAKSTHHVVSGLRENSEYFFRVFAENQAGLSDPRELLLPVLIKEQLEPPEIDMKNFPSHTVYVRAGSNLKVDIPISGKPLPKVTLSRDGVPLKATMRFNTEITAENLTINLKESVTADAGRYEITAANSSGTTKAFINIVVLDRPGPPTGPVVISDITEESVTLKWEPPKYDGGSQVTNYILLKRETSTAVWTEVSATVARTMMKVMKLTTGEEYQFRIKAENRFGISDHIDSACVTVKLPYTTPGPPSTPWVTNVTRESITVGWHEPVSNGGSAVVGYHLEMKDRNSILWQKANKLVIRTTHFKVTTISAGLIYEFRVYAENAAGVGKPSHPSEPVLAIDACEPPRNVRITDISKNSVSLSWQQPAFDGGSKITGYIVERRDLPDGRWTKASFTNVTETQFIISGLTQNSQYEFRVFARNAVGSISNPSEVVGPITCIDSYGGPVIDLPLEYTEVVKYRAGTSVKLRAGISGKPAPTIEWYKDDKELQTNALVCVENTTDLASILIKDADRLNSGCYELKLRNAMGSASATIRVQILDKPGPPGGPIEFKTVTAEKITLLWRPPADDGGAKITHYIVEKRETSRVVWSMVSEHLEECIITTTKIIKGNEYIFRVRAVNKYGIGEPLESDSVVAKNAFVTPGPPGIPEVTKITKNSMTVVWSRPIADGGSDISGYFLEKRDKKSLGWFKVLKETIRDTRQKVTGLTENSDYQYRVCAVNAAGQGPFSEPSEFYKAADPIDPPGPPAKIRIADSTKSSITLGWSKPVYDGGSAVTGYVVEIRQGEEEEWTTVSTKGEVRTTEYVVSNLKPGVNYYFRVSAVNCAGQGEPIEMNEPVQAKDILEAPEIDLDVALRTSVIAKAGEDVQVLIPFKGRPPPTVTWRKDEKNLGSDARYSIENTDSSSLLTIPQVTRNDTGKYILTIENGVGEPKSSTVSVKVLDTPAACQKLQVKHVSRGTVTLLWDPPLIDGGSPIINYVIEKRDATKRTWSVVSHKCSSTSFKLIDLSEKTPFFFRVLAENEIGIGEPCETTEPVKAAEVPAPIRDLSMKDSTKTSVILSWTKPDFDGGSVITEYVVERKGKGEQTWSHAGISKTCEIEVSQLKEQSVLEFRVFAKNEKGLSDPVTIGPITVKELIITPEVDLSDIPGAQVTVRIGHNVHLELPYKGKPKPSISWLKDGLPLKESEFVRFSKTENKITLSIKNAKKEHGGKYTVILDNAVCRIAVPITVITLGPPSKPKGPIRFDEIKADSVILSWDVPEDNGGGEITCYSIEKRETSQTNWKMVCSSVARTTFKVPNLVKDAEYQFRVRAENRYGVSQPLVSSIIVAKHQFRIPGPPGKPVIYNVTSDGMSLTWDAPVYDGGSEVTGFHVEKKERNSILWQKVNTSPISGREYRATGLVEGLDYQFRVYAENSAGLSSPSDPSKFTLAVSPVDPPGTPDYIDVTRETITLKWNPPLRDGGSKIVGYSIEKRQGNERWVRCNFTDVSECQYTVTGLSPGDRYEFRIIARNAVGTISPPSQSSGIIMTRDENVPPIVEFGPEYFDGLIIKSGESLRIKALVQGRPVPRVTWFKDGVEIEKRMNMEITDVLGSTSLFVRDATRDHRGVYTVEAKNASGSAKAEIKVKVQDTPGKVVGPIRFTNITGEKMTLWWDAPLNDGCAPITHYIIEKRETSRLAWALIEDKCEAQSYTAIKLINGNEYQFRVSAVNKFGVGRPLDSDPVVAQIQYTVPDAPGIPEPSNITGNSITLTWARPESDGGSEIQQYILERREKKSTRWVKVISKRPISETRFKVTGLTEGNEYEFHVMAENAAGVGPASGISRLIKCREPVNPPGPPTVVKVTDTSKTTVSLEWSKPVFDGGMEIIGYIIEMCKADLGDWHKVNAEACVKTRYTVTDLQAGEEYKFRVSAINGAGKGDSCEVTGTIKAVDRLTAPELDIDANFKQTHVVRAGASIRLFIAYQGRPTPTAVWSKPDSNLSLRADIHTTDSFSTLTVENCNRNDAGKYTLTVENNSGSKSITFTVKVLDTPGPPGPITFKDVTRGSATLMWDAPLLDGGARIHHYVVEKREASRRSWQVISEKCTRQIFKVNDLAEGVPYYFRVSAVNEYGVGEPYEMPEPIVATEQPAPPRRLDVVDTSKSSAVLAWLKPDHDGGSRITGYLLEMRQKGSDFWVEAGHTKQLTFTVERLVEKTEYEFRVKAKNDAGYSEPREAFSSVIIKEPQIEPTADLTGITNQLITCKAGSPFTIDVPISGRPAPKVTWKLEEMRLKETDRVSITTTKDRTTLTVKDSMRGDSGRYFLTLENTAGVKTFSVTVVVIGRPGPVTGPIEVSSVSAESCVLSWGEPKDGGGTEITNYIVEKRESGTTAWQLVNSSVKRTQIKVTHLTKYMEYSFRVSSENRFGVSKPLESAPIIAEHPFVPPSAPTRPEVYHVSANAMSIRWEEPYHDGGSKIIGYWVEKKERNTILWVKENKVPCLECNYKVTGLVEGLEYQFRTYALNAAGVSKASEASRPIMAQNPVDAPGRPEVTDVTRSTVSLIWSAPAYDGGSKVVGYIIERKPVSEVGDGRWLKCNYTIVSDNFFTVTALSEGDTYEFRVLAKNAAGVISKGSESTGPVTCRDEYAPPKAELDARLHGDLVTIRAGSDLVLDAAVGGKPEPKIIWTKGDKELDLCEKVSLQYTGKRATAVIKFCDRSDSGKYTLTVKNASGTKAVSVMVKVLDSPGPCGKLTVSRVTQEKCTLAWSLPQEDGGAEITHYIVERRETSRLNWVIVEGECPTLSYVVTRLIKNNEYIFRVRAVNKYGPGVPVESEPIVARNSFTIPSPPGIPEEVGTGKEHIIIQWTKPESDGGNEISNYLVDKREKKSLRWTRVNKDYVVYDTRLKVTSLMEGCDYQFRVTAVNAAGNSEPSEASNFISCREPSYTPGPPSAPRVVDTTKHSISLAWTKPMYDGGTDIVGYVLEMQEKDTDQWYRVHTNATIRNTEFTVPDLKMGQKYSFRVAAVNVKGMSEYSESIAEIEPVERIEIPDLELADDLKKTVTIRAGASLRLMVSVSGRPPPVITWSKQGIDLASRAIIDTTESYSLLIVDKVNRYDAGKYTIEAENQSGKKSATVLVKVYDTPGPCPSVKVKEVSRDSVTITWEIPTIDGGAPVNNYIVEKREAAMRAFKTVTTKCSKTLYRISGLVEGTMYYFRVLPENIYGIGEPCETSDAVLVSEVPLVPAKLEVVDVTKSTVTLAWEKPLYDGGSRLTGYVLEACKAGTERWMKVVTLKPTVLEHTVTSLNEGEQYLFRIRAQNEKGVSEPRETVTAVTVQDLRVLPTIDLSTMPQKTIHVPAGRPVELVIPIAGRPPPAASWFFAGSKLRESERVTVETHTKVAKLTIRETTIRDTGEYTLELKNVTGTTSETIKVIILDKPGPPTGPIKIDEIDATSITISWEPPELDGGAPLSGYVVEQRDAHRPGWLPVSESVTRSTFKFTRLTEGNEYVFRVAATNRFGIGSYLQSEVIECRSSIRIPGPPETLQIFDVSRDGMTLTWYPPEDDGGSQVTGYIVERKEVRADRWVRVNKVPVTMTRYRSTGLTEGLEYEHRVTAINARGSGKPSRPSKPIVAMDPIAPPGKPQNPRVTDTTRTSVSLAWSVPEDEGGSKVTGYLIEMQKVDQHEWTKCNTTPTKIREYTLTHLPQGAEYRFRVLACNAGGPGEPAEVPGTVKVTEMLEYPDYELDERYQEGIFVRQGGVIRLTIPIKGKPFPICKWTKEGQDISKRAMIATSETHTELVIKEADRGDSGTYDLVLENKCGKKAVYIKVRVIGSPNSPEGPLEYDDIQVRSVRVSWRPPADDGGADILGYILERREVPKAAWYTIDSRVRGTSLVVKGLKENVEYHFRVSAENQFGISKPLKSEEPVTPKTPLNPPEPPSNPPEVLDVTKSSVSLSWSRPKDDGGSRVTGYYIERKETSTDKWVRHNKTQITTTMYTVTGLVPDAEYQFRIIAQNDVGLSETSPASEPVVCKDPFDKPSQPGELEILSISKDSVTLQWEKPECDGGKEILGYWVEYRQSGDSAWKKSNKERIKDKQFTIGGLLEATEYEFRVFAENETGLSRPRRTAMSIKTKLTSGEAPGIRKEMKDVTTKLGEAAQLSCQIVGRPLPDIKWYRFGKELIQSRKYKMSSDGRTHTLTVMTEEQEDEGVYTCIATNEVGEVETSSKLLLQATPQFHPGYPLKEKYYGAVGSTLRLHVMYIGRPVPAMTWFHGQKLLQNSENITIENTEHYTHLVMKNVQRKTHAGKYKVQLSNVFGTVDAILDVEIQDKPDKPTGPIVIEALLKNSAVISWKPPADDGGSWITNYVVEKCEAKEGAEWQLVSSAISVTTCRIVNLTENAGYYFRVSAQNTFGISDPLEVSSVVIIKSPFEKPGAPGKPTITAVTKDSCVVAWKPPASDGGAKIRNYYLEKREKKQNKWISVTTEEIRETVFSVKNLIEGLEYEFRVKCENLGGESEWSEISEPITPKSDVPIQAPHFKEELRNLNVRYQSNATLVCKVTGHPKPIVKWYRQGKEIIADGLKYRIQEFKGGYHQLIIASVTDDDATVYQVRATNQGGSVSGTASLEVEVPAKIHLPKTLEGMGAVHALRGEVVSIKIPFSGKPDPVITWQKGQDLIDNNGHYQVIVTRSFTSLVFPNGVERKDAGFYVVCAKNRFGIDQKTVELDVADVPDPPRGVKVSDVSRDSVNLTWTEPASDGGSKITNYIVEKCATTAERWLRVGQARETRYTVINLFGKTSYQFRVIAENKFGLSKPSEPSEPTITKEDKTRAMNYDEEVDETREVSMTKASHSSTKELYEKYMIAEDLGRGEFGIVHRCVETSSKKTYMAKFVKVKGTDQVLVKKEISILNIARHRNILHLHESFESMEELVMIFEFISGLDIFERINTSAFELNEREIVSYVHQVCEALQFLHSHNIGHFDIRPENIIYQTRRSSTIKIIEFGQARQLKPGDNFRLLFTAPEYYAPEVHQHDVVSTATDMWSLGTLVYVLLSGINPFLAETNQQIIENIMNAEYTFDEEAFKEISIEAMDFVDRLLVKERKSRMTASEALQHPWLKQKIERVSTKVIRTLKHRRYYHTLIKKDLNMVVSAARISCGGAIRSQKGVSVAKVKVASIEIGPVSGQIMHAVGEEGGHVKYVCKIENYDQSTQVTWYFGVRQLENSEKYEITYEDGVAILYVKDITKLDDGTYRCKVVNDYGEDSSYAELFVKGVREVYDYYCRRTMKKIKRRTDTMRLLERPPEFTLPLYNKTAYVGENVRFGVTITVHPEPHVTWYKSGQKIKPGDNDKKYTFESDKGLYQLTINSVTTDDDAEYTVVARNKYGEDSCKAKLTVTLHPPPTDSTLRPMFKRLLANAECQEGQSVCFEIRVSGIPPPTLKWEKDGQPLSLGPNIEIIHEGLDYYALHIRDTLPEDTGYYRVTATNTAGSTSCQAHLQVERLRYKKQEFKSKEEHERHVQKQIDKTLRMAEILSGTESVPLTQVAKEALREAAVLYKPAVSTKTVKGEFRLEIEEKKEERKLRMPYDVPEPRKYKQTTIEEDQRIKQFVPMSDMKWYKKIRDQYEMPGKLDRVVQKRPKRIRLSRWEQFYVMPLPRITDQYRPKWRIPKLSQDDLEIVRPARRRTPSPDYDFYYRPRRRSLGDISDEELLLPIDDYLAMKRTEEERLRLEEELELGFSASPPSRSPPHFELSSLRYSSPQAHVKVEETRKDFRYSTYHIPTKAEASTSYAELRERHAQAAYRQPKQRQRIMAEREDEELLRPVTTTQHLSEYKSELDFMSKEEKSRKKSRRQREVTEITEIEEEYEISKHAQRESSSSASRLLRRRRSLSPTYIELMRPVSELIRSRPQPAEEYEDDTERRSPTPERTRPRSPSPVSSERSLSRFERSARFDIFSRYESMKAALKTQKTSERKYEVLSQQPFTLDHAPRITLRMRSHRVPCGQNTRFILNVQSKPTAEVKWYHNGVELQESSKIHYTNTSGVLTLEILDCHTDDSGTYRAVCTNYKGEASDYATLDVTGGDYTTYASQRRDEEVPRSVFPELTRTEAYAVSSFKKTSEMEASSSVREVKSQMTETRESLSSYEHSASAEMKSAALEEKSLEEKSTTRKIKTTLAARILTKPRSMTVYEGESARFSCDTDGEPVPTVTWLRKGQVLSTSARHQVTTTKYKSTFEISSVQASDEGNYSVVVENSEGKQEAEFTLTIQKARVTEKAVTSPPRVKSPEPRVKSPEAVKSPKRVKSPEPSHPKAVSPTETKPTPTEKVQHLPVSAPPKITQFLKAEASKEIAKLTCVVESSVLRAKEVTWYKDGKKLKENGHFQFHYSADGTYELKINNLTESDQGEYVCEISGEGGTSKTNLQFMGQAFKSIHEKVSKISETKKSDQKTTESTVTRKTEPKAPEPISSKPVIVTGLQDTTVSSDSVAKFAVKATGEPRPTAIWTKDGKAITQGGKYKLSEDKGGFFLEIHKTDTSDSGLYTCTVKNSAGSVSSSCKLTIKAIKDTEAQKVSTQKTSEITPQKKAVVQEEISQKALRSEEIKMSEAKSQEKLALKEEASKVLISEEVKKSAATSLEKSIVHEEITKTSQASEEVRTHAEIKAFSTQMSINEGQRLVLKANIAGATDVKWVLNGVELTNSEEYRYGVSGSDQTLTIKQASHRDEGILTCISKTKEGIVKCQYDLTLSKELSDAPAFISQPRSQNINEGQNVLFTCEISGEPSPEIEWFKNNLPISISSNVSISRSRNVYSLEIRNASVSDSGKYTIKAKNFRGQCSATASLMVLPLVEEPSREVVLRTSGDTSLQGSFSSQSVQMSASKQEASFSSFSSSSASSMTEMKFASMSAQSMSSMQESFVEMSSSSFMGISNMTQLESSTSKMLKAGIRGIPPKIEALPSDISIDEGKVLTVACAFTGEPTPEVTWSCGGRKIHSQEQGRFHIENTDDLTTLIIMDVQKQDGGLYTLSLGNEFGSDSATVNIHIRSI
"
     misc_feature    241..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    262..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    535..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    556..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    1753..1872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    1879..2004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2017..2142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2155..2280
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    3052..3321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3103..3306
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3469..3738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3520..3735
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4102..4368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4147..4353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4594..4866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4660..4854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4891..5166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4912..5166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <5389..5607
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    5746..6012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    5764..6012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6457..6729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6508..6717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    6748..7011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6766..7011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7027..7281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7045..>7233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <7387..>7512
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    7564..7815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7579..7815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7825..8076
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8089..8337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8107..8337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8347..8601
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8611..8862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8626..8862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8872..9123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8890..9126
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    9136..9384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9151..9384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    9400..9651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9418..9651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <9760..9924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9982..10203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10009..10200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10258..10518
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10309..10515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10732..11001
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10783..10992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    11086..11358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11152..11349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13090..13356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    <13174..13356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    13372..13641
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13423..13632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13657..13926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13675..13926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    13936..14205
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13987..14196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14215..14487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14269..14478
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14497..14757
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14533..14739
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    14776..15045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14827..15027
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15082..15324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15082..15324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15343..15612
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15397..15597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15622..15891
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15673..15882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15904..16173
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15961..16158
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16183..16449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16234..16443
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16462..16731
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16528..16719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16798..17010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    17029..17298
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17086..17283
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    17308..17577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17326..17577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    17587..17859
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17644..17850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    17869..18132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17920..18129
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    18148..18417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18199..18405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    18430..18696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18448..18696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    18715..18984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18772..18969
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    18994..19263
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19045..19251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19273..19545
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19330..19536
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19555..19821
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19606..19806
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19834..20106
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19858..20106
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    20119..20385
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20170..20376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    20404..20673
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20458..20664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    20683..20952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20734..20943
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    20968..21225
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21013..21219
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    21241..21495
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21292..21501
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    21529..21795
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21580..21789
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    21817..22086
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21874..22077
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22096..22368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22150..22356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22378..22644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22429..22632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22657..22929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22678..22929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    22936..23181
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    22942..23208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23227..23496
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23278..23487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    23506..23775
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23524..23775
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    23788..24054
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23815..24054
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    24064..24294
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24115..24294
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24352..24618
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24403..24612
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24640..24909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24694..24900
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24919..25191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24982..25182
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    25201..25452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25252..25452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    25480..25752
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25531..25743
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    25765..26031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25816..26022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    26050..26319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26101..26307
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    26329..26592
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26380..26589
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    26611..26868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26677..26856
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    26887..27156
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26938..27144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    27175..27441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    27226..27435
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    27463..27732
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    27520..27723
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    27751..28023
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    27820..28008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    28042..28311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    28093..28296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    28372..28638
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    28384..28638
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    28990..29232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    28993..29232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    29239..29493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    29260..29493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    29509..29769
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    29527..29772
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    31984..32067
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="PPAK motif; Region: PPAK; pfam02818"
                     /db_xref="CDD:202413"
     misc_feature    32068..32148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="PPAK motif; Region: PPAK; pfam02818"
                     /db_xref="CDD:202413"
     misc_feature    36352..36627
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    36412..36618
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    36685..36876
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    36943..>37137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    37204..37449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37468..37716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37729..37980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37747..37980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    37993..38244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38023..38244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    38260..38511
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38284..38511
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    38545..38769
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    38794..39045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39079..>39273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    39328..39579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39601..39846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39613..39846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    39862..40113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39886..40122
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of semaphorin;
                     Region: Ig_Semaphorin_C; cd04979"
                     /db_xref="CDD:143180"
     misc_feature    order(39907..39909,40036..40038)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143180"
     misc_feature    40189..40347
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    40444..40611
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    40663..40914
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    40678..40914
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    40927..41193
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    40945..41193
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    41209..41460
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    41227..41460
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    41476..41727
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    41494..41727
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    41743..>41952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    42025..42264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    42052..42264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    42274..42540
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42274..42276,42469..42471,42517..42519)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42520..42525,42529..42534)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42577..42855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42577..42579,42775..42777,42820..42822)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42823..42828,42832..42837)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42880..43161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42880..42882,43078..43080,43123..43125)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43126..43131,43135..43140)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43222..43458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    43237..43458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    43468..43725
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43468..43470,43663..43665,43708..43710)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43711..43716,43720..43725)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43768..44037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43768..43770,43963..43965,44008..44010)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44011..44016,44020..44025)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44104..44346
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    44125..44346
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    44356..44634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44356..44358,44551..44553,44596..44598)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44599..44604,44608..44613)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44653..44925
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44653..44655,44851..44853,44896..44898)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44899..44904,44908..44913)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44977..45225
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45151..45153,45196..45198)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45199..45204,45208..45213)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45256..45525
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45256..45258,45451..45453,45496..45498)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45499..45504,45508..45513)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45556..45831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45556..45558,45754..45756,45799..45801)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45802..45807,45811..45816)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45880..46134
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46060..46062,46105..46107)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46108..46113,46117..46122)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46165..46434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    46213..46434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    46444..46704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46444..46446,46639..46641,46684..46686)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46687..46692,46696..46701)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46780..47022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46942..46944,46987..46989)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46990..46995,46999..47004)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47065..47400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    47101..47400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    47410..47694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47410..47412,47611..47613,47656..47658)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47659..47664,47668..47673)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47713..47991
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47713..47715,47908..47910,47953..47955)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47956..47961,47965..47970)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48031..48291
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48208..48210,48253..48255)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48256..48261,48265..48270)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48367..48585
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    48595..48864
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48595..48597,48787..48789,48832..48834)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48835..48840,48844..48849)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48889..49167
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48889..48891,49087..49089,49132..49134)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49135..49140,49144..49149)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49249..49488
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    49498..49779
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49498..49500,49699..49701,49744..49746)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49747..49752,49756..49761)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49801..50088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49801..49803,50014..50016,50059..50061)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50062..50067,50071..50076)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50119..50394
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50119..50121,50323..50325,50368..50370)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50371..50376,50380..50385)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50485..50730
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    50740..51018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50740..50742,50935..50937,50980..50982)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50983..50988,50992..50997)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51040..51336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51040..51042,51253..51255,51298..51300)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51301..51306,51310..51315)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51382..51645
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    51655..51936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51655..51657,51853..51855,51898..51900)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51901..51906,51910..51915)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51955..52248
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51955..51957,52165..52167,52210..52212)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52213..52218,52222..52227)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52267..52545
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52267..52269,52465..52467,52510..52512)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52513..52518,52522..52527)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52627..52842
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    52852..53127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52852..52854,53050..53052,53095..53097)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53098..53103,53107..53112)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53155..53436
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53155..53157,53353..53355,53398..53400)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53401..53406,53410..53415)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53530..53718
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    53764..54021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53938..53940,53983..53985)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53986..53991,53995..54000)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54040..54309
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54040..54042,54238..54240,54283..54285)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54286..54291,54295..54300)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54343..54609
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54343..54345,54547..54549,54592..54594)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54595..54600,54604..54609)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54709..54924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    54934..55197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54934..54936,55129..55131,55174..55176)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55177..55182,55186..55191)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55234..55503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55234..55236,55426..55428,55471..55473)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55474..55479,55483..55488)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55564..55806
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    55585..55806
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    55816..56097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55816..55818,56014..56016,56059..56061)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56062..56067,56071..56076)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56116..56391
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56116..56118,56311..56313,56356..56358)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56359..56364,56368..56373)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56440..56691
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56617..56619,56662..56664)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56665..56670,56674..56679)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56779..57000
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    57010..57282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57010..57012,57202..57204,57247..57249)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57250..57255,57259..57264)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57307..57588
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57307..57309,57505..57507,57550..57552)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57553..57558,57562..57567)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57607..57885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    57658..57885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    57895..58173
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57895..57897,58090..58092,58135..58137)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58138..58143,58147..58152)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58192..58473
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58192..58194,58390..58392,58435..58437)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58438..58443,58447..58452)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58495..58791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58495..58497,58711..58713,58756..58758)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58759..58764,58768..58773)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58873..59091
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    59101..59361
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59101..59103,59296..59298,59341..59343)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59344..59349,59353..59358)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59401..59679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59401..59403,59599..59601,59644..59646)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59647..59652,59656..59661)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59719..59970
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    59749..59970
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    59980..60246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59980..59982,60178..60180,60223..60225)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60226..60231,60235..60240)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60280..60561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60280..60282,60478..60480,60523..60525)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60526..60531,60535..60540)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60577..60861
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60778..60780,60823..60825)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60826..60831,60835..60840)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60919..61161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    60940..61161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    61171..61449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61171..61173,61366..61368,61411..61413)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61414..61419,61423..61428)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61468..61737
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61468..61470,61666..61668,61711..61713)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61714..61719,61723..61728)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61771..62037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61771..61773,61972..61974,62017..62019)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62020..62025,62029..62034)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62107..62355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    62134..62355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    62365..62640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62365..62367,62560..62562,62605..62607)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62608..62613,62617..62622)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62656..62922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62656..62658,62845..62847,62890..62892)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62893..62898,62902..62907)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63001..63222
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    63232..63513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63232..63234,63430..63432,63475..63477)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63478..63483,63487..63492)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63574..63813
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63730..63732,63775..63777)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63778..63783,63787..63792)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63829..64107
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64024..64026,64069..64071)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64075..64080,64084..64089)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64207..64413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    64423..64698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64423..64425,64618..64620,64663..64665)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64666..64671,64675..64680)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64720..64992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64720..64722,64918..64920,64963..64965)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64966..64971,64975..64980)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65023..65286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65023..65025,65224..65226,65269..65271)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65272..65277,65281..65286)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65356..65598
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    65383..65598
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    65608..65877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65608..65610,65803..65805,65848..65850)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65851..65856,65860..65865)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65899..66174
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65899..65901,66091..66093,66136..66138)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66139..66144,66148..66153)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66250..66474
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66481..66762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66481..66483,66679..66681,66724..66726)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66727..66732,66736..66741)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66781..67053
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66781..66783,66979..66981,67024..67026)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67027..67032,67036..67041)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67078..67359
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67273..67275,67318..67320)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67324..67329,67333..67338)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67390..67659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    67441..67659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    67669..67944
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67669..67671,67867..67869,67912..67914)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67915..67920,67924..67929)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67990..68247
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68167..68169,68212..68214)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68215..68220,68224..68229)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68272..68535
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68272..68274,68473..68475,68518..68520)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68521..68526,68530..68535)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68608..68850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    68635..68850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    68860..69129
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68860..68862,69055..69057,69100..69102)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69103..69108,69112..69117)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69151..69402
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69151..69153,69343..69345,69388..69390)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69391..69396,69400..69402)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69448..69717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69496..69717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    69727..70008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69727..69729,69925..69927,69970..69972)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69973..69978,69982..69987)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70063..70308
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70225..70227,70270..70272)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70273..70278,70282..70287)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70324..70605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70519..70521,70564..70566)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70567..70569,70573..70575,70579..70584)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70663..70905
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    70684..70905
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    70915..71196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70915..70917,71113..71115,71158..71160)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71161..71166,71170..71175)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71215..71484
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71215..71217,71413..71415,71458..71460)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71461..71466,71470..71475)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71518..71784
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71518..71520,71719..71721,71764..71766)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71767..71772,71776..71781)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71881..72096
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    72106..72381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72106..72108,72301..72303,72346..72348)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72349..72354,72358..72363)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72397..72648
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72397..72399,72589..72591,72634..72636)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72637..72642,72646..72648)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72727..72954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    72742..72957
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    72973..73254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72973..72975,73171..73173,73216..73218)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73219..73224,73228..73233)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73273..73554
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73273..73275,73471..73473,73516..73518)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73519..73524,73528..73533)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73570..73851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73765..73767,73810..73812)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73816..73821,73825..73830)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73891..74151
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    73930..74151
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    74161..74436
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74161..74163,74359..74361,74404..74406)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74407..74412,74416..74421)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74461..74739
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74461..74463,74659..74661,74704..74706)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74707..74712,74716..74721)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74764..75030
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74764..74766,74965..74967,75010..75012)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(75013..75018,75022..75027)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75100..75342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    75133..75342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    75352..75627
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(75352..75354,75547..75549,75592..75594)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(75595..75600,75604..75609)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75643..75894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(75643..75645,75835..75837,75880..75882)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(75883..75888,75892..75894)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75973..76209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    75988..76209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    76219..76500
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(76219..76221,76417..76419,76462..76464)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(76465..76470,76474..76479)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    76519..76794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(76519..76521,76717..76719,76762..76764)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(76765..76770,76774..76779)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    76816..77097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77011..77013,77056..77058)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(77059..77061,77065..77067,77071..77076)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    77176..77400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    77410..77691
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77410..77412,77608..77610,77653..77655)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(77656..77661,77665..77670)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    77710..77988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77710..77712,77908..77910,77953..77955)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(77956..77961,77965..77970)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78013..78279
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(78013..78015,78214..78216,78259..78261)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(78262..78267,78271..78276)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78349..78591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78376..78591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    78601..78870
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(78601..78603,78796..78798,78841..78843)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(78844..78849,78853..78858)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78892..79143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(78892..78894,79084..79086,79129..79131)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(79132..79137,79141..79143)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    79189..79458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79237..79458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    79468..79713
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(79468..79470,79663..79665,79708..79710)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    79786..80037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(79963..79965,80008..80010)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80011..80016,80020..80025)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80062..80331
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(80257..80259,80305..80307)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80308..80313,80317..80322)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80422..80643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    80653..80934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(80653..80655,80851..80853,80896..80898)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80899..80904,80908..80913)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80953..81231
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(80953..80955,81151..81153,81196..81198)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(81199..81204,81208..81213)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    81256..81531
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(81256..81258,81451..81453,81496..81498)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(81499..81504,81508..81513)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    81586..81828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    81613..81828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    81838..82113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(81838..81840,82033..82035,82078..82080)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(82081..82086,82090..82095)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    82129..82380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(82129..82131,82321..82323,82366..82368)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(82369..82374,82378..82380)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    82450..82704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    82483..82704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    82714..82995
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(82714..82716,82912..82914,82957..82959)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(82960..82965,82969..82974)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    83014..83286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83014..83016,83212..83214,83257..83259)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(83260..83265,83269..83274)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    83311..83592
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83506..83508,83551..83553)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(83557..83562,83566..83571)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    83614..83892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    83671..83892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    83902..84183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83902..83904,84100..84102,84145..84147)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84148..84153,84157..84162)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84202..84480
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(84202..84204,84400..84402,84445..84447)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84448..84453,84457..84462)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84526..84771
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(84706..84708,84751..84753)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84754..84759,84763..84768)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84841..85092
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    84868..85092
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    85102..85371
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(85102..85104,85297..85299,85342..85344)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(85345..85350,85354..85359)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    85393..85668
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(85393..85395,85585..85587,85630..85632)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(85633..85638,85642..85647)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    85744..85926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    85975..86256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(85975..85977,86173..86175,86218..86220)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86221..86226,86230..86235)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    86275..86553
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(86275..86277,86473..86475,86518..86520)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86521..86526,86530..86535)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    86572..86847
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(86764..86766,86809..86811)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86812..86814,86818..86820,86824..86829)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    86929..87150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    87181..87441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87358..87360,87403..87405)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(87406..87411,87415..87420)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    87460..87723
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87460..87462,87661..87663,87706..87708)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(87709..87714,87718..87723)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    87766..88035
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87766..87768,87964..87966,88009..88011)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(88012..88017,88021..88026)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    88126..88341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    88351..88605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(88351..88353,88546..88548,88591..88593)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(88594..88599,88603..88605)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    88642..88908
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(88642..88644,88834..88836,88879..88881)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(88882..88887,88891..88896)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    88996..89217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    89227..89508
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(89227..89229,89425..89427,89470..89472)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(89473..89478,89482..89487)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    89527..89805
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(89527..89529,89725..89727,89770..89772)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(89773..89778,89782..89787)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    89824..90114
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90028..90030,90073..90075)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(90076..90078,90082..90084,90088..90093)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    90196..90417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    90427..90705
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90427..90429,90622..90624,90667..90669)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(90670..90675,90679..90684)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    90724..91008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90724..90726,90925..90927,90970..90972)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(90973..90978,90982..90987)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91030..91302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(91030..91032,91231..91233,91276..91278)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(91279..91284,91288..91293)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91366..91608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    91393..91608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    91618..91893
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(91618..91620,91813..91815,91858..91860)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(91861..91866,91870..91875)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91909..92190
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(91909..91911,92107..92109,92152..92154)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(92155..92160,92164..92169)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    92242..92490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    92269..92490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    92500..92775
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(92500..92502,92698..92700,92743..92745)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(92746..92751,92755..92760)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    92800..93069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(92800..92802,92998..93000,93043..93045)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(93046..93051,93055..93060)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    93103..93339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(93103..93105,93301..93303)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    93463..93678
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    93688..93960
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(93688..93690,93886..93888,93931..93933)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(93934..93939,93943..93948)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    94024..94275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(94192..94194,94237..94239)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(94240..94245,94249..94254)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    94297..94554
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(94297..94299,94495..94497,94540..94542)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(94543..94548,94552..94554)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    94603..94866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    94654..94857
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    94939..95157
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    95173..95454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(95173..95175,95374..95376,95419..95421)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(95422..95427,95431..95436)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    95479..95760
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(95479..95481,95677..95679,95722..95724)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(95725..95730,95734..95739)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    95788..96063
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    95839..96054
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    96136..96360
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    96370..96642
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(96370..96372,96562..96564,96607..96609)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(96610..96615,96619..96624)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    96757..97521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    96775..97515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(96775..96789,96799..96801,96838..96840,96844..96846,
                     96928..96930,96976..96987,96997..96999,97003..97005,
                     97117..97119,97123..97125,97129..97134,97138..97140,
                     97177..97179,97186..97188,97231..97242)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(96775..96789,96799..96801,96838..96840,96844..96846,
                     96928..96930,96976..96987,96997..96999,97117..97119,
                     97123..97125,97129..97134,97138..97140,97177..97179)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(96787..96789,96997..96999,97003..97005,97117..97119,
                     97123..97125,97129..97131,97186..97188,97231..97242)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(97174..97194,97231..97242)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    97759..97971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    98074..98352
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    98098..98352
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    98389..98661
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    98425..98661
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    100126..100395
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    100147..100395
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    100678..100953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="M5, fifth immunoglobulin (Ig)-like domain of human
                     titin C terminus and similar proteins; Region:
                     Ig5_Titin_like; cd05747"
                     /db_xref="CDD:143224"
     misc_feature    100690..100956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    101158..101412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    101203..101421
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    101560..101829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    101581..101829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    102139..102381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    102406..102675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    102457..102666
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    102991..103266
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    103060..103266
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            317..520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647842"
     exon            521..808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647843"
     exon            809..894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647844"
     exon            895..1139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647845"
     variation       1228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647846"
     exon            1471..1623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1624..1761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34337578"
     variation       1717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647851"
     exon            1762..1887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1888..2025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2164..2301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2298
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72647860"
     exon            2302..2595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2596..2718
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2657
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35813871"
     exon            2719..3000
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2836
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647861"
     variation       2989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647862"
     exon            3001..3066
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3067..3325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647865"
     exon            3326..3389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647867"
     variation       3358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647868"
     exon            3390..3605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             3537..3680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1574E"
                     /db_xref="UniSTS:150658"
     exon            3606..3748
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647870"
     exon            3749..3954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3955..4188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2291308"
     variation       4109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1552280"
     exon            4189..4433
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72647872"
     exon            4434..4705
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647875"
     variation       4547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647876"
     exon            4706..4870
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             4760..4866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="A008T22"
                     /db_xref="UniSTS:24210"
     variation       4855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647877"
     exon            4871..5039
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            5040..6733
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       5613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647878"
     STS             6331..6459
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1524E"
                     /db_xref="UniSTS:45880"
     variation       6473
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72647879"
     exon            6734..7015
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       6885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647880"
     variation       6998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647881"
     exon            7016..7282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7283..7555
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7556..7819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7820..8080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8081..8341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8342..8605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8606..8866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8814
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647883"
     exon            8867..9127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647884"
     exon            9128..9388
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647885"
     variation       9375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647886"
     exon            9389..9530
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9531..9696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9584
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647894"
     exon            9697..9928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9929..10213
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10214..10339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10340..10528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10529..10585
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10586..13366
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       10644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648918"
     variation       11249
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648919"
     variation       11529
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742357"
     variation       11690
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648920"
     variation       11832
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648921"
     variation       12054
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746578"
     variation       12492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1883084"
     variation       12536
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648922"
     variation       13074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1883085"
     exon            13367..13645
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13646..14209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       13799
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742347"
     variation       13884
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742348"
     variation       13972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648923"
     variation       14094
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648924"
     variation       14144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648925"
     STS             14203..14444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1518E"
                     /db_xref="UniSTS:150612"
     exon            14210..14491
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14258
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648927"
     variation       14289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648928"
     variation       14452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648929"
     exon            14492..14770
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14771..15049
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648930"
     variation       14858
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648931"
     variation       14991
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648932"
     exon            15050..15328
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15063
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648933"
     variation       15124
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:66839174"
     variation       15181
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648934"
     exon            15329..15616
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15369
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648935"
     variation       15400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648936"
     variation       15577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648937"
     exon            15617..15895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15721
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648938"
     variation       15803
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648939"
     variation       15820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648940"
     exon            15896..16177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16178..16456
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16322
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648942"
     exon            16457..16735
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648943"
     exon            16736..17014
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17015..17302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648945"
     variation       17263
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648946"
     exon            17303..17581
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             17306..17446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH44253"
                     /db_xref="UniSTS:31799"
     exon            17582..17863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17824
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648947"
     exon            17864..18142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648948"
     variation       18050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648949"
     exon            18143..18421
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648950"
     variation       18278
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648951"
     exon            18422..18700
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18424
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648953"
     variation       18478
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648954"
     exon            18701..18988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648956"
     exon            18989..19267
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19268..19549
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19372
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648957"
     exon            19550..19828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19615
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648958"
     exon            19829..20110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20080..20081
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742325"
     exon            20111..20389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20318
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648960"
     variation       20319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648961"
     variation       20380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648962"
     exon            20390..20677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648964"
     exon            20678..20956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20957..21235
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21236..21514
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648966"
     exon            21515..21802
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21803..22090
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21908
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648969"
     variation       22060
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648970"
     exon            22091..22372
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22373..22651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22395
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648971"
     variation       22497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2562831"
     variation       22506
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648972"
     variation       22576
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648973"
     exon            22652..22933
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22934..23212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23213..23500
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23425
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368226720"
     variation       23434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648976"
     exon            23501..23779
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648977"
     exon            23780..24058
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648978"
     variation       23853
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648979"
     variation       23926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648980"
     exon            24059..24337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24094
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648981"
     variation       24154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648982"
     variation       24183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648983"
     variation       24247
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648984"
     exon            24338..24625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24338
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2627043"
     exon            24626..24913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648986"
     variation       24900
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2562832"
     exon            24914..25195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24981
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742329"
     exon            25196..25474
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25210
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648987"
     variation       25365
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2562836"
     exon            25475..25756
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25563
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2562838"
     exon            25757..26035
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25768
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648989"
     variation       25802
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648990"
     variation       25929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2562839"
     variation       25930
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648991"
     exon            26036..26323
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648993"
     variation       26137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648994"
     exon            26324..26602
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26603..26881
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648995"
     exon            26882..27160
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             26884..26989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1591E"
                     /db_xref="UniSTS:150675"
     variation       27098
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648996"
     exon            27161..27448
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             27243..27358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="SHGC-62013"
                     /db_xref="UniSTS:27408"
     variation       27288
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200655768"
     variation       27333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201024042"
     variation       27405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648997"
     exon            27449..27736
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27587
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648998"
     exon            27737..28027
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742332"
     variation       28005
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72649000"
     exon            28028..28315
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28095..28096
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2627035"
     variation       28095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2742338"
     exon            28316..28408
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28402
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72649002"
     exon            28409..28694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72650003"
     exon            28695..28878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28879..28968
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28969..29236
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742343"
     variation       29073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742344"
     variation       29086
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72650006"
     variation       29210
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650007"
     exon            29237..29497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29498..29707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29548
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650011"
     exon            29708..29785
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29786..29812
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29813..29872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29873..29956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29957..30028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30029..30076
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30077..30481
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30482..30544
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30545..30622
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30623..30700
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30673
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650019"
     variation       30696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650020"
     exon            30701..30787
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30788..30868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30838
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2042995"
     exon            30869..30952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30953..31036
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31037..31120
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31121..31201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31138
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2244492"
     exon            31202..31285
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31286..31369
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31370..31471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31472..31585
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650028"
     exon            31586..31666
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650029"
     STS             31648..31773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65366"
                     /db_xref="UniSTS:73247"
     exon            31667..31744
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31745..31828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31754
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650030"
     exon            31829..31912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31898
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650031"
     exon            31913..31996
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31997..32080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650032"
     exon            32081..32161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32162..32368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32327
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650034"
     variation       32333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650035"
     exon            32369..32446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650036"
     exon            32447..32521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32522..32614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32615..32692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32690
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650040"
     exon            32693..32854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32855..32938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32939..33016
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33017..33100
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33101..33184
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33185..33268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33269..33565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33566..33640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33641..33715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33716..33811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33812..33889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33875
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650052"
     exon            33890..33958
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33959..34033
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34034..34330
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34331..34411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34412..34489
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34490..34579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34580..34663
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34664..34747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34748..34831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34832..34915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       34856
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650061"
     exon            34916..34999
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       34954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72650062"
     exon            35000..35083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35084..35167
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35168..35251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       35170
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72650064"
     exon            35252..35329
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35330..35413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       35408
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650066"
     exon            35414..35521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35522..35599
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35600..35710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35711..35779
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35780..35860
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35861..35935
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35936..36025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36026..36088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36089..36178
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36179..36229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36230..36631
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650077"
     variation       36406
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650078"
     exon            36632..36910
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650079"
     exon            36911..37186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37187..37326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37327..37453
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37454..37717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650080"
     exon            37718..37984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37849
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650081"
     exon            37985..38248
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38249..38388
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             38250..38358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1881"
                     /db_xref="UniSTS:153573"
     exon            38389..38515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38486
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650084"
     exon            38516..38782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38783..39049
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39050..39316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650088"
     exon            39317..39456
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39457..39583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39584..39726
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39652
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677216"
     exon            39727..39850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39851..40117
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            40118..40215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            40216..40384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677221"
     exon            40385..40651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40575
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677223"
     exon            40652..40918
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677225"
     exon            40919..41197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41040
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303829"
     variation       41062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677226"
     exon            41198..41606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72677227"
     exon            41607..41731
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41732..41998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677229"
     exon            41999..42268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42269..42571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677231"
     variation       42550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677232"
     exon            42572..42874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42617
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677233"
     exon            42875..43062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677237"
     exon            43063..43177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            43178..43462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            43463..43614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677238"
     exon            43615..43762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303830"
     exon            43763..43940
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677240"
     exon            43941..44062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       44029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677242"
     exon            44063..44350
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       44255
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677243"
     variation       44298
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677244"
     exon            44351..44647
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            44648..44834
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       44708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677245"
     exon            44835..44950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            44951..45250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       45033
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2115558"
     variation       45060
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677247"
     exon            45251..45550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            45551..45656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            45657..45853
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       45660
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677249"
     exon            45854..46159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       46114
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677250"
     exon            46160..46438
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       46411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78462639"
     exon            46439..46738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       46559
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632860"
     exon            46739..47041
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       46986
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288566"
     exon            47042..47404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       47187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632861"
     exon            47405..47707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            47708..48007
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            48008..48304
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       48123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303831"
     exon            48305..48589
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       48398
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646808"
     variation       48425
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2303832"
     variation       48494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646809"
     exon            48590..48883
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            48884..49183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            49184..49492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       49302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646813"
     variation       49491
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303834"
     exon            49493..49683
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            49684..50113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            50114..50422
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            50423..50571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       50441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646819"
     exon            50572..50604
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            50605..50734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       50719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646822"
     exon            50735..51034
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       50855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646823"
     exon            51035..51352
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            51353..51649
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       51403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001238"
     STS             51550..51655
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1532E"
                     /db_xref="UniSTS:150620"
     exon            51650..51949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       51831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646827"
     exon            51950..52264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             52054..52192
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65766"
                     /db_xref="UniSTS:17479"
     variation       52108
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646828"
     STS             52199..52297
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1570E"
                     /db_xref="UniSTS:150654"
     exon            52265..52413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            52414..52564
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            52565..52846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       52633
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646831"
     variation       52764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646832"
     variation       52766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646833"
     exon            52847..53149
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            53150..53452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            53453..53734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       53572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646837"
     exon            53735..54034
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       53738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288569"
     variation       53852
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646838"
     exon            54035..54337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       54235
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303836"
     exon            54338..54646
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       54415
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646839"
     variation       54617
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646840"
     exon            54647..54928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            54929..55228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       55137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646842"
     exon            55229..55522
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       55490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560220"
     exon            55523..58489
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       55792
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646843"
     variation       56120
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646844"
     variation       56123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646845"
     variation       56547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2163009"
     variation       57178
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646846"
     variation       57360
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560221"
     variation       57480
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646847"
     variation       57687
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646848"
     variation       57734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646849"
     variation       58325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646850"
     variation       58328
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646851"
     variation       58467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646852"
     exon            58490..58810
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       58741
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646853"
     exon            58811..59095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       58829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646854"
     variation       58891
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646855"
     exon            59096..59395
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59334
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646857"
     exon            59396..59698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59476
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646859"
     variation       59510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2042996"
     exon            59699..59974
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            59975..60274
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646860"
     exon            60275..60577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60394
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646861"
     exon            60578..60877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            60878..61165
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646866"
     variation       61077
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646867"
     exon            61166..61462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61388
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646868"
     exon            61463..61765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            61766..62071
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61916
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646869"
     variation       61975
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646870"
     exon            62072..62359
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646871"
     variation       62341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303837"
     exon            62360..62650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303838"
     variation       62401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646873"
     STS             62589..62989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_23497-23498:1027358865:1"
                     /db_xref="UniSTS:268713"
     exon            62651..62938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646876"
     variation       62937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288570"
     exon            62939..63526
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       63261
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646877"
     exon            63527..63631
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            63632..63829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       63760
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646880"
     exon            63830..64126
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            64127..64714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       64447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646881"
     variation       64685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646882"
     exon            64715..65017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       64727
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288572"
     variation       64887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:67041405"
     variation       64952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646884"
     variation       64978
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646885"
     exon            65018..82123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       65562
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646887"
     variation       65782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646888"
     variation       65953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646889"
     variation       65979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646890"
     variation       66134
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646891"
     variation       66166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646892"
     variation       67242
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646893"
     variation       67335
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646894"
     STS             67511..67636
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1571E"
                     /db_xref="UniSTS:150655"
     variation       68329
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646895"
     variation       68522
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646896"
     variation       68848
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646897"
     variation       69904
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646898"
     variation       70141
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744426"
     variation       70193
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646899"
     variation       70274
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744427"
     variation       70339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744428"
     variation       70376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731743"
     variation       70922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646900"
     variation       70939
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646901"
     STS             71045..71246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1580E"
                     /db_xref="UniSTS:150664"
     STS             71368..71468
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1593E"
                     /db_xref="UniSTS:150677"
     variation       71645
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813243"
     variation       71715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646902"
     variation       72001
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3813244"
     variation       72022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813245"
     STS             72207..72547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="TTN-1"
                     /db_xref="UniSTS:254009"
     variation       72581
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813246"
     variation       73215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648203"
     variation       73365
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648204"
     variation       74048
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010407"
     variation       74194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648205"
     variation       74528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648206"
     variation       74567
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731745"
     variation       74928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648207"
     variation       75164
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731746"
     variation       75243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648208"
     variation       75246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648209"
     variation       75775
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648210"
     variation       76101
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813247"
     variation       76324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648211"
     variation       76407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648212"
     STS             77068..77194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1550E"
                     /db_xref="UniSTS:150635"
     variation       77787
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648213"
     variation       77989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648214"
     variation       78056
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648215"
     variation       78099
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648216"
     variation       78418
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648217"
     variation       78515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648218"
     variation       78625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829746"
     variation       79505
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648219"
     variation       79655
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648220"
     variation       79942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648221"
     variation       80121
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648222"
     variation       80505
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648223"
     STS             80701..80916
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1560E"
                     /db_xref="UniSTS:150645"
     STS             81245..81423
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH48674"
                     /db_xref="UniSTS:32026"
     variation       81271
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648224"
     variation       81304
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648225"
     STS             81344..81455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1572E"
                     /db_xref="UniSTS:150656"
     variation       81828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648226"
     exon            82124..82420
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             82168..82249
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1553E"
                     /db_xref="UniSTS:150638"
     exon            82421..83008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       82714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648227"
     variation       82913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648228"
     variation       82971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648229"
     exon            83009..83311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       83073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648230"
     variation       83209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648231"
     STS             83239..83376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_21540-21541:1033053987:1"
                     /db_xref="UniSTS:268573"
     exon            83312..83608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            83609..83896
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       83798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648234"
     exon            83897..84196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       83987
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648235"
     variation       84070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648236"
     exon            84197..84499
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            84500..84805
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             84539..84652
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1519E"
                     /db_xref="UniSTS:22697"
     variation       84688
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648237"
     variation       84728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648238"
     exon            84806..86572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648240"
     variation       85209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648241"
     variation       85743
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648242"
     STS             86091..86233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65575"
                     /db_xref="UniSTS:58532"
     variation       86375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648243"
     exon            86573..86866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            86867..87154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       86875
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648244"
     exon            87155..87454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             87209..87347
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH98821"
                     /db_xref="UniSTS:85869"
     variation       87239
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648245"
     variation       87301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648246"
     exon            87455..89521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       87478
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648247"
     variation       88163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648248"
     variation       88178
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648249"
     STS             88413..88504
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1540E"
                     /db_xref="UniSTS:150626"
     variation       88468
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648250"
     variation       88545
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731748"
     variation       88826
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648251"
     variation       88895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648252"
     STS             88944..89045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1546E"
                     /db_xref="UniSTS:150631"
     exon            89522..89824
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            89825..90130
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90000
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648253"
     exon            90131..90421
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370821616"
     variation       90145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648254"
     variation       90148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648255"
     variation       90153
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648256"
     variation       90349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648257"
     exon            90422..90718
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90491..90492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857280"
     variation       90561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648258"
     variation       90572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648259"
     exon            90719..91024
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857267"
     variation       90855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648260"
     variation       90868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648261"
     variation       90949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648262"
     variation       90955
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648263"
     variation       90991..90992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857270"
     exon            91025..91330
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       91268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72648265"
     exon            91331..91612
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            91613..92206
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       91711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857279"
     variation       92177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200676850"
     exon            92207..92494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       92220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648266"
     exon            92495..92794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       92596
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648267"
     exon            92795..93097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       92915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3731749"
     exon            93098..93400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            93401..93985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       93420
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648269"
     variation       93466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648270"
     variation       93474
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648271"
     variation       93544
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648272"
     variation       93596
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648273"
     variation       93669
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648274"
     exon            93986..94291
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            94292..94591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       94457
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648276"
     exon            94592..95167
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            95168..95473
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       95203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648278"
     variation       95257
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648279"
     exon            95474..96067
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       95546
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648282"
     variation       95675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648283"
     variation       95708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857264"
     variation       95761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629779"
     exon            96068..101676
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       96404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962659"
     variation       96741
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629781"
     variation       97010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629782"
     variation       97821
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857265"
     variation       98135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3731752"
     variation       98179
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629783"
     variation       98276
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857266"
     variation       98355
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731753"
     variation       98534
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72629784"
     variation       98665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629785"
     variation       99083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829747"
     variation       99260
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629786"
     variation       99475
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857268"
     variation       99679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72629787"
     STS             99758..99882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65621"
                     /db_xref="UniSTS:70042"
     variation       99878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:68080670"
     variation       99893
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629788"
     STS             100289..100497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1568E"
                     /db_xref="UniSTS:150652"
     variation       100290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829748"
     variation       100392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629789"
     variation       100495
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857269"
     variation       100514
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813249"
     variation       100686
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813250"
     variation       100884
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829749"
     variation       101089
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67254537"
     variation       101123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2857271"
     exon            101677..101833
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            101834..102525
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             102038..102216
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1564E"
                     /db_xref="UniSTS:150649"
     exon            102526..102679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            102680..102982
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       102878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629793"
     exon            102983..104301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       103321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629794"
     variation       103337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629795"
     STS             103896..104010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S2648"
                     /db_xref="UniSTS:75793"
     variation       103942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629796"
     variation       104020
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629797"
     polyA_signal    104274..104279
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
     variation       104293
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629798"
     polyA_site      104301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
ORIGIN      
gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgcatagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctcaccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagcaaccttgggcttagtcccaccctttttaggcactcttgagaaatcagagtgcctagaaagatgacaactcaagcaccgacgtttacgcagccgttacaaagcgttgtggtactggagggtagtaccgcaacctttgaggctcacattagtggttttccagttcctgaggtgagctggtttagggatggccaggtgatttccacttccactctgcccggcgtgcagatctcctttagcgatggccgcgctaaactgacgatccccgccgtgactaaagccaacagtggacgatattccctgaaagccaccaatggatctggacaagcgactagtactgctgagcttctcgtgaaagctgagacagcaccacccaacttcgttcaacgactgcagagcatgaccgtgagacaaggaagccaagtgagactccaagtgagagtgactggaatccctacacctgtggtgaagttctaccgggatggagccgaaatccagagctcccttgatttccaaatttcacaagaaggcgacctctacagcttactgattgcagaagcataccctgaggactcagggacctattcagtaaatgccaccaatagcgttggaagagctacttcgactgctgaattactggttcaaggtgaagaagaagtacctgctaaaaagacaaagacaattgtttcgactgctcagatctcagaatcaagacaaacccgaattgaaaagaagattgaagcccactttgatgccagatcaattgcaacagttgagatggtcatagatggtgccgctgggcaacagctgccacataaaacacctcccaggattcctccgaagccaaagtcaagatccccaacaccaccgtctattgctgccaaagcacagctggctcggcagcagtccccatcgcccataagacactccccttccccggtcagacacgtgcgggcaccgaccccatctccggtcaggtccgtgtctccagcagcaagaatctccacatcccccatcaggtctgttaggtctccattgctcatgcgtaagactcaggcatccaccgtggccacaggtcctgaagtgcctcccccttggaagcaagagggctacgtggcctcctcatctgaggctgagatgagagagacaacgctgacaacctctactcagatcaggacagaagagagatgggaagggagatacggtgtccaggagcaagtgaccatcagtggtgctgcgggtgctgccgccagtgtgtcggccagtgctagctacgcagcagaggctgttgccactggtgctaaagaggtgaaacaagatgctgacaaaagtgcagctgttgcgactgttgttgctgccgttgatatggccagagtgagagaaccagtgatcagcgctgtagagcagactgctcagaggacaaccacgactgctgtgcacatccaacctgctcaagaacaggtaagaaaggaagcggagaagactgctgtaactaaggtagtagtggccgccgataaagccaaggaacaagaattaaaatcaagaaccaaagaagtaattaccacaaagcaagagcagatgcacgtaactcatgagcagataagaaaagaaactgaaaaaacatttgtaccaaaggtagtaatttccgcagctaaagccaaagaacaagaaactagaatttctgaagaaattactaagaaacagaaacaagtaactcaagaagcaataagacaggaaactgagataactgctgcatccatggtggtagttgccactgcaaagtccacaaaactagaaacagtcccgggagctcaagaagaaactaccacacaacaagatcaaatgcacctaagttatgaaaagataatgaaggaaactaggaaaacagttgtacctaaagtcatagttgccacacccaaagtcaaagaacaagatttagtatcaagaggtagagaaggcattactaccaaaagagaacaagtgcaaataactcaggagaagatgagaaaggaagccgagaaaactgccttgtctacaatagcagttgctactgctaaagccaaagaacaagaaacaatactgagaactagagaaactatggctactagacaagaacaaatccaagttacccatggaaaggtggacgttggaaaaaaggctgaagctgtagcaacagttgttgctgcagtagaccaggcccgagtcagagagcccagagagcctgggcatcttgaagaatcctatgctcagcagaccactttggagtacggatataaggaacgcatttccgccgcaaaggtagctgagcctccccaacgtccagcctcagaaccccacgttgtccctaaagcagtcaagcctagagtaatccaggctccttctgagactcatatcaaaactactgatcaaaagggaatgcacatatcatcacagatcaagaaaactacagatctaacaacggaaagattagtccatgtggataaacgcccccgcacagctagccctcactttactgtttcaaaaatttctgttcctaagacagaacatggatatgaggcatcaatagccggtagtgctattgccacattacaaaaagagttgtcagccacatcttctgctcagaagatcaccaaatcggtgaaggctcctactgtgaagcccagtgagactagagtaagggcagagcccacacccttgccacagttccccttcgctgacacaccagatacttacaagagtgaagctggcgttgaggtgaaaaaggaagtaggggtgagcatcactggcaccaccgtccgtgaagagcgctttgaagtactgcacggacgcgaagccaaggtaacagaaacagcaagagtaccagcacctgttgaaattcctgttactccaccaactttggtctcgggcttaaaaaatgtgactgtcatagaaggtgaatctgtcaccttggagtgccacatctctggatacccatccccgacagtgacatggtacagggaagactaccaaatcgaaagttccattgacttccagataaccttccagagtggaattgctcgtcttatgattcgcgaagcatttgcggaagacagcgggcgatttacttgcagtgctgtaaatgaggctggaaccgtcagcacatcctgctatctggctgtgcaggtgtcagaagaatttgaaaaggaaaccacagccgtgactgagaaatttactacagaagagaaacgctttgttgagtcaagagatgtggttatgactgatactagcctcacagaggaacaagcagggcctggagaacctgccgcgccttactttattacaaaaccagtggtccagaaactggtggaaggtgggagcgtggtgtttggatgccaagttggcggcaacccaaagccccatgtatactggaaaaaatctggtgttcctctaaccactggatacagatacaaagtgagttacaacaaacaaaccggtgaatgcaagctggtgatttctatgacttttgctgatgatgctggagaatacactattgttgttcgcaataagcatggagaaacttctgcatctgcttccttgcttgaagaagctgattatgagttactgatgaagtcccagcaagaaatgctttatcagacacaagtgactgcatttgttcaagaacctaaagttggagaaacagcacctggatttgtatactctgagtatgaaaaagagtatgaaaaagaacaagccttaattaggaagaaaatggccaaagatactgtagtggtcagaacttatgtagaagatcaggaattccatatttcttcctttgaagagagacttattaaagaaattgaatatagaataataaagactacattagaagaacttcttgaagaagatggagaagaaaagatggcagttgacatttctgaatctgaagctgttgaatcaggatttgattcaagaatcaagaattatagaattcttgaggggatgggtgtcacttttcattgcaagatgtctggatatccattaccaaagattgcttggtacaaagatggcaagcgcatcaaacatggagaaagataccaaatggactttctacaagatggcagagctagtctgcgtatacctgttgttcttccagaagatgaaggaatctacactgcatttgccagcaatattaaaggaaatgcaatttgctcagggaaattgtatgtggagcctgctgcaccacttggagctccgacttacattcccacactagagccagtgagcagaatcagatctctctctccacgttcagtgagcaggtctcctatacgcatgtctcctgcacggatgtcacctgcaaggatgtctcctgcacggatgtcccctgcaagaatgtcccctggacgtaggctggaggagacagatgagtcacaacttgagagactatataaaccagtctttgtgttaaaacctgtttctttcaaatgtttagaagggcaaactgccagatttgacttaaaggttgttggtagacctatgccagagacgttctggtttcatgatggccagcaaattgtcaatgactatacccataaagtagtcattaaagaagatggtactcaatcactaattattgtccctgccacacccagtgattctggggaatggactgtggttgcccaaaacagggcaggcagatcttcaatttcagtgattttaactgtggaagctgtggaacatcaggtaaaaccgatgtttgtagaaaaactgaaaaatgtcaatataaaggaaggttcccgacttgaaatgaaagtcagagctacgggtaaccccaaccctgacattgtatggttgaaaaacagtgacatcattgtgcctcataaatatcccaaaatcagaattgaaggaaccaagggagaagctgcccttaaaatcgattccactgtcagccaagattctgcctggtatactgcgactgctattaataaagctggcagagacactacaagatgcaaagtaaatgttgaagttgagtttgcagagcctgagccagagagaaagttaatcatcccacgggggacatatagagcaaaggagattgcagccccagaactggagcccctccatttgcgatatggccaagagcaatgggaagaaggtgatctctatgacaaagagaaacaacagaaaccatttttcaagaaaaaactcacttccttaagacttaagcgctttgggcctgcccactttgaatgcaggctaacacccattggtgacccaacgatggtggtggagtggctccatgatggaaagccacttgaagcagccaacaggctccgtatgatcaatgaatttgggtactgcagccttgattatggcgttgcatattctagagacagtggtatcattacttgcagagccactaacaaatatggaacagatcacacatctgctacccttattgttaaagatgagaaaagtcttgtggaagaatcccaattgcctgaggggaggaaaggcttacagagaattgaagaattagagagaatggctcatgaaggtgcacttacaggtgtaacaacagatcagaaagaaaagcaaaagccagacattgtcttgtacccagagccagttagagtacttgaaggggagactgcaaggttccgctgcagggtaacaggctaccctcagcccaaagtcaactggtacctcaatggacagctcatccgcaaaagcaaaaggttcagagttcgctatgatggtatccattacctggacatcgtggactgcaaatcatatgacacaggtgaagtgaaggtcaccgcggaaaatcctgaaggtgtgatagagcataaagtgaagcttgagattcaacagagggaagattttaggtctgtccttaggagagctcctgaaccaaggcctgagtttcacgtacatgaaccaggaaagcttcagtttgaagtacaaaaagtggatagacctgttgacaccactgaaaccaaagaagttgtgaagttgaaaagggctgaaagaattacccatgaaaaagtgcctgaagagtcggaagagctgcgcagtaaattcaagcgcagaacagaagagggctattatgaagccattaccgctgtggagctcaagtctcgaaagaaggatgaatcctatgaggaactcctcaggaagacaaaagatgaacttctccactggaccaaagagttaactgaagaggaaaagaaagctcttgccgaagaaggcaaaatcacgattccaacttttaaacctgacaagattgaactaagtcctagtatggaggctccaaaaatcttcgaaagaatccagagccaaacagtgggccaaggatctgatgcacacttccgggtcagagtcgtggggaaaccagaccccgaatgtgaatggtacaaaaatggtgtcaaaattgaacggtctgaccggatctactggtactggcccgaagacaatgtttgtgaattggtcataagagatgtgactgctgaggactctgccagcatcatggtaaaagccatcaacatagctggagaaacctccagtcacgcattcttacttgtccaagccaagcaattgatcactttcacacaggaattacaagatgttgttgctaaggaaaaagacactatggcaacctttgaatgtgaaacttcagaaccatttgtcaaagtgaaatggtataaagatggtatggaggttcatgagggagataaatacaggatgcactctgacagaaaggttcacttcctctccatactgaccattgatacgtctgatgctgaagattacagctgtgtacttgtggaagatgaaaatgtcaaaacgactgctaaacttattgttgaaggtgcagttgttgagtttgtgaaagaacttcaggacatagaagttccagaatcatattcaggagaattagagtgcattgtatccccagaaaatatagaaggaaaatggtatcataatgatgtggagcttaaatccaatggcaaatatacaattacatctcgtcgtggacgtcagaacctcacggtcaaggatgtaaccaaggaggaccagggagaatacagctttgtcatcgacgggaaaaagacaacctgtaaattaaagatgaaaccccgccccattgctatcctacaaggacttagtgaccaaaaagtctgtgagggtgacattgttcagcttgaagttaaagtctccttggaaagtgtggaaggcgtctggatgaaagacggccaagaagtgcagcccagtgacagggttcacattgtgatagacaaacaatctcatatgctgctcattgaagacatgactaaggaagatgctggaaattactctttcaccattccagcccttggcctctccaccagtgggcgtgtctctgtctatagtgtggacgtgataacacctctaaaagatgttaatgtgattgaaggcaccaaggctgtgcttgaatgtaaggtgtcagtccctgatgtgacttctgttaagtggtacttaaatgatgaacaaatcaagcctgatgaccgtgtacaggccattgtgaaaggtactaaacagcgactagtcattaaccgaactcatgcttcagacgaaggaccttacaagctgatagttggcagagttgaaaccaactgtaatctctctgtagaaaaaattaaaattatcagaggtcttcgtgaccttacctgtacagaaactcaaaatgtggtgtttgaggttgagctgtcccactctggaattgatgtcctgtggaattttaaggacaaggaaatcaagcccagttctaaatataaaattgaagcacatggaaaaatatataaattgacagttctaaatatgatgaaagatgatgaaggaaaatacacattttacgcgggagaaaatatgacatctggaaaacttactgtggcaggtggggccatctccaagccactcacagatcagaccgtagctgaatcccaggaagctgtgtttgaatgtgaagttgccaacccagattccaaaggcgaatggttgagggatggcaaacacctaccactgactaacaacatcagaagtgagtctgatggccacaaaaggagacttatcattgctgccaccaaattagatgacattggagaatatacctacaaggtggccacctccaaaacatctgccaaactcaaagttgaagctgtcaaaattaagaagactctgaagaacctcacagtgacagaaacacaggatgctgttttcactgtcgagcttacacaccctaatgtcaaaggtgtccagtggatcaaaaatggagttgtgctggaatccaatgaaaagtatgctatctctgtcaaaggaacaatttactctctgaggattaaaaactgtgccatcgtggatgagtctgtttatggcttcaggcttggaaggcttggagccagtgccagactgcacgtggagactgtcaagatcattaaaaagccaaaggatgtgacagccttggaaaatgccactgttgcctttgaagttagtgtttcccatgacactgttccagtaaaatggttccataagagtgtggaaattaagccaagtgacaaacacagactggtctcagaaaggaaagtccacaagctgatgctgcagaacatctccccctcagatgctggggaatacacagctgtggtcgggcaattggaatgcaaagcaaaactgtttgtggagacattacatattacaaaaaccatgaaaaatatcgaggtgcctgagaccaaaactgcctcttttgagtgtgaggtgtcccacttcaatgtcccttccatgtggctgaagaatggtgtggaaattgagatgagtgaaaagttcaagatagttgtgcagggaaaactccatcagctgatcatcatgaacaccagcacagaggactcggcagaatacacatttgtctgtggcaatgaccaagtcagtgccaccctgacagtcaccccaatcatgattacttccatgctgaaagacatcaacgctgaagaaaaagacactattacttttgaggtgacagtgaactatgaaggcatctcttacaaatggttaaagaatggtgtggaaatcaaatcaactgacaagtgccagatgagaaccaaaaagctcacacactcactgaacatcaggaatgttcactttggggatgctgctgactacacctttgtggctggaaaagcaacatcaacagccacactttatgtggaagctcgtcatatagaatttaggaaacacattaaggacattaaggtactggagaagaagcgagccatgtttgaatgtgaagtttctgaacctgacatcactgtacagtggatgaaagatgaccaggaactgcagatcacagacagaataaagattcagaaggagaaatatgtccaccgccttctgatcccatccacccggatgtctgatgctgggaagtacacagtggtggcaggaggcaacgtgtcaactgcaaaactctttgtagaaggcagagatgttcgcatccgaagtattaaaaaggaggttcaggtcattgagaaacagcgtgctgttgttgaatttgaggtcaatgaagacgatgttgatgcccactggtataaagatggcattgaaatcaatttccaagttcaagaacgacacaaatatgtagtggaaagaagaatccaccgaatgtttatctctgagaccagacagagcgatgcaggagaatacacctttgtggcaggaaggaacaggagttctgtcactctctatgtcaatgctcctgaaccgccccaagttctgcaggagctccagcctgtcactgtgcagtctggcaagcctgcccgcttctgtgccgtgatatccggaagaccacagcccaaaatttcctggtacaaggaagagcagctgctttccactggcttcaagtgcaaatttcttcatgatgggcaagaatacacgcttttgctaattgaagccttcccagaggatgcggcagtctatacctgtgaagccaagaatgactatggtgttgccacaacatcagcttcactctcagtggaagttccagaagttgtgtctcctgatcaggaaatgcctgtttatccacctgccatcatcaccccgcttcaggacactgtcacttctgaagggcagccagcccgttttcaatgccgggtttctggaacagatctaaaagtgtcgtggtacagcaaagacaagaaaatcaagccatctcggttctttagaatgactcaatttgaagacacttatcaactggaaattgccgaagcttatccagaagatgaaggaacttacacgtttgttgctagtaatgctgtaggccaagtatcaagcacagccaacctgagtctggaagctcctgaatcaattttgcatgagaggattgaacaagagattgagatggaaatgaaagagttttctagttcttttctgtctgccgaggaagaaggacttcatagcgccgaacttcaattatctaaaataaatgaaacacttgaacttttgtctgaatctccagtttacccaactaaatttgattccgaaaaggaaggcactggcccaattttcatcaaagaagtgtcaaatgctgatataagcatgggggatgtggctacactgtctgtaactgtcattggcatccccaaacctaaaattcagtggttctttaatggagtgctattaaccccttctgctgactacaaatttgtttttgacggtgatgatcatagcctgatcattctgttcaccaaattggaggatgagggagagtatacatgtatggccagtaatgactatggaaagacaatatgtagtgcctatctaaaaattaattccaaaggagagggtcacaaagacactgaaacagaatcagcagtggcaaaatctctggaaaagctgggaggtccttgtcctcctcacttccttaaggagttaaaaccaattcgctgtgctcaagggcttcctgccatctttgagtacacagtggttggagagcctgcccctactgttacatggttcaaagaaaacaagcagctttgcaccagtgtttattacactatcattcataaccctaatggctctggaactttcattgtcaatgaccctcagagggaagacagtggcctctatatctgtaaagcagagaatatgttgggtgagtccacctgtgcagcagagctgcttgtgcttctggaagacacagacatgactgataccccctgcaaagcaaagtccacaccagaggctcctgaggattttccacagacacccttaaagggtcccgcagttgaagcacttgactcagagcaggaaattgcaacgtttgtaaaagacaccattttgaaagctgctttaattacagaagaaaaccagcaactatcttatgagcatattgctaaagccaatgaattgagcagtcagcttcctttgggagctcaggaattgcaatccattttggagcaagacaagctcactcctgaaagcaccagggaatttctttgcatcaatggcagtattcactttcagcctctcaaggaaccatctcccaacctacagctgcagattgtacagtcccagaaaaccttctccaaagaaggtattctaatgcctgaagagcctgagacacaggcagttctatcagataccgagaaaatcttcccaagtgccatgtccatagaacaaattaattcattaacagttgagcctctgaaaactttattagctgaacctgaagggaattatccacagtcttcaatagaacctccaatgcattcttatctaacctctgtggctgaggaagtactttcaccaaaagaaaagacagtatctgacaccaacagagagcaaagagtgactcttcaaaagcaagaggcacaaagtgcgctcatcttgagtcagagcttagctgagggacacgtggagagtctccagagtcctgatgtcatgatctctcaggtaaactatgagcccctagtcccttcagaacactcatgcacagaaggaggtaaaattttgatagaaagtgcaaatccactggaaaatgcagggcaagattctgcggtcagaattgaggaaggcaagtccttaagatttccactagcacttgaagaaaagcaggtactgctcaaagaagagcattctgacaacgtggtgatgcccccagaccaaatcattgagtctaaaagagagcccgtggcaataaagaaagtgcaggaggtacagggaagggaccttctttctaaggaaagcttgctttctggtattccagaagagcagagattaaacctgaaaattcaaatctgccgggctttgcaagcagccgtggccagcgagcagccaggtcttttctctgagtggctaagaaatattgaaaaggtggaggtcgaggctgtaaacatcacccaagagcccagacacatcatgtgcatgtaccttgttacttcggcaaagtctgtaacagaagaagtaaccatcattattgaagatgttgatcctcaaatggctaacctgaaaatggaacttagggatgctttgtgtgctattatatatgaggaaatagacatcctaacagctgagggtcctagaattcagcaaggagccaaaacaagtttgcaagaagaaatggattctttttcaggttcacagaaggttgaacccattactgaaccagaagttgaatctaaatatctgatctcaactgaagaggtcagttattttaacgtgcaaagtagggttaaatatttggatgccacacctgtcactaaaggggttgcttcagctgttgtctctgacgaaaaacaagatgagagtctgaaaccatcagaggaaaaagaggagtcttcctctgaaagtggtactgaggaggttgctacagtaaagatacaggaagctgagggtggcttaatcaaagaggatggccccatgatacatacacctttagtggacactgtttctgaggaaggtgatattgtacacctcacaacatccataacaaatgctaaagaggtgaattggtattttgagaataaactggtgccttcagatgaaaagttcaagtgtttacaagatcaaaatacatatacgctagtcatcgacaaagtaaataccgaagaccatcaaggagagtatgtctgtgaggccttgaatgacagcggaaaaacagcaacttcagccaaactcactgtagtaaaaagagctgccccagtgatcaagaggaaaatcgaacccctggaagtagcactgggccacctagccaaattcacctgtgagatccaaagtgctcccaatgtccggttccagtggtttaaagctggccgagaaatttatgagagtgacaagtgttctattcgatcttcaaagtatatctccagccttgaaatcctgagaacccaggtggttgactgcggcgagtatacatgcaaagcttccaatgagtatggcagtgtcagctgtacagccacactaactgtgacagaggcatatccaccaacctttctctccagacctaagtcccttacaacttttgtgggtaaggcagccaagttcatctgcacagtgacagggactcctgtgatagaaaccatttggcagaaagatggtgctgcactctcaccttcacctaactggaggatttccgacgcagaaaacaaacacattttagaactctcaaaccttaccattcaagatagaggagtttattcttgtaaggcttccaacaagtttggagcagacatctgccaagcagagttgatcatcattgataagccacatttcattaaagaattagagcctgtgcagtccgctatcaataagaaggtccaccttgagtgccaagtagatgaagacagaaaagtcacagttacgtggagcaaagatgggcaaaaactccccccagggaaagattataagatctgttttgaagataaaatagcaacacttgagattcctttggccaaactgaaagattcaggaacctatgtctgtacagcttcaaatgaggctggaagcagctcctgctcagccacagtcactgtcagagagccaccatccttcgtgaagaaggtggatccctcttatttaatgctcccaggtgaatcagcacgcctccattgcaagctgaaaggctcacctgtgatccaggttacttggtttaaaaataacaaagaactcagtgaaagtaacacagtccgaatgtattttgtcaattctgaggctatacttgatattacggatgtaaaagttgaagacagtgggagttactcatgtgaagcagtgaatgacgtcggcagtgatagctgcagtactgaaatagttatcaaagaacctccttctttcatcaaaactcttgagcctgcagacatagtgagaggaacaaatgctctacttcagtgtgaagtctcaggcactggaccatttgaaattagctggttcaaagacaagaaacaaattcgaagtagtaaaaaatacagattgttttctcagaagtctcttgtgtgtctggagatcttttcgtttaatagtgcagatgttggtgaatatgaatgtgttgttgctaatgaagtcggcaagtgtggctgcatggcaacccacttactcaaagaacctccaacctttgtaaagaaagtagatgatttgattgcactaggaggacaaaccgttaccctgcaagctgctgtgagagggtcagagcccatttctgtcacatggatgaaaggtcaagaggtcatcagagaagacggaaaaatcaaaatgagcttttccaatggtgttgcagtcttgataatccctgatgttcagattagttttggaggcaaatacacgtgcctggctgaaaatgaagctggaagccaaacatctgttggggaattaatagttaaagaacctgccaaaatcattgagcgagcagaactgatccaggtgacagcaggagatcccgccacactggagtacacagtggcaggcacgccagaactgaagcccaaatggtacaaagatgggagacccttggtcgccagtaaaaaataccgaataagttttaaaaacaatgttgcccagctcaaattttattcagctgagctgcacgacagtggccaatacacatttgagatttccaatgaagtgggcagcagctcctgtgagactacattcactgtattagatcgagacattgctccattttttaccaaacccttgcgcaacgtggatagtgttgttaatggtacctgcagactggactgcaaaattgcaggctccctccccatgagggtgtcctggtttaaggatggcaaagaaatagctgcttctgacagatacaggatagcatttgtggaaggcacagcctctttggagatcatcagagtagacatgaatgatgcagggaatttcacttgtcgagccacaaattccgtgggaagcaaagacagcagtggagccctgattgtgcaagaaccacccagttttgtaactaaacccggctcaaaggatgttctgcctggctcagcagtctgcctgaagagcactttccaaggatctactcctctcacaatcagatggtttaagggcaacaaagagctggtttctggtggaagctgctatattaccaaagaagctttagagagttccctggaactctatttagtaaaaacctctgattcgggcacgtacacatgtaaagtcagcaatgtcgctggaggggtggaatgcagtgcaaacttgtttgtaaaagaacctgccacatttgttgaaaagttagagccatcacagctgttaaagaagggagatgccacccagctagcctgcaaagtaactggtacccctccaattaaaataacatggtttgcaaatgatagagaaattaaggagagcagcaaacacagaatgtcttttgtggagtctactgcagttctaagactgacagatgttggcatcgaagacagtggtgaatatatgtgtgaggcccaaaatgaggctggcagtgaccactgcagtagcattgtaatagtcaaagagtcaccttattttaccaaggaatttaagccaattgaagtcttaaaggagtacgatgtcatgttgctggctgaggtggcaggcactcctccctttgagatcacttggttcaaagataacacaatcctgcgaagtggtagaaagtataagactttcattcaggatcatctggttagcctgcagatcctcaagtttgtagctgcagatgctggcgaataccagtgtcgggtgaccaatgaggtgggcagcagcatctgcagtgccagggtgactttaagagaacccccatccttcataaagaagatcgagagtaccagctccctccggggaggcacagctgccttccaggccactctgaagggctccttgccaattacggtgacttggctaaaagacagcgatgaaatcactgaagacgataatataagaatgacctttgagaacaatgtggccagtttgtacctcagtggcattgaagtcaagcatgatgggaaatatgtctgtcaggccaaaaatgatgcaggaatacaaagatgttctgcattactctcagtaaaagaacctgcaacaatcaccgaggaagctgtgtctatagatgtcacccaaggagacccagccactttgcaggttaaattttcagggactaaggagattacagccaaatggtttaaagatggccaagaactgaccctgggctcaaaatataaaatcagtgtcactgatacagtctcaatactgaagattatttctacagaaaagaaagatagtggagaatatactttcgaggtccaaaatgatgttgggaggagcagctgcaaggctagaattaatgtattagatcttatcatacctccttcattcaccaaaaagctgaagaaaatggacagcattaaaggttctttcattgatttagaatgtatagtggctgggtcacatcccataagcatccagtggttcaaagatgaccaagaaatatcagctagtgaaaagtacaaattctcttttcatgacaatactgccttcttggaaatcagccagctggaaggtacagacagtgggacatacacttgttctgccacaaataaggcagggcacaaccaatgcagtgggcatctgacagtcaaagaacccccttactttgtggaaaagccacagtcacaagatgtcaatcccaacacaagggtacagttaaaggctcttgtgggtggcactgcacccatgacaataaagtggtttaaagataacaaagagttacactcaggagcagcccgctcagtttggaaggatgacacctctaccagtctagagctctttgcagccaaagctaccgattctggaacctacatttgccaactaagcaatgatgttggcacagcaaccagcaaagccactctctttgtaaaagaacctcctcaattcattaagaagcccagtccagtcttagtgctgaggaatggacagtcaacaacatttgaatgccaaataacaggcactcctaaaatccgagtgtcttggtatctagacgggaatgaaataacagccattcagaaacatggcatttccttcattgatggtttagccactttccagatttctggtgccagggtagaaaatagtgggacttatgtgtgtgaagctcgaaatgacgcaggcacggcgagctgcagcattgaactcaaagtgaaagaaccccccacctttatcagagagctgaagcctgtggaggtagtaaaatatagtgacgtggagctggagtgtgaagttacgggaacacctccgtttgaagtcacttggctgaagaataacagggaaattcgaagcagcaaaaaatacacattgaccgacagagtgtctgtgtttaacctccatataaccaagtgtgacccttcagacactggggaataccagtgcattgtatccaatgaaggcggcagctgctcatgcagtactagagttgccctgaaagaaccaccatcattcattaagaagatagaaaataccactactgttttgaaaagttctgccacctttcagagtaccgtggcaggttctcctcctatttctataacctggctaaaggatgatcagattcttgatgaagatgataatgtctatatttcatttgtggacagtgtggccacacttcaaatcagaagtgtggataatggacacagtgggagatatacctgtcaagccaagaatgagtcaggagttgagaggtgttatgctttccttttagtacaagaaccagctcaaatcgtagagaaagctaaatcagttgatgttacggagaaagatcccatgaccttggaatgtgttgtggctggaacaccagaactcaaagtgaaatggcttaaagacgggaaacaaatagttcccagtagatacttttcaatgagttttgaaaataacgtggccagttttagaattcagtcagtaatgaagcaggacagcggtcagtacactttcaaggtggaaaatgacttcggaagcagtagctgtgatgcctacttaagagtgctagatcaaaatattcctccatcattcaccaaaaaattaaccaaaatggataaagttctgggctcttctattcatatggagtgcaaggtgtctggttcacttcccattagtgctcagtggtttaaggatggaaaagaaatatctacaagtgcaaaatacagacttgtgtgccatgagagatctgtgtctctggaagttaataatctggaattagaagatactgcaaattacacatgcaaagtgtcaaatgtagcaggagatgatgcatgcagtggcatcttaactgtgaaagaaccaccaagcttcctagtgaaacctgggcgacagcaagccatacctgattctacagtggaatttaaggcaatactaaaaggaacaccaccatttaaaataaaatggtttaaggatgatgtggaacttgtctcaggtcctaaatgtttcattggcttggaagggtcgactagcttcttaaatctctactcagtggatgcttctaagactggacagtatacttgccatgttaccaatgatgttggtagcgactcttgtactacgatgttgcttgtgacagaaccaccaaagtttgtaaagaaattagaagcctccaaaattgtgaaagcaggtgactcttcacgacttgaatgcaagatagctggatccccagaaatcagagttgtgtggttccgaaatgaacatgaacttccagccagtgataagtacagaatgactttcattgactcagtggccgtcatacagatgaacaatctcagtactgaggacagtggagatttcatttgtgaggctcagaatcccgctggcagcacaagctgcagtaccaaggttatagtaaaagagccacctgtttttagcagcttccctcctatagtagaaacccttaaaaatgctgaagtcagtcttgaatgtgaactttcgggaacaccaccgtttgaggtggtatggtacaaagacaagcggcaactcagaagcagcaagaaatacaagattgcatccaaaaacttccacacaagtattcacattctcaatgtggacacttcagacatcggtgaataccactgcaaagcacagaatgaagtgggaagtgatacttgtgtttgtactgtaaaattgaaagaaccaccaagatttgtctccaaactgaacagcctcactgttgtagccggagagcctgctgaattacaagcatccatagaaggcgcccagcctatttttgtccagtggcttaaagagaaggaagaagtgattagagaaagtgaaaacatcaggattacatttgtggaaaatgttgcaactctacagtttgcaaaagcagagccagctaatgctggaaagtatatctgccaaatcaagaatgatggtggaatgagggagaacatggccacactgatggtcttagagcccgcagtcattgttgagaaggcaggaccgatgacggtgactgtaggagaaacgtgcactctggagtgtaaggtggctggcactccggaactctctgttgaatggtacaaggatggaaagctgttgaccagcagccaaaaacacaaatttagcttctacaacaaaatctcttccttaaggattctctcagttgaaaggcaagatgcaggcacatacactttccaggttcaaaataatgttgggaaaagcagctgcacagctgtggttgatgtttcagaccgagcagttcctccctctttcacacgaagactgaaaaatactggtggggtgttaggtgcttcttgcatcttggaatgcaaagtagctggatcatcacctatttcagttgcctggtttcatgagaaaaccaagattgtcagtggagcaaagtaccaaaccacattttcagataatgtctgcacattgcagttgaattctctggattcctcagatatgggcaattacacatgcgtggctgctaatgtcgctgggtctgatgaatgtcgtgcagtgctaactgtacaagaaccaccctcttttgtgaaagaacctgaacctttggaagtactaccaggcaaaaatgtaaccttcacaagcgttattagaggaacccctccattcaaagtcaactggttcagaggtgccagagaactagtgaaaggagaccggtgcaacatctattttgaagacactgtggcagaactggaattatttaatattgacatatctcagagtggggaatacacctgtgtggtttctaacaacgctggccaagcatcttgcactacccgtctctttgtgaaagaaccagctgcatttttgaagagattaagtgatcattctgtagaaccagggaagtccataattctggagagcacctacactggaacacttccaatttctgtcacttggaaaaaggatggttttaacataactacctctgaaaaatgtaacatagtcacaacagagaaaacttgtatcctggaaattctgaatagcacaaaaagagatgcagggcagtattcctgcgagattgaaaatgaggcaggaagggatgtttgtggagctctggtatctacattagaaccgccttattttgttacggaactggaacctctggaggcagcagttggagattcggtttctttacaatgccaagttgctgggacaccagaaattacagtgtcttggtacaaaggagataccaaattacggccaactcctgaatacaggacctactttacaaacaatgtggccacacttgtttttaataaagtgaacatcaatgacagtggagagtacacatgcaaagcagaaaatagtataggaactgcttcttctaagactgtgttcagaattcaagagcgccaactcccaccttcttttgcaagacaattaaaggacattgaacaaactgtggggttacctgttacactcacttgtcgattaaatggctctgcacccatccaagtgtgctggtatagagatggagtacttttaagagacgatgaaaatctacagacttcatttgtagataatgtggcaactttaaaaattttgcaaactgacttgagtcactctggccagtactcttgctcagcttccaacccacttggaacagcatcttctagtgctagactcacagcaagagaacccaagaaatctcccttctttgacatcaagcctgtatctatagatgttattgctggagaaagtgctgattttgagtgtcatgttactggtgctcaaccgatgcgaatcacttggtcaaaagataacaaggagatccgtcctggaggaaactatacaatcacatgtgtgggaaacactcctcatttgagaattcttaaagtaggcaaaggagactctggtcaatatacttgccaagcaaccaatgatgttggcaaagacatgtgctcagctcagctcagtgtaaaagaacctccaaagtttgttaagaaattagaagcttcaaaagttgcaaagcagggagaatccattcaactggaatgtaaaataagtggctccccagaaatcaaagtttcatggttccgaaatgacagcgaacttcatgaaagttggaaatacaacatgtcattcattaattctgtggcattgcttacgatcaatgaagctagtgctgaagacagcggggactacatttgtgaggctcataatggtgttggtgacgccagctgcagcacagcgttgacagtgaaagcacctcctgttttcacccagaagccttctccagtaggagctcttaaaggttctgatgtgattctccaatgtgaaatttcgggaactcccccatttgaagtagtatgggttaaagatcgaaagcaggttagaaacagcaagaaatttaaaatcacttcaaaacattttgatacaagtcttcatatccttaatcttgaagcctccgatgtcggggaatatcactgcaaagctactaatgaggtgggaagtgacacgtgttcttgctctgtcaagttcaaagaacctccacgattcgtgaaaaagctaagtgacacctcaacccttattggggatgctgttgagttacgggccatagtggagggcttccagccaatttctgttgtctggctgaaagatagaggtgaagtcatcagagagagtgaaaataccaggatttcattcattgataacattgcaaccctccagctggggagtccagaagcatctaattctggaaaatatatatgccaaatcaaaaacgatgctggaatgagagaatgctctgcagtcttgactgtactagaaccagcaagaatcatagagaagcccgaacccatgactgtcactactggaaatccttttgcattagagtgtgtagtgactggaacaccagaactctcagccaagtggttcaaagatggaagagaattgtctgcagacagcaaacatcacattacattcatcaataaagtggcttcccttaaaatcccctgtgccgaaatgagtgacaaaggattatatagctttgaagtgaaaaacagtgttggcaaaagtaactgcactgtatccgtccatgtttctgatcggattgtgcctccttccttcatccgcaagctgaaagacgtgaatgccatcctgggggcctcagttgttttggagtgccgagtctctggctcagccccgatttcagttggctggtttcaggatggaaatgagattgttagtgggcccaaatgtcagtccagcttttcggaaaacgtctgtactttgaatctgagcttgttggagccctccgacacaggcatatacacgtgtgtggctgccaatgtagctggttccgatgagtgctcagcagtcctgactgtgcaagaaccaccatcttttgaacaaacccctgattctgtggaagttttgcctggaatgagcctcacattcaccagtgtcatcagaggcacccctcctttcaaggtcaagtggtttaaaggcagcagggaactggtgcctggggagtcatgcaacatctctctggaagattttgtcacagaactggagttgtttgaggtgcagccattagaaagtggagactattcttgcctcgttacaaatgatgctggcagtgcttcctgtaccacacatctttttgtgaaagaaccagccacctttgtgaaaagattggctgatttcagtgttgagacaggaagccccatagttctcgaggccacatacactggcacacctccaatctcagtgagctggataaaggacgagtatcttatttcacaatctgagagatgcagtattactatgacagaaaaatctaccatactggaaattcttgagagcacaatagaggattatgcacagtacagctgcctgatagaaaatgaggctggtcaagatatctgtgaagctctggtgtctgtcttagaaccaccgtactttattgaacctctggaacatgtggaagcagtcattggagaacctgcaactttacagtgtaaagtggatggaactccagaaattagaatttcttggtataaagaacacacaaagctacgatcagctcctgcatataaaatgcaattcaaaaataacgttgcttccttagtaatcaacaaagtggatcacagtgatgtgggagagtattcatgcaaggcagacaacagtgtgggggcagtcgcttcttcagctgtgcttgttatcaaagcgcgcaaacttccacctttctttgcaagaaaactgaaagacgttcatgagactctaggcttcccagttgcatttgaatgccgcatcaatggctcagaacctcttcaagtgtcttggtacaaggatggggttcttttgaaagatgatgctaatttgcagacatcttttgttcataatgtagcaactcttcagattttacaaactgaccagagccacatagggcagtataattgctctgcttctaatcctcttgggactgcttcatccagtgccaagctcattctctcagagcatgaagtgcctcctttctttgatctaaagcctgtatcagtagatcttgctcttggagaaagtggtacttttaaatgtcatgtaactgggactgcaccaatcaaaatcacttgggccaaagataaccgagagattcgccctggaggcaactacaagatgactttggtagaaaatactgccactctgacagttctcaaagtaggcaaaggcgatgccgggcagtacacctgctatgcaagcaacatcgctggaaaagactcttgttctgctcagctgggtgtacaagaaccacccaggttcattaagaagctagaaccttcaagaattgtgaaacaggatgaattcacaaggtatgaatgcaaaatcggtgggtctccagaaatcaaagttttatggtataaggacgagactgaaattcaagagagcagtaaattcagaatgtcattcgttgactcggtggctgtgctggaaatgcacaatctcagtgttgaagacagtggagactacacctgtgaggcccacaatgcagcaggcagtgccagcagcagcacatccttaaaagttaaagaaccacccattttccgcaaaaagcctcatcctatagagacactgaaaggagctgatgttcaccttgaatgtgagcttcagggcactcccccatttcacgtttcttggtataaagacaagagagaacttaggagcggcaagaagtacaagataatgtctgagaacttcctaaccagtatccacatcctgaatgtcgatgctgcagacattggggaatatcagtgtaaagccacaaatgatgtgggaagcgacacttgcgttggttccatcgctctcaaagcaccaccaagatttgtgaagaagctcagtgacatatctactgtcgttggtaaagaagttcagctgcagactaccattgaaggcgctgaacccatttcagtggtgtggttcaaagataagggagaaatcgttagagaaagtgacaacatatggatttcttattcagaaaacattgcaaccttacagttttcaagagtggaaccagccaatgctggaaaatacacttgtcagatcaaaaacgatgctgggatgcaagagtgcttcgccacgctatccgttctcgagcctgcaacaattgtagaaaagccagaatccataaaagttaccacgggagacacctgtaccttggagtgtacagtagctggcacccctgaactcagtactaagtggtttaaggatggaaaagagctaacaagtgacaacaaatacaaaataagcttcttcaacaaagtatccggccttaagatcatcaatgtagcaccgagtgacagtggggtatacagttttgaggtgcagaaccctgttggcaaagacagctgcacagcttcattgcaggtttcagaccgaaccgttcctccttcattcacaagaaaattgaaagagacaaatggtctatccggctcctcagttgtaatggagtgtaaagtctatgggtcacctccaatctctgtctcctggttccatgaaggaaatgagatcagtagtggaaggaaataccagaccaccctgacagataatacttgtgctttaactgtgaacatgctggaagaatcagacagtggtgactacacatgtatagctactaatatggctggttctgatgaatgtagtgctcctttgactgtgagagaaccaccatcttttgttcagaaacctgatcccatggatgttttaactgggaccaatgtaactttcacaagtatcgtaaaaggaacacctcctttcagtgttagctggttcaaaggtagcagtgaactagtaccaggtgacagatgcaacgtgtctttggaggattcagttgctgaactggagttgttcgatgtagatacatcacaaagtggagaatatacttgcatagttagcaatgaagctggcaaggcttcttgtacaacacatctctacataaaagccccagccaaatttgtgaagaggctgaatgattacagcatagagaaaggaaaacccctgatcctagagggtacattcactggaactcctcccatttcggttacctggaagaaaaatggcataaatgtaactccttctcagaggtgtaatataactacgactgaaaaatcggcaatcctggaaattccaagtagcacagtagaggatgcaggacaatacaactgctacattgaaaatgcctctggaaaagattcctgttcagcacaaatactcatactagaaccaccgtattttgtcaagcagttggagccggttaaggtgtctgttggagattctgcctctctacaatgccagcttgctggaacccctgaaattggggtatcctggtataaaggagatacaaaattgagacccactacgacttacaaaatgcattttaggaataatgttgctacactggttttcaaccaggttgatattaatgatagtggagaatatatctgcaaagctgaaaacagcgtgggagaagtttctgcatcaactttccttaccgttcaagagcaaaaacttccaccatcattttctcgacaattgagagatgttcaagaaacagttggactgccagttgtttttgattgtgccataagtggatcagaacctatctccgtgtcttggtataaagacggcaagccattgaaagacagcccaaatgtacaaacatcatttttagacaatacagccacactcaatatttttaaaactgaccggagccttgcaggccagtattcctgcacagctacaaaccctataggctctgcttcttccagtgccaggctcattctcacagaggggaagaacccacccttctttgacatccgtcttgcccctgtggatgctgtggtgggagaaagtgctgactttgagtgccacgtcacgggcacacaaccgataaaggtcagctgggccaaagacagcagagaaatacgaagtggcggaaagtaccagattagttatctggaaaacagcgcccacctgacagtcctcaaagtagacaaaggagattctggacaatatacctgctatgctgtgaatgaagtgggaaaagactcttgcacagctcagctgaatataaaagagcggctcatcccaccaagtttcactaaaagactctcagagacagtagaagaaacagaagggaattctttcaaacttgagggacgtgtggctggttcccaacctataactgttgcctggtacaaaaataatatagagatacaaccaacttctaactgtgaaataacattcaagaacaacacgttagtgctgcaagtcaggaaagcaggcatgaacgacgctggtttgtacacatgcaaagtgtccaatgatgcaggctctgctctgtgcacgtcttcaatcgtcatcaaagaacctaagaagccacctgtatttgatcagcaccttactccagtaacagtgagtgaaggagaatacgtgcagctcagctgccatgtccagggatctgagccaattaggatccagtggttgaaggctggcagggaaataaagccttcagacagatgcagcttcagctttgctagtgggacagctgtactggaactcagagatgtggctaaagcagattcgggagattatgtgtgtaaagcttcaaatgtggctggaagtgacactaccaaatcaaaagtgaccattaaagacaaaccagctgtggccccagcaaccaagaaagctgcggtagatggaagactcttttttgtgtcagaacctcagagtatcagagtcgtagaaaaaaccactgcgaccttcattgcaaaagttggaggtgacccaatcccaaatgttaaatggacaaaagggaagtggagacagctgaaccaaggaggtcgtgttttcatccaccaaaaaggcgatgaagcaaaactggagattagggacaccacaaaaactgattctgggttataccgatgcgtggcatttaacgaacatggtgaaattgaaagtaatgttaacttacaggtggatgaaaggaagaaacaagagaaaattgaaggcgatcttagagcaatgctgaaaaagactccaatcttaaagaaaggagctggagaagaagaggaaattgatatcatggaacttctcaaaaatgttgatcctaaagaatatgaaaaatatgcccgcatgtatggaatcactgacttccgaggtcttcttcaagcatttgaactgctcaagcaaagccaagaagaagagacacatagactggaaattgaggaaatagagaggtcagagagggacgaaaaggaatttgaggaacttgtatcatttattcagcaaagactgtcacagacagagcctgtcactctgatcaaggacattgaaaatcagacagttttgaaagataatgatgctgtctttgaaattgacattaaaattaattatccagaaatcaagctttcgtggtacaaaggaactgaaaaactggaacccagtgataaatttgaaataagcattgatggtgaccgacatacactcagagtcaaaaactgtcaacttaaagaccagggcaattatcgattggtttgtggtccacacatcgctagcgctaaactaactgtaattgagcctgcatgggaacggcatcttcaggatgtgactctgaaagaaggccagacttgcaccatgacatgccaattttctgtaccaaatgtaaaatctgaatggttcagaaatggcagaatccttaaaccccaaggtagacataaaacagaagtggaacacaaagtccataaattgaccattgcagatgttcgagcagaagaccagggtcagtacacctgcaaatatgaagaccttgaaacttcagcagaactcagaatcgaagctgaaccaattcagtttacaaagcgcatacagaacatcgtggtgagtgagcatcagtctgccacctttgagtgtgaagtgtcctttgatgatgccattgtaacatggtacaaaggaccaacagaactgacagagagccagaaatacaacttcaggaatgatggccgctgccattatatgaccatccacaatgtgaccccagacgatgaaggtgtctactcggtcatcgctcggctggagccaagaggtgaagcaagaagcacggcagagctgtacctaacgacgaaagaaatcaaacttgagctgaagcctcctgatattcctgactccagagttccaatcccaaccatgcctatcagagcagtgccaccagaagaaatccctcctgtggttgctcctcctatcccccttttgctaccaacacccgaagaaaagaaaccaccaccaaaacgtattgaagttaccaaaaaggctgtgaagaaagatgccaaaaaagttgttgcaaagcccaaagagatgacaccacgtgaagagattgtcaagaagcctccacctcctactaccttaattccagcaaaagctcctgaaatcattgatgtatcctctaaagctgaagaagtaaaaataatgactataaccagaaagaaagaggttcagaaagaaaaagaagctgtgtatgagaaaaagcaagcagtccacaaggagaagagagtcttcattgaatctttcgaagaaccttatgacgaactggaggtagaaccatacacagagccatttgaacaaccttattatgaagaaccagatgaagactatgaagagattaaggtagaagctaaaaaagaagttcacgaggaatgggaagaagattttgaagaagggcaagaatactatgaaagggaagaaggctatgacgaaggggaggaagagtgggaagaggcttaccaagaaagggaagtaattcaagttcaaaaggaggtctatgaagaatcacatgagagaaaagttccagccaaagtacctgaaaagaaagcaccaccacctcctaaagttataaagaagccagtaattgaaaaaattgaaaagacttctcgaagaatggaggaagaaaaagttcaagtcaccaaagtacctgaagtttcaaagaagattgttccacaaaaaccttcccggactccagtacaggaagaagttattgaagtgaaagtaccagctgtgcatacaaagaagatggttatttcagaagaaaagatgttctttgcttctcacacagaggaggaggtgtcagtcacagtccccgaggtacaaaaggaaattgttactgaagagaaaattcacgttgccatttccaaaagggttgaaccaccacctaaagtccctgagctacctgagaaaccagctccagaagaagtggcccctgttcctatccctaaaaaagtggagcccccagcaccaaaagttcctgaggttcccaagaaacccgtgccagaggagaaaaagccagttcctgtgcctaagaaggaacctgctgctcccccaaaagtcccagaggtgccaaagaaacctgtccctgaagaaaagattcccgttcctgttgcaaagaaaaaggaagctcccccagctaaagttcctgaagtacagaagggagttgtgacagaagaaaaaataaccattgtaactcaaagagaggaatctccaccaccagcagtgccagaaataccaaagaagaaagttcctgaagaaaggaaacctgttcctcggaaggaggaagaagttccaccaccaccaaaagtgccagctctgcctaagaaacccgtcccagaggagaaagttgcagtgccagttcctgtcgctaagaaagctcctcctccccgagctgaagtctctaagaaaactgttgtagaagaaaagagatttgttgctgaagaaaaactatccttcgcagttcctcaaagagtggaagtcacgcggcacgaagtatctgcagaggaggaatggagttactcagaagaggaggaaggtgtgtccatttcagtttatagagaagaagaaagagaggaggaggaagaagcagaggttacagaatatgaagtgatggaagagcctgaggaatatgttgtggaagaaaagctgcacattatttctaagagagtggaagctgagccagctgaagtgacagagaggcaggagaagaaaattgtactgaaaccaaaaattcctgctaaaatagaggagcctccaccggctaaagttcctgaagcacctaagaaaattgtgccagaaaagaaagttcctgctccagttcctaaaaaggaaaaggtgcccccacctaaagtgccagaagagccaaagaaaccagttccagaaaaaaaggttcctccaaaagtcattaagatggaagaacctctcccagccaaagtgactgagaggcacatgcaaattacccaggaagaaaaagttcttgttgctgtaactaaaaaagaggcgcctccaaaagcaagagtgccagaggaaccgaagagagctgtcccagaagaaaaagttctgaaactcaaacctaaaagagaggaggaaccaccagctaaagtgactgaattcagaaaaagagtggttaaagaagaaaaagtatcaattgaagctccaaaaagagaacctcaacccatcaaagaagtaactataatggaagagaaagaaagggcttataccctagaagaagaagctgtttcagtacaacgggaagaagaatatgaggaatatgaagaatatgattataaagaatttgaggagtatgaaccaacagaagaatatgaccaatatgaagaatacgaggagcgggagtatgaacgatatgaagagcatgaagaatacatcacagaaccagagaagcctatccctgtaaagcctgtcccagaagaaccagttcccacaaaaccaaaggccccaccggctaaagtgctgaagaaagctgtccctgaagaaaaagtaccagtgcccattcctaagaaactcaaacctccaccacccaaagtgcctgaagaaccaaagaaagtttttgaggaaaaaatacgtatttcaattaccaaacgtgaaaaagagcaggtgactgaacccgctgctaaagtgcccatgaagcccaagagggttgtcgcagaagaaaaagtacctgtccctagaaaagaagtagcaccacctgttagagtgccagaagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaacccatgtagaagaatatcttgtagaagaagaagaagagtacattcatgaagaagaggagttcataactgaggaagaagtggtgccagtgataccagtcaaagtgcctgaggtacccaggaaacctgttccagaagagaagaaacctgttcctgttcccaagaagaaggaagctccaccggcaaaagtgcctgaggttcctaagaagccagaggagaaagttcctgtgcttattcctaaaaaggagaagcctccgccagcaaaagttcctgaagtgcccaagaaacctgtgccagaggagaaagtaccagtaccagttcctaaaaaggtggaagctccacctgccaaagtgccagaggtacccaagaagcctgtgcctgagaagaaggtgccagttcctgctcctaagaaagtggaggctccacctgcaaaagtgccagaggtgcccaagaagctcatcccagaagaaaagaaaccaacacctgttccgaaaaaagtggaagcaccaccacccaaagtgccaaagaaacgtgaaccagttccagttcctgtagctctacctcaggaagaggaagttctatttgaagaagaaattgttcctgaagaggaagttctacctgaggaagaggaagttctacctgaggaagaggaagttctacctgaagaagaggaagttctacctgaagaagaggaaattccacctgaggaagaggaagttcctcccgaagaagaatatgtacctgaggaagaagaatttgtacctgaagaagaagtccttccagaagttaaacctaaggtgccagtacctgcaccagtgcctgaaattaagaagaaagtgacagagaagaaagtggtcattcccaagaaagaggaggctccccctgccaaagttcctgaggtgcctaagaaggtggaagaaaaacgaatcattctccctaaagaagaggaagttctaccagttgaagtgactgaggagcctgaagaagagcctatttcagaagaagaaatcccagaagaaccacctagcatagaggaagttgaagaggtggcaccacctagagtgcctgaagtgattaagaaagcagtacctgaagcacctactcctgttcctaaaaaagtggaggcaccaccagctaaagtgtcaaagaaaattcctgaggaaaaagtacctgttcctgttcagaaaaaagaggcacccccagccaaagtgcctgaagtaccaaagaaagtcccagaaaagaaagtccttgtgcctaaaaaggaagctgttcccccagctaaagggagaactgtccttgaagaaaaagtatcagttgccttccgccaagaagtagtagtaaaagaaagactagaattagaagtagtagaagcagaagtggaagaaattccggaagaagaagagttccatgaagttgaagaatattttgaagaaggcgagtttcatgaagtagaagaattcatcaaattagaacaacatagagttgaagaagaacacagagttgaaaaagttcatagggtaatagaagtttttgaggctgaagaagtggaagtatttgaaaaaccaaaagctccacctaaagggcctgagatatctgagaaaatcatccctccaaaaaaaccgcccactaaagttgttcctcgaaaagagccaccagctaaagtaccggaggtgcctaagaaaattgtggtagaagaaaaagtacgtgttcctgaagagcccagagttccaccaactaaagtgcctgaagtgctgccaccgaaggaagtggtcccagaaaagaaagtaccggtgcctcctgccaaaaagccagaagctccacctcctaaagtgcctgaggctcccaaagaagttgttcctgaaaagaaagtgccagtgcctcctcctaaaaagcctgaagtgccacccacaaaagtcccagaggtgccaaaggcagctgtcccagaaaagaaggtgcctgaagctattcctcccaaaccggaaagtcctccccctgaagtgccagaggctccgaaagaagttgttcctgaaaagaaagtgccagcggctcctcctaaaaagcctgaagtcacacctgttaaagtgcctgaggctcccaaagaagttgttcctgaaaagaaagtgccagtgcctcctcctaaaaagcctgaagtgccacccacaaaagtcccagaggtgccaaaggtagctgtcccagaaaagaaggtgcctgaagctattcctcccaaaccggaaagtcctccccctgaagtgttcgaggagcctgaggaagttgccctagaagagcctcctgctgaagttgtggaagagccagagccagcggcgcctccacaagtgaccgtaccacctaagaaacctgtcccagaaaagaaagcacctgctgtcgttgccaaaaaacctgaactaccaccagtgaaagtgcccgaggtgcccaaggaggttgttcctgaaaagaaggtgcctctggtggttcccaaaaagccagaagccccacctgctaaagtgcctgaagttccaaaagaagttgttccagaaaagaaagtagctgttcccaaaaagccagaagtcccaccagcaaaagtgccagaagtgccaaagaaacctgtcttggaagagaaaccagctgttcctgttccagaaagagcggagtctcctcccccagaagtatatgaagaacctgaggaaattgctcctgaagaggaaattgctcctgaagaggaaaagccagttcctgttgcagaagaggaggaaccagaggttccacctccagcagtgcctgaagagcccaagaagatcatcccagagaagaaagttcctgtcatcaaaaaaccagaagcaccgcctcctaaagaacctgaacctgaaaaggttattgagaagccaaaactcaaaccaagacccccacctcctccacctgctccacctaaggaagatgtgaaggagaaaatattccaacttaaagctattccaaagaagaaagttcctgaaaaacctcaggttccagaaaaagtggagcttacacctctgaaagtgcctggaggtgaaaagaaagttcgcaaattacttccggaacgtaaacctgaaccaaaggaagaagttgttctgaaaagcgttctaagaaaaagacctgaagaagaagaacctaaagtagaacctaaaaaactagaaaaagttaaaaaacctgcagtaccagaaccaccacctccaaaacctgttgaagaggttgaagtacctactgttacaaaaagggaaaggaagattcctgaaccaacaaaagtgcctgaaatcaagccagcaatacctctccctgcacctgaaccgaaaccaaagcccgaagcagaagtgaaaacaatcaaaccacctcctgtggaacctgaaccaacccccatcgctgccccagtaacagtgccagtggttggaaagaaagcagaagccaaagcacctaaggaagaggctgccaagccaaaaggtcctatcaaaggtgtacccaaaaagactccttcaccaatagaagccgaaaggagaaagttaaggccaggaagtggtggagagaaacctcctgatgaagccccgttcacctaccagctaaaggctgtgccactgaagtttgtgaaagaaatcaaagacatcatcttgacagaatcagagttcgttggctcttcagcaatctttgaatgtttggtctccccttccactgcaattacaacctggatgaaagacggtagcaatatccgtgagagtcccaagcacaggtttattgcagatggtaaagacagaaagctgcacatcattgatgttcaactttccgatgctggtgaatacacctgtgttttacgtttgggaaacaaagaaaagacctccacggctaaacttgttgtagaagaacttcctgtgcgttttgtaaaaacactggaagaggaagtcacagtggtcaaaggacagccattgtacttgagctgcgagttaaacaaagagcgtgacgtggtctggaggaaggatggcaagattgtggtggagaaacctggccgaattgtgccaggcgtcattggcttgatgcgggctctgaccatcaacgatgcagatgacacagatgctggaacatacacagttactgtggaaaacgccaacaacctggagtgttcatcttgcgtaaaagtagtagaagtcattagagattggctggtgaaacctatacgagaccagcatgtgaaacccaaggggacagctatttttgcctgtgatatagcaaaagatactccaaacattaagtggttcaaaggatatgatgaaatccctgcggaaccaaatgataagactgaaatactgagagatggaaatcatctgtacctcaaaattaagaatgctatgccagaagatattgctgagtatgcagtggaaattgaaggaaaaagataccctgcaaagctgacacttggagagcgtgaagttgaactgcttaaaccaatagaggacgttaccatttatgagaaagaaagtgcaagctttgatgcagaaatctcagaggcagacattcctggacaatggaaactgaaaggagaacttctaaggccctcacctacttgtgaaatcaaagcagaaggtggaaaacgcttcttaactttgcacaaagtcaaactggaccaagctggtgaagtcctctaccaggcccttaatgcaattacaactgccattttgacagtaaaagaaatcgaacttgactttgctgtgcccctgaaggatgtcactgttccagaaaggcgacaggctcgattcgaatgtgtcctcacccgagaggcaaatgttatatggtccaaaggacctgatataattaagtcatctgacaaatttgatatcatcgctgatggaaagaaacatattcttgttattaatgattctcaatttgatgatgaaggggtctatactgctgaggtggagggcaagaagacctcagctcggttgtttgtcacaggtataagactgaaattcatgtcacctcttgaagatcaaacagtaaaagaaggtgaaacagcaacttttgtttgtgaactttctcatgaaaaaatgcatgtagtctggttcaaaaatgatgccaaactccatacaagcagaacagtactcatctcttctgagggcaagactcacaaattggaaatgaaagaagtgacattggatgatatatctcagataaaagctcaagtcaaggagctgagctccacagcacagctgaaggtcttagaggccgatccctacttcactgtgaaattacatgacaaaactgcagtggagaaggatgagattactttgaagtgtgaagtgagcaaagatgtaccagtgaaatggttcaaagatggtgaagagattgtcccttcacccaaatattctatcaaggcagatggcctgcgccgcatcttaaaaatcaaaaaggcggaccttaaagataaaggcgaatatgtgtgtgactgtggcacagacaagaccaaggcaaatgttactgttgaggctcgactaataaaagtggaaaagcctctgtacggagtagaggtgtttgttggtgaaacagcccactttgaaattgaactttctgaacctgatgttcacggccagtggaagctgaaaggacagcctttgacagcttcccctgactgtgaaatcattgaggatggaaagaagcatattctgatccttcataactgtcagctgggtatgacaggagaggtttccttccaggctgctaatgccaaatctgcagccaatctgaaagtgaaagaattgcctcttatcttcatcacacctctcagtgatgttaaagtcttcgagaaagatgaggctaagtttgagtgtgaagtatccagggagcccaaaacattccgttggctaaaaggaacccaggaaatcacaggtgatgacagatttgagcttataaaggatggcactaagcattcaatggtgatcaagtcagctgcttttgaagatgaagcaaaatacatgtttgaagctgaagataagcacacaagtggcaaactgatcattgaaggaatccggctcaaattcctcacccctctcaaagatgtaactgccaaagagaaggaaagtgctgtatttactgtggagttatctcatgataacatccgagttaaatggttcaagaatgaccagcgcctacacaccaccaggtcggtctcaatgcaagacgaagggaaaactcattcgatcacattcaaagacctgtctattgatgacacctcccaaattagagtagaagctatggggatgagttcagaagctaaactcactgtgcttgagggagacccatattttacaggaaaacttcaagattatactggtgtagagaaagatgaagttattctacagtgtgaaattagcaaagcagatgcaccagtgaaatggtttaaggatgggaaggaaataaagccatccaaaaatgctgttattaaggcagatggcaagaaacgcatgctaatcctaaagaaagccttgaaatcagatattggacagtacacctgtgactgtgggacagataagacctcaggaaaacttgacattgaggatcgggaaattaaactggtgcgacccctgcacagtgtggaggtgatggagactgagacagcacgctttgaaaccgaaatctctgaagatgatatccacgccaactggaaactcaagggagaggccctactccaaacacctgattgtgaaattaaggaagaaggcaaaatacactcccttgttttgcacaactgtcgcctggaccagacgggtggggtggatttccaagctgccaatgttaaatctagtgcccacctccgagttaagccacgagtaattggtcttctgaggcctttaaaggatgtcaccgtgactgcaggggaaacagccaccttcgactgcgagctctcctacgaagatatcccagtggaatggtatctcaaagggaagaaactagagcccagcgataaggtggtcccacgttcagaaggaaaagttcatacacttactctgagggatgtaaagttagaagatgctggggaagtccaactaacagcaaaagatttcaaaactcacgccaacctctttgtgaaagaacccccagttgaattcactaagcctcttgaggaccagacggtcgaagagggagccactgcagtgctggagtgtgaagtctccagagaaaatgctaaggtgaaatggttcaaaaatgggacagaaatcctcaaaagcaagaagtatgaaattgttgctgatggcagggtcagaaaacttgttatacatgactgtaccccagaggatattaaaacatacacttgtgatgctaaggattttaagacttcctgtaacctgaatgtcgtgcctcctcatgtggaattcttaagaccactcaccgaccttcaagttagagaaaaagaaatggctcgatttgagtgtgaactttcccgagaaaatgctaaggttaagtggtttaaagatggtgctgaaattaaaaagggcaaaaaatatgacatcatatccaagggagcagtgcgcattcttgtcatcaacaaatgtctactggatgatgaagctgaatattcctgtgaagtaaggacagcgagaacttctggcatgctgacagttctggaagaagaagctgtctttaccaaaaatcttgccaacattgaagttagtgaaacagacactataaaactggtttgtgaagtctccaaacctggcgcagaagtgatttggtataaaggggatgaggagatcattgaaacaggaagatatgaaatactgactgaaggacggaagagaatcctggtcattcagaacgctcaccttgaggatgctggcaactacaactgtcgactcccaagctctcgaaccgatggcaaagtcaaagtacatgaactggctgctgaatttatctcaaagcctcaaaaccttgaaatacttgaaggagaaaaggctgaatttgtctgctctatatcaaaagaaagctttccagtccagtggaagagggatgataagacacttgaatctggagataaatatgacgttattgctgatggtaaaaagagggtcctagttgtgaaagatgccacattacaagatatgggcacttacgttgtcatggtaggggccgccagagcagcagctcacttgacagtcattgaaaaactcaggatcgtagttcctcttaaggacacccgggtgaaggaacaacaggaagttgtcttcaactgtgaagtcaatactgaaggtgccaaagccaaatggttcagaaatgaagaagctatatttgatagttcaaaatacatcattctccaaaaagacctagtctacaccctcagaattagagatgcacacttagatgaccaagccaactataatgtgtctttgaccaatcacagaggtgaaaatgttaaaagtgcagccaatctaatagtagaagaggaagaccttaggattgttgagcctcttaaagatattgaaacaatggagaagaaatctgtcacattctggtgcaaggtgaatcgtctcaatgtaacactgaagtggaccaaaaatggtgaagaagtgccttttgacaaccgtgtctcatacagagttgataagtacaagcacatgttaaccattaaagactgtggcttcccagatgaaggtgaatacattgtcactgctggacaagataaatctgttgctgagcttctcatcatagaagccccgacagaatttgtggaacacttggaagatcagacagtcactgagttcgatgacgctgtcttctcctgccagctctccagagagaaagccaatgtaaaatggtacagaaatgggagagaaatcaaagaaggcaaaaaatacaaatttgaaaaagatggaagtatacacagactcattataaaagattgcaggctggatgatgagtgtgaatatgcttgcggggtagaagacaggaagtctcgtgctagactttttgtggaagaaattcctgttgagatcatcaggcctccacaagatattcttgaagcccctggtgctgatgttgtctttttagcagaactcaataaagataaggtggaagtccaatggctaagaaataacatggttgttgtccagggtgataaacaccagatgatgagtgaaggaaagatacatcgactacagatttgtgatattaagccccgtgaccagggtgaatacagatttattgccaaagacaaagaagccagagctaagcttgaactggcagctgcaccaaaaatcaagacagctgaccaagaccttgtggttgatgttggcaagcctctgacaatggtggtgccatatgatgcctaccccaaagcagaagctgaatggtttaaagaaaatgaacctttatctacaaaaaccattgatactacggctgaacaaacttctttcagaattttagaagccaagaaaggagacaaagggaggtataaaattgtgcttcagaacaaacatggaaaagcagaaggattcatcaatttaaaagttattgatgttcctgggccagtacgtaacttagaagtgacagaaacatttgatggtgaagtgagccttgcttgggaagaacctttaactgatggtggaagcaaaatcataggttacgttgttgaaagacgtgacattaagagaaagacctgggttctggccacagaccgtgcagagagttgtgagtttactgtcactggtctacagaaaggaggagttgagtacctattccgtgtgagtgcaagaaacagagttggcactggtgagccagtagaaactgacaatcctgtagaagcaaggagtaaatatgatgttccaggccctcctttgaatgtaaccatcactgatgtgaatcgatttggtgtctcactgacatgggaaccaccagagtatgatggaggtgctgagatcacaaactacgtcattgaattaagagacaagacttctatcaggtgggatactgccatgactgtgagagctgaagacctgtctgcaactgttactgatgtggtagaaggacaggagtacagtttccgagtgagagcccaaaatcgaattggagttggaaaaccaagtgcagccacacccttcgtcaaagttgctgatccaattgagagaccaagtcctcctgtaaacctaacttcctcagatcagactcagtcatcagttcagctcaaatgggaacctcctctgaaagatggaggaagcccaatattaggctatataattgagcgatgcgaagaaggaaaagataattggattcgttgcaatatgaaacttgtccctgaactgacttacaaggttaccggattggaaaaaggaaataaatatttatatagagtatctgcagaaaataaagctggtgtttcagatccatctgaaattcttggtcctctcaccgctgacgatgcatttgttgaaccaacaatggatttaagtgcatttaaagatggtctggaagttattgtcccaaatcctatcacgatcctggttccaagtacaggctatccaaggccaactgcaacctggtgttttggagataaagtactagaaacaggggaccgggtgaaaatgaagaccttgtctgcctatgccgaacttgtcatttctccaagtgaacgttcagacaagggcatttatacactgaaattagaaaaccgtgtgaaaacaatttctggggaaattgatgtcaatgtaattgctcgcccaagtgcacccaaagaattgaaatttggtgatataaccaaggactcagtacatttgacttgggaaccacctgatgatgatggaggaagtccgttaactggatacgttgttgaaaaacgagaagtcagccggaaaacatggactaaagttatggactttgtgactgatctagaattcacagttcctgatcttgttcaaggaaaagagtacttatttaaagtttgtgctcgtaacaaatgtggccctggagaacctgcatatgttgatgaacctgtaaatatgtcaactcctgcaacggtacctgacccaccagagaatgttaaatggagagatcgaacagccaatagcatcttcttaacatgggatccacctaaaaatgatggtggttcacgcatcaaaggatatatagttgaaagatgtccacgtggttctgataaatgggttgcctgtggagaacctgttgcagaaacaaaaatggaagtgacaggtcttgaggaaggcaaatggtatgcctaccgcgtgaaggccttaaacaggcagggtgctagcaaaccaagcagacccacagaggaaatccaggctgtggacacacaagaggccccagaaatcttcctcgatgtgaagctccttgctggtctcactgtaaaagctgggaccaagattgaacttcctgccaccgtaaccggaaaacctgaacctaaaataacttggacaaaggctgatatgattctgaagcaggacaaaagaattaccattgaaaatgtccctaagaaatccacagtgactattgttgatagtaagagaagtgacactggcacatatatcattgaggctgtgaatgtgtgtggccgggccactgctgtggtggaagtgaacgtcttagataaacccggaccaccagctgcctttgacatcacagatgtaaccaatgagtcatgtcttctaacatggaacccaccacgcgatgatggtggatctaagatcacaaactatgttgtggagagacgagcaactgatagtgaagtgtggcacaagctctcatccaccgtcaaggatacaaacttcaaggccaccaaattaatccccaataaagagtacatcttcagagttgctgcagaaaacatgtatggtgttggtgaaccagttcaggcctctccaataacagccaaatatcagtttgatccacctggtcctccaactcgcctagaaccttctgatatcactaaagacgcagtgactctcacatggtgtgagccagatgatgatggtggcagcccaatcacaggatactgggttgaaagactggatcctgatacagataaatgggttagatgcaataagatgccagtaaaggacacaacatacagagtgaaaggtctcactaataagaaaaaatacagattccgtgtgttggctgaaaatcttgctggacctggaaaaccaagcaaatcaactgaaccaatcttaataaaggatcccatagatcctccatggccccctggaaaaccaactgtaaaagatgtaggcaaaacatcagtaaggttgaattggacaaaaccagaacatgatggaggtgcaaagattgagtcttatgtcattgaaatgctgaagactggaacagatgagtgggtcagagtggcggaaggggttcccaccactcagcacttgctcccagggctcatggaaggacaggaatactcattccgagttagagctgtgaataaggctggggaaagtgaacccagtgaacccagtgaccctgtgctttgccgggagaagctatatcctccatcaccaccacgctggcttgaagttattaatatcacaaaaaatacagcagacctaaaatggacagttcctgagaaagatggagggtcccccatcaccaactacattgtggaaaagagagacgtcaggcgaaaaggctggcaaacagtggataccactgtcaaggacaccaagtgcacagtcaccccactgactgagggctctttatatgtgttccgagttgctgcagaaaatgctataggacaaagcgactacaccgaaattgaggactctgtgctggccaaagacacctttaccactcctggaccaccctacgccctggcagtggttgatgtgacaaaacgacatgttgacctaaagtgggagccacctaaaaatgatggtggaagaccaatacagagatatgtcattgagaagaaagaaaggttaggtacccgttgggtgaaagctggaaagactgcaggacctgactgtaacttcagagtaactgatgtcatcgaaggaacagaggtccagtttcaggttcgggctgaaaatgaagctggagttggccacccaagtgaacccacagaaatcctatccattgaagatccaacaagtcctccctcaccaccccttgacctacatgtgactgatgctgggagaaaacacattgccattgcttggaagcctccagagaaaaatggtggaagtcctatcataggataccatgttgaaatgtgtccagtaggcactgagaaatggatgagagttaattctcgcccaataaaggacttgaaattcaaggttgaagaaggtgttgttcctgacaaagaatatgtcctgagagtgagagcagtcaatgctattggtgtcagcgagccatctgaaatctctgaaaatgtggttgccaaagacccagactgcaagccaacaattgacctggagactcatgacattattgttattgaaggtgaaaagttaagcattcctgttcccttcagagctgtcccagttccaactgttagttggcataaagatggcaaagaagttaaagcaagtgatagattaacaatgaagaatgatcacatctctgcacaccttgaagttcccaagagtgtccgtgcagatgccggaatttataccattacactggagaataagctcggctcagcaacagcctcaatcaatgtcaaagtcataggcctacctggaccatgcaaagatattaaagcaagtgacattaccaagagttcttgtaagttaacttgggaacctccagaatttgatggtggaaccccaattcttcattatgtcctggagcgcagagaagctgggaggagaacatatataccagtcatgtctggtgagaacaaactgtcatggactgtgaaggatctcataccaaatggtgaatacttcttccgtgttaaagcagtcaacaaggttggtggaggagaatatattgaactgaaaaatccagtcattgctcaagatccaaagcaaccccctgatccacctgtagatgtagaggttcataatcctacagcggaggcaatgactattacatggaagccacctttgtatgatggagggagcaagataatgggctacatcatagagaagattgctaagggtgaagaaaggtggaagagatgcaatgaacacctggtaccaatcctgacctatacagcaaaaggacttgaagaggggaaagagtaccaattccgtgtgcgagcagagaacgccgcgggtattagtgaaccttctcgggctactcctccaaccaaagctgtagatcccattgatgcccccaaagtcattctgagaacaagcctagaagtgaaacgaggtgatgaaatagcacttgatgcaagtatttctggatcaccttacccaactattacatggataaaggatgaaaatgttattgtaccagaggaaattaagaagcgtgcagcacccttggttaggagaaggaagggtgaagttcaagaagaagaaccatttgtcctgcctctgacacagcgtttgagtattgacaacagcaaaaagggagaatctcagctacgcgtccgagattctctccgacctgaccatggtctgtatatgatcaaagttgaaaatgaccacggtattgcaaaagctccttgtactgtcagtgtgttagatacaccgggaccaccaatcaactttgtatttgaagatatcagaaagacctcagtcctttgtaaatgggaaccaccccttgatgatggtggcagtgaaatcataaactacactttggaaaagaaagacaagacaaaacccgactcagaatggattgttgtcacttcaacacttagacattgcaaatattcagtaacaaaactgattgaaggaaaagagtacctcttccgtgtaagagctgaaaacagatttgggccaggtccaccatgtgtttcaaagccacttgtggctaaagatccatttggaccacctgatgcaccagataagcccattgtggaagatgttaccagcaacagtatgctagtgaaatggaatgaaccaaaagataatggaagccccattttgggttactggcttgaaaaacgtgaagttaacagtacacattggtctcgtgtcaacaaaagccttctgaatgccttgaaagccaatgtagatggcttattagaaggactcacctatgtcttcagagtatgtgctgaaaatgcagctggacctggaaagttcagtccaccttcagatcccaaaacagcacatgatccaatctctcctcctgggccacctatcccaagagtcactgacacaagctctacaactattgaactagaatgggaacccccagctttcaatggtggtggggaaattgttggctattttgttgataagcagttggttggcacaaatgaatggtcacgctgcacagagaagatgatcaaggtccgtcagtacaccgtcaaagaaatccgagagggtgctgattacaaacttcgggtgagtgctgtcaatgccgcaggggaaggaccgcctggagaaacacaacctgttactgtggctgaaccacaagagcctccagctgtggaactggatgtttctgtcaagggtggaatacaaataatggctgggaagactcttagaattccagctgtggtgactggtcgccctgtacctacaaaagtatggaccaaagaagaaggggagctggataaagaccgtgttgtaatagacaacgttggaaccaaatctgaactaattatcaaggatgcactgcgaaaagaccatggcagatatgtgattacagctacaaatagctgtggttccaaatttgcagcagccagggtagaagtttttgatgtccctggtccagttcttgacttaaaacctgttgtaacaaacagaaaaatgtgtctacttaactggtctgatccagaagatgatggaggaagtgaaataacaggctttatcattgaaagaaaagatgccaagatgcatacttggagacaaccaatagagactgagagatctaaatgtgacatcacaggtctgcttgagggacaagaatataagttccgtgttattgccaagaacaagtttggctgtggccctcctgttgaaataggaccaattcttgcagttgatccactaggtcctccaacatctccagagaggctcacatacactgaaaggacaaagtccactatcacacttgactggaaagagccccgcagtaatggtggcagtcccatccaaggatatatcattgaaaaacggcgtcatgacaaacctgactttgaaagagttaacaagcgactctgcccaaccacatcttttctggttgaaaatcttgatgaacaccaaatgtatgagttccgtgtcaaagctgtcaatgaaattggtgaaagtgaaccatccctacctcttaatgtagtcatacaagatgatgaagtgcctccaactattaagttgcgtctgagtgttcgaggagacactatcaaagttaaggcaggagagcctgtccacatccctgcagatgtgacaggccttccaatgcctaagattgaatggtccaaaaatgaaactgtaattgaaaaacccactgatgcacttcagataaccaaggaagaggtatcccgaagtgaggcaaaaactgagcttagcattcccaaagcggtccgggaggacaaaggcacttacacagttactgcttccaatcgccttggctcagtgttccgaaatgttcacgttgaagtatatgaccgcccatccccaccaagaaatcttgctgttactgacattaaagctgaatcttgctacttgacatgggatgcccctcttgataatggtggcagtgaaatcacccattatgttattgacaaacgtgatgcaagtaggaagaaagcagaatgggaggaagtcaccaacactgctgtagagaaaagatatgggatctggaaacttatccccaatggtcagtatgagttccgagtcagggcagtgaataaatatggaatcagtgatgagtgcaaatcagataaagtagtcattcaagatccttatcgccttcctggacctccaggaaaaccaaaagttttggcacgcaccaaaggatcaatgctagtgagctggactcctcctttggacaatggtggctctccaattactggctactggctggagaaaagagaagagggaagtccttattggtcacgtgttagccgagcaccaataaccaaagtgggattgaaaggcgtggaatttaatgttcctcgtttgcttgaaggcgttaaataccagttcagagccatggcaataaatgctgcaggaattggtcctcccagtgaaccatcagatccagaggttgcaggagatcccatatttccaccggggccaccttcttgcccagaagttaaagataaaacgaagtcaagcatctcactaggatggaaacctccagccaaagatggtggcagcccaatcaaaggatacattgtagaaatgcaagaagaaggtactactgactggaaaagagtaaatgaaccagacaaacttataactacctgtgaatgtgtggtgcctaatctgaaagagctcaggaagtacagattcagagtgaaagctgtcaatgaagctggtgaatctgaaccaagtgatacaactggggagatccctgccactgatattcaagaggaaccagaagttttcattgacattggagcacaggactgtctggtttgtaaagctggctcacagattaggattcctgctgtcatcaagggacgcccaacaccaaaatcatcttgggaatttgatggaaaggcaaagaaagcaatgaaggatggagttcatgacatacccgaagatgcacagctggagactgctgaaaactcctcagtaattattattccggagtgtaaacgatctcatacaggcaaatacagcatcacagccaagaataaagcaggacaaaagactgcaaattgcagagttaaagtcatggatgtaccaggcccacccaaagatctgaaagtcagtgatatcacaaggggtagttgcagactttcatggaagatgccagacgacgatggaggagacaggatcaaaggctatgttattgagaagaggactattgatggaaaagcctggaccaaagtcaatccagactgtggaagcaccacatttgtagtgcctgatctcctctctgaacagcaatatttcttccgtgtgcgagcagaaaaccgttttggtattggcccacctgtggaaaccattcagaggaccactgccagagatccgatatatcctcctgatcctcctattaaactcaagattggcctcatcacaaagaacacagtgcatctgtcatggaaacccccgaagaatgatgggggctcccctgttacccactatattgttgagtgccttgcatgggaccctactgggacaaagaaagaagcctggaggcagtgcaataagcgtgatgtggaagaactgcaatttactgttgaagacctagtagagggtggggaatatgaattccgagtcaaagctgtcaatgctgcaggagtcagcaagccttcagccactgttggccctgtgactgtcaaagaccagacatgcccaccatcaattgatctaaaagaattcatggaggttgaagaaggaaccaatgttaacattgtggccaaaattaaaggtgtgccattcccgacactaacctggtttaaagctcctccaaagaagcctgataacaaagaacctgttctctatgacacccatgtcaacaaactggtggtagatgatacttgcactttagttattccgcagtctcgcaggagtgacactggcttatataccatcacagctgtaaataatctgggaacagcatcaaaggagatgagactgaatgtcctgggtcgtcctggccctccagtgggacccataaaatttgaatctgtttcagcagatcaaatgacactatcttggtttccacctaaagatgatggtgggtctaagattacaaactatgtaattgagaaaagagaagctaacaggaagacatgggtccatgtctccagtgaacctaaggagtgcacgtacacgattcccaaattgctagaaggccatgaatatgtattccgaatcatggcccagaataaatatggcattggagaacctcttgacagtgaacctgaaacagcaagaaacctcttctctgtccctggagcaccagataaaccaacagttagcagcgtgactcgtaactccatgactgtcaactgggaagagccagaatatgatggaggctctcctgtgacagggtactggctggaaatgaaagacaccacttcaaagagatggaagagagttaaccgagatcctatcaaagccatgactttgggtgtttcttataaagtgactggtcttattgaaggttccgactatcaattccgggtatatgcaatcaatgctgctggcgtgggtccagcaagtctgccatcagacccagcgactgctagagatccaattgcccctcctggtcctccatttcccaaagtgacagattggactaaatcatctgcagatctggagtggtctcccccactaaaagatggtggatccaaagtaactggatacatcgttgaatataaagaagaaggaaaagaagaatgggaaaagggtaaagataaagaagtgagaggaacaaagcttgttgtgacaggattaaaggaaggagcattctacaaatttagagttagagcagtcaacattgctggcattggagaacctggagaggtcacagatgtcattgaaatgaaggacagacttgtttcacctgaccttcagctagatgccagtgtcagagatagaattgttgtccatgctggaggggtgatccgaatcattgcctatgtgtctggaaagcctcctccaaccgtcacctggaacatgaatgaaagaaccttacctcaagaagccaccattgagaccacagccattagctcatccatggtcatcaagaactgccagaggagccatcaaggcgtctattctcttcttgccaaaaatgaagccggagaaagaaagaagacaattattgttgatgtattagatgttccaggtcccgttggaacaccattcctagctcacaacctaaccaatgagtcctgcaaactgacatggttttctccagaagatgatggaggctctccaatcaccaattatgtcattgaaaagcgtgaatctgaccgcagagcatggaccccagtgacatatacagttacccgacaaaatgctactgtccagggtctcattcaaggaaaagcctactttttccgaattgcggctgaaaatagtattggcatgggtccatttgttgagacatcagaggcacttgttatcagagagccaataactgtaccagagcgtcctgaagacctggaagtcaaagaagttactaaaaatactgtaactttgacttggaatcctcctaagtatgatggtgggtcagaaattattaactatgtcctagaaagtcggctcattgggactgagaagttccacaaagttacaaatgacaacttgcttagcagaaaatacactgttaaaggcttaaaagaaggtgatacctatgagtaccgtgtcagtgctgtcaacattgttggacaaggcaaaccatcattttgcaccaaaccaattacttgcaaggatgagctggcacccccaacgcttcacctcgacttcagagataagctcacgattcgagttggtgaagcttttgccctcactggccgttactcaggcaaaccaaagcctaaggtttcctggttcaaagatgaagctgatgtgctggaagatgatcgcactcatataaagactacaccagcaacacttgctttagagaagatcaaggccaaacgttcagattccggcaaatactgtgtggttgtggagaacagtacaggctctaggaaaggtttctgtcaagttaatgttgttgaccgtcctggaccaccagtaggaccagttagttttgatgaggtgaccaaagattacatggttatctcttggaagcctcctttagatgatggaggcagtaaaatcaccaattatattattgagaagaaggaagtgggtaaagacgtctggatgccagtgacatctgcaagtgctaaaacaacatgcaaagtttctaaactacttgaaggaaaagattatattttccggatacatgctgaaaatctgtatggaataagtgatcctctggtgtctgattcaatgaaagccaaagatcgtttcagggttcctgatgcacctgatcagccaattgttacagaagttaccaaagactctgcattagtaacctggaataagccacatgatggaggaaaacccatcacaaactacatcctggaaaagagagaaactatgtctaaacgatgggctagagttaccaaagatcctattcatccatacactaaatttagggttcctgatcttctagaaggatgtcagtatgaattccgggtttctgcagaaaatgaaattggtattggagatccaagcccaccatccaaaccagtctttgctaaagatccaattgctaaaccaagtccacctgttaatcctgaagcaatagatacaacatgcaattcagtcgatctaacttggcagccaccacgtcatgatggtgggagcaagattctgggttatattgttgagtaccagaaagttggagatgaagagtggagaagagccaatcacacccctgagtcatgtcctgaaactaaatataaagtcaccggtcttcgggacggtcaaacctataagtttagagtgttagcagtcaatgcagctggtgaatcagatccagctcatgttccggagccagtcctagtaaaagacaggcttgaaccccctgagttgattcttgatgccaacatggcaagagaacaacacattaaagttggtgatactctaagacttagtgccatcatcaaaggagtgccattcccaaaagtaacttggaaaaaagaagacagagatgctccaactaaagcaagaattgatgtgactccagttggtagcaagcttgaaattcgtaatgctgcccatgaagatggtggaatttattctttaacagtggagaatccagctggttcaaaaactgtctcagtaaaagtacttgtattagataaacctgggccacctagagatctggaagtcagtgaaattaggaaagattcatgttaccttacttggaaagaaccactggatgatggtggttctgttattaccaattatgtggttgagaggagagatgttgccagcgcccagtggtcacctctctcagctacatcaaagaaaaagagtcacttcgctaagcatctgaatgaaggcaaccagtacctcttccgagtagctgcggagaaccagtatggacgtggtccttttgttgaaacaccaaaaccaatcaaggctttggatcctctccatcccccagggccacccaaggacctgcaccatgtagatgttgacaagactgaagtctccctagtctggaataagccggatcgtgatggtggttctccaatcactggatatttggtagaatatcaagaagaaggcacccaggactggattaaatttaagactgtgacaaacttagagtgtgtggttactggactacaacaaggaaagacctatagattccgtgtaaaagctgaaaacattgtgggtcttggtctccctgacacaactatcccgatagaatgtcaagaaaaactagtgcctccatccgtggagctagatgtgaaattaattgaaggtcttgtggtaaaggctggaaccacagtcagattccctgctattataagaggtgtgcctgttcctactgcaaagtggacaaccgatgggagtgagattaaaaccgatgagcactacacagttgaaacagacaacttctcatcagtacttaccattaagaactgcttaaggagagacactggggaatatcaaatcacagtttccaatgcagccggtagcaaaacagtagccgtacatcttactgttcttgatgttcctgggccaccaacaggtcctattaatattctggatgttactcctgaacacatgactatctcatggcagccacctaaggatgatggaggaagccctgtgataaattatattgttgagaaacaagatacaaggaaagacacgtggggtgttgtctcttccggaagcagtaagacaaagctgaaaatcccacatctgcagaagggctgtgaatatgttttccgagttagagcagagaataagataggtgttggtcctccccttgactccacacctactgttgctaagcataaatttagtcctccgtctcctcctggtaaaccagtggttactgacattactgaaaatgcagcaacagtgtcttggaccctgccaaaatctgatggtggcagtccaataactggctactatatggaacgtcgagaagtaactggcaaatgggtgagggtcaacaaaacacctatcgctgacctgaagttcagagtgactggactctatgaaggaaatacatatgagtttagagtttttgctgaaaatcttgcaggactaagcaaaccatccccaagttctgatccaataaaagcttgccggcccatcaaaccacctggaccacctattaatcctaaactgaaagacaagagcagagaaacagctgatttggtgtggacaaagcctctcagtgatggtggtagccccattctaggatatgtagtggaatgtcagaaacctggcacagcacaatggaacaggattaataaagatgaactcattaggcaatgtgcctttagggtacctggactaattgaaggaaatgagtacagattccgtataaaggcagctaatattgtaggagagggtgagccaagagaactagcagaatctgtgattgcaaaagatatccttcatcctccagaagtagaacttgatgttacttgtcgtgatgttattaccgtgagagtaggccaaactatccgcattctagctcgagtcaaaggcagacctgaaccagacataacttggactaaggaaggcaaagtattggtccgagaaaagagggtggaccttattcaggatctacctcgtgttgagttacaaattaaagaagctgttagagctgatcatggcaagtatatcatctcagctaagaacagcagtggacatgcccaaggttcagccatcgttaacgtccttgacagacctgggccttgccagaatttgaaggttaccaatgtaaccaaagagaactgtacaatttcttgggaaaacccactagataatggtggctcagaaataacaaacttcatagtagaatatcgcaaaccaaaccagaaaggctggtcaattgttgcatcagatgtcactaaacgattaatcaaggccaaccttttagccaacaatgaatactatttccgagtttgtgcagagaataaagtaggtgttgggccaaccatcgaaacaaaaactcccattctggctattaaccctattgacagaccaggtgagcctgaaaaccttcacattgcagataaaggaaagacatttgtctatctaaagtggcggaggcctgactatgatggtggcagtccaaatctgtcatatcatgttgagagaaggcttaagggctccgatgactgggaaagagtgcataaaggaagcattaaagaaactcactacatggttgacagatgtgttgaaaaccagatttatgagttcagagtgcaaacaaagaatgaaggtggggaaagtgactgggtgaagacagaggaagttgttgtgaaagaagacttacaaaaaccagtacttgatctgaaattaagtggggtcctaactgtcaaagcaggggacaccattaggcttgaggcaggggttagaggcaaaccattcccagaagttgcatggaccaaggacaaagacgctacagacttaacaagatcaccaagggtcaagattgatacccgtgctgattcatctaaattttctcttactaaagcaaagcgaagtgatgggggtaaatatgtagttacggcaactaacacggctggcagttttgtggcctatgccactgtcaatgttttagataagcctggtcctgtgagaaatctgaaaattgttgatgtgtccagtgataggtgtactgtttgctgggatccaccagaagatgatggtggctgtgaaatccaaaattatattctagaaaaatgtgagacaaagcgaatggtttggtctacctattctgctactgtcttgacacctggtactacagtaacacgtctcatagaaggaaatgaatatattttcagagtccgtgcagaaaataaaataggcacagggcctccaacagaaagtaaaccagtcatagccaaaaccaagtatgataaacctggtcgccctgatcccccagaagtcactaaagtaagcaaagaagagatgactgtggtttggaatccacctgaatatgatggtggaaagtctataactggatactttttggagaaaaaggaaaagcattcaacacgatgggtccctgtcaacaagagtgcaatccctgagagacgtatgaaagtacagaatctcctcccagaccatgaatatcagttccgtgtcaaggcagaaaatgaaattggaattggagaaccaagcttgccttcaagaccggtggtggcaaaagaccccatagagccacctggtccaccaaccaatttcagagtggttgatacaaccaaacattccataactcttgggtggggaaaaccagtctatgatggtggtgcaccgatcattggatatgttgtggaaatgagaccaaaaatagcagatgcgtctcctgatgaaggctggaaacggtgtaatgctgcagcacagcttgtacgcaaggaattcactgttaccagcttggatgaaaaccaggaatatgagttcagggtgtgtgcccaaaaccaagttggtattgggcgccctgcagagctaaaggaagctatcaaacctaaagaaatactagaacctccggagattgatttggatgccagcatgaggaaactggtcatagtgagagcaggatgccctattcgtctctttgctatagtgagaggacgaccagcccctaaagtcacttggcgaaaagttggcattgataatgtggtcagaaaaggacaagttgatctggttgacactatggccttccttgtcatccccaattctacccgtgatgactcaggaaaatattccttaacacttgtgaacccagcaggagaaaaggctgtattcgtaaatgtcagagtattagacactcctgggcctgtgtctgatttaaaagtttcagatgtcactaaaacatcatgccatgtgtcctgggcccctcctgaaaacgacggtgggagccaagtgacacattatatcgtggagaaacgtgaggcagacagaaagacatggtcgaccgttaccccagaagttaagaaaacaagcttccatgtaaccaatcttgtccctgggaatgagtattacttcagagtaactgctgtcaacgaatatggccctggcgtcccaacagatgtcccaaaaccagtgcttgcatcagatcctctaagtgagccggatcccccaaggaaattagaagtgactgaaatgaccaagaacagtgccaccttagcctggttacctcccctacgtgatggaggtgctaaaatcgatggctacatcactagttacagagaagaagagcagcctgcagatcgctggacagagtactcagtggtaaaagatctgagccttgttgtcactggcctaaaggaaggaaagaaatacaaatttagagtagcggccagaaatgctgttggagtcagtttgccaagagaagctgaaggagtgtatgaagccaaagaacaactgttgccaccaaagatccttatgccagagcaaataactatcaaagctgggaaaaaactccgaattgaagcccatgtgtatggaaagcctcatcccacctgtaaatggaaaaaaggagaagatgaagttgtcacatccagccacctggcagtgcataaagcagacagctcttcaattctgatcataaaagatgtgactaggaaagacagtggttactacagcctcacagcagagaacagttctgggacagacactcagaaaatcaaagttgtagtcatggatgcccccggcccccctcagcctccatttgacatttctgatatagacgctgatgcttgctccctgtcatggcacatccctctggaggacggaggcagtaacatcaccaattatatagtggagaagtgtgatgtaagccgaggtgactgggtcacggctctagcttcagtcacaaaaacttcctgcagggttggaaagctgatcccaggccaggagtacatcttccgggtccgtgctgaaaaccgatttggcatttcagagcctctcacatctccaaagatggttgcgcagttcccatttggtgttcctagtgaaccaaagaatgcacgagtcaccaaagtcaacaaggactgtatttttgttgcttgggacagaccagatagtgatggagggagccccattattggttatctgattgaacgcaaggaaagaaacagtttgctgtgggtgaaagccaatgatactcttgtccggtcaactgaatatccttgtgctggccttgtagaaggtcttgagtattcattcagaatctatgccctaaacaaagctggatccagcccacccagcaaacccacagaatatgtaactgcaagaatgccagttgatcctcctgggaaacctgaggttattgatgtcaccaagagtactgtatctctgatctgggctcgtccaaagcatgatggaggcagtaaaattattggctatttcgtagaagcttgcaaacttcctggtgataaatgggtacggtgcaatactgcacctcaccagattccccaggaagagtacacagctactggcctagaagagaaagctcagtatcaatttagagctattgccaggaccgcggtaaacattagcccaccttctgaaccttctgatccagtgactatcctcgcagaaaatgtccctcccaggatagacctgagtgtggctatgaaatctttgcttactgtgaaagctggaactaatgtctgcttggatgctactgtttttggtaaaccgatgccaacagtttcttggaaaaaagatggcacactgctaaaaccagcagaaggcataaagatggccatgcagcggaatctgtgcaccttggagctattcagcgtgaaccggaaggactcaggagactataccattactgctgaaaattcaagtggttctaaatcagccaccattaagcttaaagtgttagataaaccgggtcctccagcatctgttaaaatcaacaaaatgtattcagatcgtgctatgctttcttgggaaccgcctcttgaagatggaggctcagaaatcaccaactatattgttgacaaacgtgaaacaagcaggcccaactgggctcaagtctctgcaactgtgcctatcaccagctgcagcgtggagaaacttatagagggccatgagtatcagttccgtatttgtgctgaaaataaatatggagtaggcgatccagtcttcactgaaccagcaattgccaaaaacccatatgacccaccaggacgctgtgatcctcctgttattagcaacataaccaaagatcacatgacagtcagctggaagccaccagcagatgatgggggctcacccatcactggctatttgcttgaaaagcgggaaacccaggctgttaactggactaaggtcaacagaaaacctattatagaaagaacattaaaagcaacaggtcttcaagaaggtaccgaatatgagttccgtgttacagctataaataaagctggaccaggcaaacccagtgacgcatccaaggccgcttatgctcgggaccctcagtatcctcctggcccaccggctttccctaaagtatatgatacaactcgcagctctgtgagtctatcttggggcaagccagcctatgacggcggcagccctatcattggttatctcgttgaagtaaaacgggctgactccgataactgggtgaggtgcaacttaccacagaatctacagaaaacccgctttgaggttactggcctgatggaagacacacaatatcaattccgtgtgtatgccgttaataagattggatacagtgaccccagtgatgtgccagataaacactatcccaaggacatcttaattccacctgagggagaacttgatgcggacttaaggaagacactcatattacgtgctggagttactatgagactatatgtaccagtaaaaggacgcccacctccaaagattacttggtctaaaccaaatgtcaatctaagagacaggattggactggacataaagtcaactgactttgacactttcttgcgctgtgaaaatgtgaacaaatatgatgcaggaaaatatatcttaaccctggagaacagctgtggtaaaaaggaatataccattgttgtgaaagtgcttgatactcctgggccacctgtcaatgtgactgttaaggaaatatccaaagactctgcttatgttacctgggagcctcccattattgatggcggaagccccatcataaactatgtggtacaaaaacgtgatgcagagaggaaatcctggtctacagtgacaactgagtgctccaaaacaagcttcagagtagctaatttggaggagggaaaatcctacttcttccgagtgtttgctgaaaatgagtatggcattggtgatcccggtgaaactcgtgatgctgtcaaagcttcccaaactcctggaccagttgtggacctgaaagtgaggtctgtatctaagtcatcctgtagcattggctggaaaaagcctcacagtgatggtggaagtcggattattggatatgtagttgatttcctgactgaagaaaataagtggcaacgagttatgaaatccttaagcctacagtactctgcaaaagatttgactgaagggaaggaatataccttcagagtgagtgctgagaatgaaaatggagaaggaaccccaagcgaaatcactgttgtggcaagggatgatgttgtggctcctgatcttgacttaaagggtctacctgatttgtgctacttggctaaagaaaacagcaacttccggcttaagatccccataaaaggcaagccagctccatcagtctcctggaagaaaggggaagatcctctagcaactgacactagagtcagtgttgagtcatctgcggttaacacaactcttatagtgtacgattgccaaaaatctgatgctggaaaatacacaatcacacttaagaatgttgctggcaccaaggaaggaactatctccataaaggttgttggcaagcctggcatccccactggaccaatcaaatttgatgaagtcacagcagaagccatgaccttaaagtgggctcctccaaaggatgatggaggttctgaaatcaccaactatatcctagagaagagggattctgtgaacaacaagtgggtgacgtgcgcctcagctgtccagaaaaccacctttagagtaaccagacttcatgagggcatggaatataccttcagggtcagtgccgaaaataaatatggtgtaggggaaggcctgaaatcggagccaattgttgcgagacatccatttgatgtgcctgatgctcccccacctcccaatattgtggatgtcagacacgattcagtatctctaacttggactgaccccaagaaaactggtggttctccaattacagggtatcatctcgagttcaaggaaagaaacagccttttgtggaagagagctaacaagactccgataaggatgagagactttaaagtgacaggattaactgaaggtcttgaatatgaattccgagttatggcaatcaatttagcaggtgtgggcaagccaagcctaccatcagagcctgttgtggcactggacccaattgatcctcctggaaaacctgaggttattaacataacaaggaattcagtgactctcatttggactgaacctaaatatgacggtggtcataagttaactggatatatagtggagaagcgagatctaccttcgaagtcttggatgaaagccaaccatgttaatgtcccagaatgtgcctttactgtaactgaccttgttgagggtggaaaatatgaattcagaattagagcaaagaatacagcaggtgctatcagtgctccatcagaaagtacagaaaccattatttgcaaggatgaatacgaggcaccaacaattgtccttgatcccacaataaaagatgggctaacaattaaagcaggggataccattgttttgaatgccattagcattcttggcaaaccccttccaaaatcaagttggtccaaggcaggaaaagacattagaccatcagatatcactcagataacttcaaccccaacatcttccatgcttactatcaagtatgccactagaaaagatgcgggtgaatataccatcactgctaccaatccttttggcacgaaggtggaacatgtgaaggtaacagtccttgatgtacctggtcccccaggtcctgttgaaatcagtaatgtttctgctgaaaaagcaacacttacatggacacctcccttggaagatggcggctcaccaattaagtcctatatacttgaaaagagagaaaccagccgacttttgtggacagtggtttctgaagatattcagtcttgcaggcatgtggcaaccaaacttatccaaggaaatgagtacatcttccgggtctcagctgtaaaccactatggcaaaggagaacctgtacagtctgaacctgtcaaaatggtagacagatttggtccccctggccctcctgaaaaaccagaggtatcaaatgtcactaagaacactgccactgtcagctggaaaaggccagtggatgatggtggcagcgaaattacaggatatcatgtagaaaggagagaaaagaaaagcctgcgatgggtgagagcaataaaaacaccagtttccgatctcaggtgcaaagtaacaggactgcaagaaggaagcacctacgaattccgtgtcagtgcagaaaacagagcaggaattggtccacccagtgaggcttcagattctgttctgatgaaagatgcagcatatcctccaggaccaccttcaaatccgcatgtcactgatactaccaagaaatctgcttctttggcatggggcaagcctcattatgatggtggacttgaaatcactggctatgtcgtggagcatcaaaaagtaggagacgaggcctggataaaagataccacaggaaccgccctcagaatcactcagttcgttgttcctgatcttcagactaaagaaaaatacaacttcagaatcagtgccatcaacgatgcaggtgttggggagccagcggtgattccagatgttgaaatcgtagaacgggagatggctcctgattttgaactagatgccgagcttcgaagaacacttgttgttagagcaggactcagtattaggatatttgtgccaattaaaggtcgtcctgctcctgaagtgacatggaccaaagataacatcaacctgaaaaaccgagccaacattgaaaatacggaatcatttactcttctgattatcccagaatgtaacagatatgataccggtaaatttgtcatgaccattgaaaacccggctgggaagaaaagtggctttgtgaacgtcagagtcttggacacgccaggcccagtcctcaacctgcggcctacagacatcacaaaggacagtgtcaccctgcactgggacctccctctgatagatggaggctcacgtataacaaactacattgtagagaaacgtgaagcaacacggaaatcttattccacagccaccactaagtgccataaatgcacatataaagttaccggcttgtctgaagggtgtgaatatttcttcagagtgatggcagagaatgaatatggaattggtgagccaacagaaactacagagcccgtaaaagcctctgaagcaccatctccaccagacagccttaacatcatggacataactaagagcaccgtcagcctggcatggcctaagcccaaacacgatggtggcagcaagatcactggctatgtgattgaagcccaaagaaaaggctctgaccagtggacccacatcacaaccgtgaaagggttagaatgtgttgtgaggaatctaactgaaggagaggaatataccttccaagtgatggcagtgaacagcgcggggagaagtgcccctagagaaagcagacccgtcattgtcaaggagcagacaatgcttccagagctggatctccgtggcatctatcagaaactggtcattgccaaagctggtgacaacatcaaagttgaaattccagtgctcggtcgaccgaagcccacagtgacatggaaaaaaggagaccaaattcttaaacagacacagagagttaattttgaaaccacagcgacttcaaccattttaaatatcaatgagtgtgtcagaagtgatagtgggccctatccattaacagcaaggaacattgtaggagaggttggtgatgtcatcaccattcaagtccatgatatcccagggccacctactggaccaatcaaatttgatgaagtttcatctgattttgtaaccttctcttgggacccacctgagaacgatggtggtgtaccaataagcaactatgtagtggaaatgcggcagactgacagtactacctgggttgagttagcaaccaccgttatacgtactacctataaagccacccgccttactactggattagagtatcagttccgtgtaaaagctcagaatagatatggagttggaccaggcatcacatcagcatgcatagttgccaactatccatttaaggttcctggacctcctggtacccctcaggtaactgcagttaccaaggattcaatgacaattagctggcatgagccactttctgatggtggaagccccattttaggatatcatgttgaaagaaaagaacgaaatggtattctctggcagactgtgagcaaagctttagtaccaggcaacattttcaaatcaagtggacttacagatggtattgcttatgagttccgggtgattgcagaaaacatggcaggcaaaagtaagccaagcaagccatcagaacctatgttggctctggatcccattgacccacctggaaaaccagtacctctaaatattacaagacacacagtaacacttaaatgggctaagcctgaatatactgggggctttaaaattaccagttatatcgttgaaaagagagaccttcctaatggacggtggctgaaggccaacttcagcaacattttggagaatgaatttacagtcagtggcctaacagaagatgctgcatatgaattccgtgtgatcgccaaaaatgctgcaggtgccatcagtccaccatctgagccatctgatgctatcacttgcagggatgatgttgaggcaccaaagataaaggtggatgttaaatttaaggacacggttatattaaaagcaggtgaagcattcagactggaagctgatgtttcaggccgcccacctccaacaatggaatggagcaaagatggaaaagagctggaaggcacagcaaagttagaaataaaaattgcagatttctctactaatctggtaaacaaagattcaacaagaagggatagtggtgcctatacccttacagcgactaatcctggtggctttgctaaacacattttcaatgtcaaagttcttgacagaccaggcccacctgaaggacctttggctgtaactgaagtgacatcagaaaagtgtgtactatcatggttccctccactggatgatggaggtgccaaaattgatcattacatagtacagaaacgtgaaaccagcagattggcatggacaaatgtagcctcagaagtccaagtaacaaagctaaaggtcactaaactcttgaaaggcaatgaatacatattccgtgtcatggctgtaaataaatatggagtgggagagccactggaatcagagcctgtgcttgcagtgaatccttatggaccccctgatccgcccaaaaaccctgaagtgacaactattactaaagattcgatggttgtctgctggggacatcctgattctgatggtggaagtgaaatcatcaattatattgtggaacggcgtgataaagctggccaacgctggattaaatgcaacaaaaaaactcttactgatttaagatataaagtgtctggactgacagaaggacatgaatatgagttcaggattatggctgaaaatgctgctggaattagtgcaccaagtcctaccagtccattttacaaggcttgtgacactgtgtttaaacctggaccaccaggtaacccacgtgttctggatacaagcagatcatccatttcaatcgcttggaataaacctatctatgatggtggttcagaaatcactgggtatatggttgagattgccctgccagaggaagatgaatggcagattgtcactccaccagcaggactcaaggcaacttcgtatactatcactggcctcacagagaatcaggaatataagatccgcatctatgccatgaattccgaaggacttggggaacctgcccttgttcctggaactccaaaggctgaagacagaatgctgcctccagaaattgaactggatgctgacctgcgcaaagttgttactataagggcctgctgcaccctgagactttttgttcccatcaaaggaaggcctgcacctgaggtgaagtgggcccgggaccatggagaatctttagataaagctagcatcgaatccacaagctcttacaccctgcttattgttggaaatgtaaacagatttgacagtggcaaatatatactaactgtagaaaatagttcaggcagcaagtctgcatttgtcaatgttagagttctcgatacaccaggccccccacaggatctgaaggtaaaagaggtcactaagacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaagaactatattgttgaaaagcgggaatcaacaagaaaagcatattcaactgttgcaacaaactgccacaagacttcctggaaggtagaccagcttcaagaaggctgtagctactatttcagggttctcgcagaaaatgaatatggcattgggctgcctgctgaaaccgcagaatctgtgaaagcatcagaacgacctcttcctccaggaaaaataactttgatggatgtcacaagaaatagtgtgtcactctcttgggagaaaccagagcatgatggaggcagccgaattctaggctacattgtggagatgcagaccaaaggcagtgacaaatgggccacgtgtgccacagtcaaggtcactgaagccactatcactggattaattcagggtgaagaatactctttccgtgtttcagctcagaatgaaaagggcatcagtgatcctagacaactgagtgtgccagtgatcgccaaagatcttgtcattccaccagccttcaaactcctgttcaatactttcactgtactggcaggtgaagacctaaaagttgatgttccattcattggccgccctaccccagctgtaacctggcataaagataatgtaccactgaagcagacaactagagtaaatgcagagagcacagaaaataattcactactgacaataaaggacgcctgccgagaagatgttggccattatgtggttaaactgactaactcagctggtgaagctattgaaacccttaatgttatcgttcttgacaaaccagggcctccaactggaccagttaaaatggatgaagtgacagctgatagtattactctttcctggggcccacccaagtatgatggtggaagttctatcaataattacattgttgagaaacgggacacttccacaaccacctggcaaattgtatcagctacagttgcaaggacaacaataaaggcttgcagactgaagactggatgtgaatatcagtttagaattgcagctgaaaacagatatgggaagagtacctacctcaattcagagcctactgtagcccaatatccattcaaagttcctggtcctcctggcactccagttgtcacactgtcctccagggacagcatggaagtacaatggaatgagccaatcagtgatggaggaagtagagtcattggctatcatctagaacgcaaggaaagaaatagcatcctctgggttaagttgaataaaacacctattcctcaaaccaagtttaagacaactggccttgaagaaggtgttgaatatgaatttagagtctctgcagagaacatcgtgggcattggcaagccgagtaaagtatcagaatgttatgtggctcgtgacccatgtgatccaccaggacggccagaggcaatcattgtcacaaggaattctgtgactcttcagtggaagaaacccacctatgacggtggaagcaagatcactggttatattgttgagaagaaagaattacctgagggccgttggatgaaagccagttttacaaatattattgacactcattttgaagtaactggcctagttgaagatcacagatatgagttccgggttatagcccgaaatgccgcaggagtgtttagtgagccttcagaaagcacaggagcaataacagctagagatgaggtagatccaccacgaataagtatggatccaaaatacaaagacacaatcgtggttcatgctggtgaatcattcaaggttgatgcagatatttatggcaaaccaataccaaccattcagtggataaaaggtgatcaggagctttcaaacacagctcgattagaaataaagagcaccgactttgccaccagtctcagtgtaaaagatgcagtacgtgtcgacagtggaaattacatactgaaggccaaaaatgttgcaggagaaagatcagttactgtgaatgtcaaggttcttgacagaccagggccacctgaaggacctgttgttatctcaggagttacagcagaaaaatgcacactagcttggaaacccccacttcaggatggtgggagtgacatcataaattatattgtggaaaggagagaaaccagccgcttagtttggactgtggttgatgccaatgtgcagactctcagctgcaaggttactaagcttcttgaaggcaatgaatatactttccgtataatggcagtaaacaaatatggtgttggtgaacctcttgaatctgagccagtagttgccaagaatccatttgtagtaccagatgcaccaaaagctccagaagtcacaacagtgaccaaggactcaatgattgttgtatgggaaagaccagcatctgatggtggtagtgaaattcttggatatgttcttgagaaacgggataaagaaggcattagatggacaagatgccataagcgtctgattggagagttgcgcctgagagtaactggactcatagaaaatcacgattatgagttcagagtttctgctgagaatgctgctggacttagtgaaccaagccctccttctgcttaccaaaaggcttgtgatcctatttataaaccaggacccccaaacaaccccaaagtcatagacataaccagatcttcagtattcctttcttggagcaaaccaatatatgatggtggctgtgaaattcaaggatacattgttgaaaaatgtgatgtgagtgttggtgaatggacaatgtgcactccaccaacaggaattaataaaacaaacatagaagtagagaagctgttggaaaagcatgaatacaacttccgtatctgtgctattaataaagctggagttggagaacatgctgacgtccctggacctattatagttgaagaaaaattagaagcaccagacattgatcttgacctagaactaaggaaaatcataaatataagggcaggtggctccttaaggttatttgttcctataaaaggtcgtcctacaccagaagttaaatggggaaaggtggatggtgaaatccgagatgcagctataattgatgtcactagcagtttcacctctcttgttcttgacaatgtcaaccgatatgatagtggaaaatatacgcttacattagaaaacagcagtggaacaaagtctgcctttgttactgtgagagttctggacacgccaagtccacctgttaacctgaaagtcacagaaatcaccaaagactcagtatcaattacatgggaacctcctttgttggatgggggatccaaaataaaaaattacattgttgagaaacgtgaagccacaagaaaatcatatgctgctgttgtaactaactgccataagaattcttggaaaatcgatcagctccaagaaggttgcagttattactttagagtcacagctgagaatgagtatggtattggccttcctgcccagactgctgatccaattaaggttgcagaagtgccacaacctcctggaaaaataactgtggatgatgtcaccagaaacagtgtctctctgagttggacaaaacctgaacatgatggtggcagtaaaatcattcagtatattgtggaaatgcaagctaaacacagtgagaaatggtcagagtgtgctcgagtaaagtctcttcaggcagtaattaccaacctaactcaaggggaagaatatctttttagagttgttgctgtaaatgaaaaggggagaagtgatcctcggtcccttgcagttccaatagttgccaaagatctggtaattgagccagatgtaaaacctgcattcagtagttacagtgtacaggttggccaagatttgaaaatagaagtgccaatttctggacgtcctaagccaaccattacctggactaaagatggtctcccactgaagcagaccacaagaatcaatgttaccgattcactggatctcaccacactcagtattaaagaaactcataaggatgatggtggacaatatggaatcacagttgccaatgttgttggtcagaagacagcatccatcgaaattgtaactctagataaacctgatcctccaaaaggacctgttaaatttgatgacgtcagtgctgaaagtattacattatcttggaaccctccattatatacagggggctgccaaatcaccaactacattgttcagaaaagagatacaaccaccacagtatgggatgttgtttctgctactgttgctagaactacactcaaagtgaccaaactgaaaactggtacagaataccaatttagaatatttgccgaaaacagatatggacaaagctttgccttagagtctgatccaattgtagctcaatatccctacaaagaaccaggccctccaggtacaccatttgccacagccatttccaaagactccatggtcatacagtggcatgaaccagtcaacaatggtggaagccccgtcataggttaccacctggagagaaaagaaagaaacagtattttgtggacaaaggtcaacaaaactattattcatgacacccaattcaaagcacagaatcttgaagaaggcattgaatatgaattcagagtgtatgctgaaaatattgttggtgtaggcaaagcaagcaagaattctgaatgctatgtagccagagatccctgtgacccaccaggaaccccagaaccaataatggttaaaagaaatgaaatcactttacagtggaccaaacctgtgtatgatggtggaagtatgattacaggctacattgtagagaaacgtgatttgcctgatggtcgttggatgaaagctagctttacaaatgtcattgaaactcaatttactgtgtcaggtcttactgaagatcaaagatatgaattcagagtcattgcaaagaatgcagctggtgcaataagtaaaccctctgacagtactggaccaataactgccaaggatgaggttgaactcccaagaatttcaatggatccaaaattcagagacacaattgtggtaaatgctggagaaacattcagacttgaggctgatgtccatggaaagcccctacctaccattgagtggttaagaggagataaggaaattgaagaatctgctagatgtgaaataaagaacacagatttcaaggctttacttattgtaaaagatgcaattagaattgatggtgggcagtatattttaagagcttccaatgttgcaggttctaagtcattcccagtaaatgtaaaagtattagatagaccaggacctccagaagggccagtccaggttactggagtcacttctgaaaaatgctctttaacatggtctccaccacttcaagatggtggcagtgacatttctcactatgttgttgaaaagcgagaaaccagtcgacttgcctggactgttgttgcttcagaagttgtgaccaattctctgaaagttaccaaactcttagaaggtaatgaatatgttttccgtataatggctgtcaacaaatatggtgttggagagcctttggaatctgcaccagtactaatgaaaaatccatttgtgcttcctggaccaccaaaaagcttggaagtcacaaatattgccaaagactccatgaccgtctgttggaaccgtccagatagtgatggtggaagtgagattattggttacattgtagagaaaagagacagaagtggcattcgatggataaaatgtaataaacgccgcattacagatttgcgtctaagagtgacaggattaacagaagatcatgagtatgaattcagggtctctgcagaaaatgctgctggagttggggaaccaagtccagctacagtttattataaagcctgtgatcctgtgttcaaacctggcccacctaccaatgcacacattgtagacaccactaaaaattcaatcacacttgcctggggtaaacccatctatgatggcggcagtgagatcttgggatatgtagtagaaatctgtaaagcagatgaagaagaatggcaaatagttactccacagactggcctgagagtcactcgatttgaaatttcaaaactcactgaacaccaagagtataaaatacgagtctgtgccctcaacaaagttggtttaggtgaggctacatcagttcctggtactgtgaaaccagaagataaacttgaagcacctgaacttgaccttgactccgaattaagaaaaggaattgttgtaagagctggtggatctgccagaattcacattccattcaaaggtcgtccaacgcctgagatcacttggtctcgagaggaaggtgaattcacagataaggtccaaattgaaaagggagtaaactatacccaactatcaatagataactgtgatagaaatgatgctggaaaatacattcttaagttggaaaacagcagtggatcaaagtctgcttttgtaactgtgaaagttcttgacactccaggaccaccacagaatttggcagtcaaagaagtgagaaaagattctgccttcctggtatgggagccacccatcattgatggaggggcaaaggtcaagaactatgtgattgacaaacgtgagtcaaccagaaaagcgtatgctaatgtgagtagtaaatgcagcaaaacaagttttaaagtggaaaaccttacagaaggagccatttattacttcagagtcatggctgaaaatgaatttggagttggtgttccagtggaaactgttgatgccgtgaaagctgctgaacctccttccccaccaggaaaggttacactcactgatgtgtcccagaccagtgcatcacttatgtgggagaaacctgaacatgatggcggtagcagagtcctggggtacgttgttgaaatgcagcccaaaggaactgaaaaatggagcattgtggctgaatccaaagtctgtaatgcagttgttactggtttgagttctggacaagaatatcagttccgtgtcaaggcttataatgagaaaggaaaaagcgatccaagagtgttgggtgttcctgtcatagccaaggacttgactatacagcctagtttaaagttaccatttaacacatatagtatccaagctggagaagatcttaaaatagaaattccagttataggccgaccaagacctaacatttcttgggtcaaagatggtgagcctcttaaacagacaacaagagtaaacgttgaagaaacagctacctcaactgttttgcacattaaagaaggtaacaaagatgactttggaaaatacaccgtaacggcaacaaatagtgcaggcacagcaacagaaaatctcagtgttatcgttttagaaaagcctggacctccagttggcccagttcggtttgatgaagttagtgcagactttgtagtcatatcttgggaacctccagcctatactggtggctgccaaataagcaactacattgtagagaagcgagatacaaccaccaccacttggcacatggtatcagcaacagttgcaagaacaacaattaaaataaccaaactgaaaacaggcacggagtaccagtttagaatttttgctgaaaacaggtatggaaaaagtgccccactggattctaaggcagttattgtacaatatccatttaaagaacctggaccacctggaactccttttgtgacatcaatctcaaaagatcagatgcttgtgcaatggcatgagccagtgaatgatggaggcaccaaaattattggctaccatcttgaacagaaagaaaagaacagtattttatgggtcaagttaaataagacccccattcaggacaccaaattcaaaacaactgggcttgatgagggccttgagtatgagttcaaagtttctgctgaaaatattgttggcattggcaagcctagcaaagtgtcagaatgctttgttgctcgtgatccatgtgacccacctggtcgccctgaagccattgttattacaagaaacaatgtcacactgaaatggaagaaacctgcctatgatggtggtagcaaaataacaggttatattgtagaaaagaaagatctacctgatggccgctggatgaaagccagctttaccaacgtattagaaactgaatttacagtgagtggacttgtagaagaccaaagatatgaatttagagtaattgcaagaaatgcagctggaaactttagtgaaccatctgatagtagtggtgccattactgcaagagatgaaattgatgcaccaaatgcctctctggatccaaaatataaagatgtcatcgttgttcatgcaggagagacttttgttcttgaagccgacatccgtggcaaacctatacctgatgttgtttggtcaaaagatggaaaagaacttgaagaaacagctgctagaatggaaattaaatctactattcagaaaacaactcttgttgtcaaagactgtatacggactgatggaggacaatatattctgaaactcagcaatgttggtggtacaaagtctatacccatcactgtaaaggtacttgacaggccagggcctcctgaagggcctctgaaagttactggagttactgcggaaaaatgttacctggcatggaacccacctttgcaagatggtggtgctaatatttcacattacatcattgaaaagagggagacaagccgactctcttggacccaggtttcaactgaggtacaggcccttaactacaaagttactaaacttcttcctggtaatgagtacattttccgtgtcatggctgtgaataaatatggaattggagagcccttggaatctgggcctgttacggcctgtaatccttataagccaccaggtcctccctcaacacctgaagtctcagcaatcaccaaagattctatggtagtaacatgggcacgcccagtagacgacggaggtaccgaaattgagggctacattcttgaaaaacgagataaggaaggcgttagatggaccaagtgcaacaagaaaacattaacggatctgcggctcagggtaactggtcttaccgaaggccattcctatgaattcagagttgctgctgaaaatgcagctggtgtgggagaacctagtgagccatctgttttctaccgtgcgtgtgatgccttgtatccaccaggtcccccaagcaatccaaaagtgacggacacttccagatcttctgtctccctggcatggagtaagccaatttatgatggtggcgcacctgttaaaggctatgttgtagaggtcaaagaagctgctgcggatgaatggacaacctgcactccaccaacaggattacaaggaaagcagttcacagtgaccaagcttaaagaaaacactgaatataacttccgtatttgtgccatcaattctgaaggtgtaggtgaacctgcaactctacctggctcagtggttgctcaggagaggatagagccaccagaaatagaactcgatgctgatctcagaaaggtggtcgttctgcgtgcaagtgctactttacgcttatttgtcactatcaaaggtcgaccagaacccgaagttaaatgggaaaaggcagaaggcattctcactgacagggctcagatagaggtgaccagctcatttacaatgttggtgattgataatgttaccagatttgacagtggtcggtataatctgacattagaaaataatagtggctccaaaacagcttttgttaacgtcagagttcttgactcaccaagtgcccctgtgaatttgaccataagagaagtgaagaaagactcagtgacgttgtcctgggaaccaccacttattgatggtggagctaagattacaaactacattgtcgaaaaacgagaaactacaagaaaagcctatgctaccattacaaataattgcactaaaactactttcagaattgaaaatctacaagaaggatgttcttactacttccgagtcttggcttccaatgaatatgggattggtttgccagctgaaacaacagaacccgttaaagtgtctgaaccacccctcccacctggaagagtaactcttgttgatgtgacccgtaatacagctacaattaagtgggagaaaccagaaagtgatggtggcagcaaaattactggttatgtggttgaaatgcagactaaagggagtgaaaagtggagcacctgcacacaagttaagactctagaagcaactatatctggcttaactgcaggagaagagtatgtcttcagggtagctgcagttaacgaaaagggaagaagtgatccaagacaacttggagtgccagtaattgcaagggatattgaaataaagccttcagttgagcttcctttccatactttcaatgtaaaggctagagaacaacttaagattgatgtgccattcaaaggaagacctcaagctactgtgaactggagaaaagatggtcagactcttaaagagacaactagagtcaatgtttcttcttcaaagactgtaacatcactatctattaaggaagcttcaaaggaagatgttggaacttatgaattatgtgtttcaaacagtgctggatccataacagttcctattactataattgtccttgacagaccaggacctccaggtcctatacgtattgatgaggttagttgtgacagcataaccatttcttggaatcctccagaatatgatggtggctgccaaattagcaattacattgttgaaaagaaagaaaccacctctacaacatggcacatagtttcacaagcagttgcaagaacatccattaaaatagttcgcctgacaacaggaagtgagtatcagttccgtgtttgtgcagaaaaccgctatggaaagagctcctacagtgaatcttcagctgttgttgcagagtatccattcagtcccccaggtcctcctggtactcctaaagttgtgcatgccacaaaatctaccatgcttgtaacctggcaagtgccagttaatgatggaggaagtcgagtaattggctatcatcttgagtataaagaaagaagcagcattctttggtcaaaagcaaataaaatcctcattgctgatactcaaatgaaagtctccggccttgatgaaggactgatgtatgagtatcgtgtatatgctgaaaatattgctggaattggtaaatgcagtaaatcttgtgaaccagtccctgcaagagatccttgtgaccctcctggacaacctgaagtcacaaatatcacaagaaaatcagtgtcacttaaatggtctaaaccacattatgatggtggagctaagatcacaggatacattgttgaacgcagagaactaccagatggccggtggctgaagtgcaattatactaatatacaagaaacatactttgaagtaactgaacttactgaagatcagcgttatgaattccgggtttttgcaaggaatgctgctgactcagttagtgagccatctgaatccactgggcctattatagttaaagatgatgttgagcctccaagagttatgatggatgtcaagttccgagacgttattgttgtcaaagctggagaggtccttaagataaatgcagacattgcagggcgacctctgccagtaatttcctgggccaaggatggtatagaaattgaagaaagagcaagaacagaaatcatctcaacagacaatcatactttgttaacagttaaagactgtataagacgagacactgggcaatatgtactaacactgaagaatgttgccggcactcggtctgtggccgttaattgcaaagtacttgataagcctggtccaccagcaggaccacttgaaataaatggcctcactgctgagaaatgctctctttcctggggacgtccccaagaagatggtggtgcagatatcgactattacatcgtagaaaaacgtgaaacaagccaccttgcatggacaatatgtgaaggagagttacagatgacatcctgtaaagtaaccaagttactcaaaggcaatgaatatatatttagagtaactggtgttaataaatatggtgttggtgagcccctagagagtgtagctataaaggcactagatccatttacagttccaagtccacccacgtctttggaaattacttctgtgaccaaagaatctatgacactttgctggtcaagacccgagagtgatggaggtagtgaaatatctggatatataattgaaaggcgagagaaaaatagcctaagatgggtgcgtgtaaacaaaaaaccagtttatgatctaagagtgaaatcaacaggacttcgggaaggatgtgaatatgaatatcgtgtttatgcagaaaatgctgctggcctaagtcttccaagtgaaacctctcccttaattagggcagaagatccagtgttcctaccatctcctccatccaaacccaaaattgtggactcaggcaagacaactataactattgcctgggttaagccgctgtttgatggtggggccccgataactggatatactgtagaatacaaaaaatctgatgacactgactggaaaacttccattcagagcttacgagggacagaatatacaataagcggactaacaacaggagctgaatatgttttcagagtaaaatctgtcaataaggttggtgctagtgaccccagtgatagctctgaccctcagatagcaaaggaaagagaagaagaacctttatttgatattgacagtgaaatgaggaagaccttgattgtcaaggctggtgcctcatttaccatgactgtgcctttccgaggaagaccagtacccaatgtcttgtggagtaagccagacactgacctccgtactagagcttatgttgataccacagactctcgtacatcactgaccattgaaaatgccaacagaaatgactctggaaagtacacattaacaattcagaatgttttgagtgctgcttcactgaccttagttgtcaaagttttagataccccaggtcctccaaccaacattactgtgcaagatgtaaccaaagagtctgcagtgttatcctgggatgttcctgaaaacgatggtggagcaccagtgaagaattaccacatagaaaaacgtgaggccagcaagaaagcatgggtctctgtgaccaacaactgtaaccgcctctcctacaaagttaccaatttacaagaaggagctatctattacttcagagtctctggagaaaatgagtttggtgttggtataccagctgaaacaaaggaaggagtaaaaataacagaaaaaccaagcccacctgaaaaacttggagtaacaagtatatccaaagacagtgtttccctgacctggctgaagcctgaacatgatggcggaagcagaattgtacactatgtcgttgaagcactagaaaaaggacagaaaaactgggttaaatgtgcagtggcaaagtcaacccatcacgttgtttccggtctgagagagaattctgaatactttttccgagtgtttgctgaaaatcaagctggcctgagtgacccgagagagcttctgcttcctgttcttattaaggagcaactagaaccacctgaaattgatatgaagaatttcccaagtcacactgtatatgttagagctggttcaaaccttaaagttgacattccaatctctggaaaaccacttcccaaagtgaccttatcaagagatggtgtcccccttaaggcaaccatgagatttaataccgaaattactgctgagaacctgaccatcaatctcaaagaaagtgttacagctgacgctgggagatatgaaatcactgctgccaactccagtggtacaaccaaagctttcattaacattgttgtgctagacaggcctggtcctccaactggccctgttgttattagtgatataactgaagaaagtgtgactctcaaatgggagccacctaagtatgacggtggaagtcaagttaccaactacattctactcaaaagagaaacaagtactgcagtgtggactgaagtgtctgcaacagttgcaagaaccatgatgaaagtcatgaaactgaccacaggagaagaataccaattccgcatcaaggcagaaaaccgctttggcatcagtgatcatatagattcagcttgtgtgactgtcaaactaccatacacaacacctggaccaccatctacaccatgggtcactaatgttactcgagaaagcatcactgtgggctggcatgaaccagtgtcaaatggaggcagtgcagtcgtaggctatcacctggaaatgaaagacagaaacagtattttatggcaaaaagccaacaaactggtcatccgcacaactcacttcaaagtcacaacaatcagtgctggacttatttatgaattcagggtgtatgcagaaaatgctgctggagttggaaaacctagccatccttctgaaccagtcttggcaattgatgcttgtgaacccccaagaaatgttcgtatcactgatatttcaaagaactctgtcagcctttcatggcaacaaccagctttcgatggaggtagcaagattacaggctacattgttgagagacgtgaccttccagatggcagatggaccaaggccagcttcaccaatgttactgaaactcaattcatcatctctggcttgactcagaattcccagtatgaattccgtgtctttgctaggaatgctgttggttccattagcaatccatctgaggttgtagggcccattacttgcatcgattcttatggtggtcctgtaattgatttgcctctagaatatacagaagttgtcaaatacagagcaggtacatctgtgaagctcagagctggcatttctggcaaacctgcgcctactattgagtggtataaagatgataaagaattacaaaccaatgcactggtgtgtgttgaaaataccacggacctcgcatctatactcatcaaagatgccgatcgccttaatagtggatgctatgaattaaaactaaggaatgccatgggctcagcctcagccaccatcagagtacagatccttgacaaaccaggcccacctggtggaccaattgaatttaagactgtaactgctgagaagatcacccttctctggcggcctccagctgatgatggtggtgcaaaaatcactcactacattgtggaaaagcgtgagacaagccgcgttgtgtggtctatggtgtctgaacatttggaagagtgcatcattacaaccaccaaaattatcaaaggaaatgaatacatcttccgggtccgagccgtgaacaaatatggaattggcgagccactggaatctgattccgttgtagccaagaacgcatttgttacacctgggccaccaggcataccagaagtgacaaagattaccaagaattcgatgactgttgtatggagcaggccaattgcagatggcggtagtgatataagtggctatttccttgaaaaacgagacaagaagagcctaggatggtttaaagtactaaaagagactatccgtgacaccagacaaaaagtaacaggactcacagaaaacagtgactatcaatacagagtttgtgctgtaaacgctgctggacagggtccattttctgaaccatctgaattctacaaagctgctgatcctattgatcctccaggtccacctgctaagataagaatcgcagattcaaccaagtcatccatcacccttggctggagtaagcctgtctatgatgggggcagtgctgttactgggtatgttgtcgagataagacaaggagaggaagaggaatggactactgtctctaccaaaggagaggtcagaactacagaatatgtggtatccaacctgaaacctggagtcaattactacttccgggtatctgctgtaaactgtgctggacaaggagaacctatagaaatgaatgaacctgtacaagctaaagatatacttgaggcaccagagattgacctggatgtggctctcagaacttctgttattgccaaagctggtgaagatgtacaagtgttgattccctttaaaggcagacctccacctactgtcacatggagaaaagatgagaagaatcttggcagtgatgccagatacagcattgaaaacactgattcatcctcattactcaccattcctcaagttactcgcaatgatacaggaaaatatattctcacaatagaaaatggagttggtgaacctaagtcttcaactgtgagtgttaaagtgcttgacacaccagctgcctgccagaaactacaggttaaacatgtttctcgaggcacagtcactttgctctgggatcctcctctcattgatggaggatctccaataattaattatgtcattgaaaagagagatgccaccaagagaacatggtctgtcgtgtcacacaaatgttctagcacatccttcaagctaatagatttgtcggagaagactccattcttcttcagagttcttgcagaaaatgaaattggaattggggaaccctgtgaaactacagagccagtgaaggctgctgaagtaccagctcctatacgtgatctctcaatgaaagactcaacaaagacatctgtcatcctcagctggaccaaacctgactttgatggtggtagcgtcatcacagaatatgttgtagaaaggaaaggtaaaggtgaacagacgtggtcccacgctggcataagtaagacatgtgaaattgaggttagccaacttaaggagcagtcagtcctggagttcagagtgtttgccaaaaatgagaaaggactgagtgatcctgtcactattgggccaattacagtgaaagaacttattattacacctgaagttgacctgtcagatatccctggggcacaagtcactgtgagaattgggcacaatgtgcaccttgaattaccttataagggaaaacccaaaccatccatcagttggctgaaagatggcttgccactgaaagaaagtgaatttgttcgcttcagtaaaactgaaaacaaaattactttgagtattaagaatgccaagaaggagcatggaggaaaatacactgttattcttgataatgcagtgtgtagaattgcagtccccattacagtcatcacccttggcccaccatcaaagcccaaaggacccattcgatttgatgaaatcaaggctgatagtgtcatcctgtcatgggatgtacctgaagataatggaggaggagaaattacttgttacagcatcgagaagcgggaaacttcacaaactaactggaagatggtgtgttcaagtgttgccagaacgactttcaaagttcctaatctagtcaaagatgctgagtaccagtttagagtgagagcagaaaacagatacggagtcagccaaccacttgtctcaagcattattgtggcaaaacaccagttcaggattcctggtcccccaggaaagccagttatatacaatgtgacttctgatggcatgtcactaacttgggatgctccagtttatgatggtggttcagaagttactggattccatgttgaaaagaaagaaagaaatagcatcctctggcaaaaagttaatacatcaccaatctctggaagagaatatagagccactggactggtagaaggtctggattaccaattccgtgtatatgctgaaaattctgctggcctaagctcacctagtgacccaagcaaatttaccttagctgtttctccagtagacccacctggcactcctgactacattgatgtcacccgggaaaccatcacacttaaatggaacccaccattgcgtgatggaggcagtaagattgtgggctatagcattgagaaacggcaaggaaatgaacgctgggtgagatgcaactttactgacgtcagtgaatgtcagtacacagttacaggactcagtcctggggatcgctatgagttcagaataattgcaagaaatgctgttggaactataagcccgccctcacagtcttctggcattattatgacaagagatgaaaatgttccaccaatagtagagtttggccctgaatactttgatggtctcattattaagtccggagagagccttagaattaaagctttggtacaaggaagaccagtgcctcgagtaacttggttcaaagatggagtggaaatcgaaaagaggatgaatatggaaataaccgacgtacttggatccaccagcctatttgttagagatgctactcgggaccatcgtggtgtatacacagtggaagccaaaaatgcatctggttctgcaaaagcagaaattaaagtgaaagtacaagatacaccaggaaaagtagttgggccaataagattcaccaatattactggggagaagatgactctgtggtgggatgccccactcaatgacggttgtgctcccataacccactacatcattgaaaaacgggaaaccagcagacttgcctgggcactaattgaggataaatgtgaagcccaaagttacactgccattaaactaataaacggcaatgaataccaattccgtgtttctgcagttaacaagtttggtgttggcaggccacttgattctgatccagtggttgctcaaatacaatatactgttcctgatgcccctggcattccagaacctagcaacataacaggcaacagcattaccctgacatgggcaaggccagaatcagatggtggcagtgaaattcaacagtatatccttgaaagaagagaaaagaaaagcacaagatgggtaaaagtgatcagcaaacgaccaatctctgaaacaagattcaaagtcactggtctgacagaaggcaatgagtatgaattccatgtcatggctgaaaatgctgcaggagttggacctgcaagtggcatctcaagactcattaaatgtagagagcccgtcaacccaccaggtcctcccacagtggtcaaagtaacagacacatcaaagacaactgtgagcttagaatggtccaaaccagtgtttgatggtggcatggaaataattgggtatattattgaaatgtgtaaggccgacttaggagactggcacaaggtgaatgcagaggcatgtgtgaaaacaagatatacagtcactgatctacaagcaggtgaagaatacaaattccgagttagtgctatcaatggtgctggaaaaggcgacagctgtgaagtgactggcacaattaaagcagttgaccggttaacagctcctgagttagacatagatgcaaacttcaaacagactcatgttgttagagctggggccagtattcgcctcttcattgcctaccaaggtagacctactcctacagctgtgtggagcaaaccagactctaaccttagccttcgggctgatatccatacaacagattccttcagcaccctcactgtggaaaactgcaacagaaatgatgcagggaaatatacccttactgtggaaaacaacagtggtagtaagtcaatcacattcaccgtgaaagtgctagacactccaggcccacctggcccaattaccttcaaagatgtgacccggggatctgctacattgatgtgggatgcccctcttcttgacggtggtgcccgaatccatcattatgtggtagagaaacgagaggcaagtcgccgtagttggcaggttatcagtgaaaaatgcactcgtcagatcttcaaggtcaatgacctggccgaaggtgttccgtactatttccgtgtttctgcagtaaatgagtatggtgttggtgagccctatgaaatgccagaaccaattgtagccacagaacagcctgctccacctaggagacttgatgttgttgatactagcaaatcctccgcagtcttagcttggcttaaacctgaccacgatggaggcagccggatcactggctacctgcttgaaatgagacaaaagggatctgacttctgggttgaagctggtcacaccaaacagctaactttcacagtagagcgtcttgttgagaaaactgaatatgaattccgtgtgaaggccaagaatgatgctggctatagtgaacccagagaagccttctcttctgtcatcattaaggagcctcaaatcgagcccactgctgacctcactggaattaccaatcagcttataacttgcaaagcaggaagcccatttaccattgacgtaccaatcagtggtcgtcctgcccccaaagtaacatggaaactggaagaaatgagacttaaagagacagatcgagtgagcattacaacaacaaaagacagaaccacactgactgtaaaggacagcatgagaggtgactctggaagatacttcttgaccctggaaaatacagctggtgttaaaacatttagcgtcacagttgtggtcattggaaggccaggtccagtaaccggccccattgaggtctcatctgtctcagctgaatcgtgtgtcctgtcatggggagaacctaaagatggaggaggcactgaaattactaattacatagttgaaaagcgtgaatcgggtacaacagcttggcagcttgtcaattccagtgtcaagcgcactcaaattaaagtcactcatctcacaaaatacatggaatattctttccgtgtcagttcagagaacagatttggtgtcagcaaacctctagaatcagcaccaataattgctgaacatccatttgtcccaccaagcgctcctaccagacctgaggtctaccatgtgtctgccaatgccatgtctattcgttgggaagaaccctaccacgatggtggcagtaaaatcattggctactgggttgagaagaaagaacgtaatacaattctttgggtgaaagaaaacaaagtgccatgcttagagtgcaactacaaagtaactggtttagtagaaggactggaatatcagttcagaacttatgcactcaatgctgcaggtgttagcaaggccagcgaagcttcaagacctataatggctcaaaatccagttgatgcaccaggcagaccagaggtgacagatgtcacaagatcaacagtatcactgatttggtctgccccagcgtatgatggaggcagcaaggttgtgggctacatcatagagcgtaagccagtcagtgaggtaggagatggtcgctggctgaagtgcaactacaccattgtatctgacaatttcttcaccgtgactgctctcagtgaaggagacacttatgagttccgtgtgttagccaagaatgcagcaggcgtaattagcaaagggtctgaatctacaggccctgtcacttgccgagatgaatacgctccacccaaagccgaactggatgcccgattacacggtgatctggttaccatcagagcaggttctgatcttgttctggatgctgcagttggtggcaaacctgaacccaaaattatctggaccaaaggagacaaggagctagatctctgtgaaaaagtctctttgcagtatactggcaaacgagcaactgctgtgatcaagttctgtgacagaagtgacagtggaaaatacactttaacagtgaaaaatgccagcgggaccaaggccgtgtctgtcatggtcaaagtgcttgattcccctggcccatgtggaaagctcaccgtcagcagagtaacacaggagaagtgcactttagcctggagccttccgcaggaagacggaggagcagaaatcactcactacatcgtggaaagacgcgagactagcaggctcaactgggtgattgttgaaggcgaatgcccaaccctatcctatgtcgttaccaggctcatcaagaacaatgagtacatattccgagtgagggcagtaaacaaatatggccctggtgtgcctgttgaatcagagccaattgtagccagaaactcattcactattccatcaccacccggcatacctgaagaagttgggactggcaaagagcatatcatcattcagtggacaaaacctgaatctgatggtggcaatgaaatcagcaactacctagtagacaaacgtgagaagaagagcctgcgctggacacgtgtcaacaaagactatgtggtgtatgataccaggctgaaggtgaccagcctgatggagggttgtgattaccagttccgggtgaccgcagtgaatgcagctggtaacagtgagcccagcgaagcttccaacttcatctcatgcagagaaccatcatatacccctggaccaccttctgctccaagagttgtggataccaccaaacacagcattagtttggcatggaccaaacccatgtacgatggtggtactgacattgtaggatatgttctggaaatgcaagagaaggacactgatcagtggtaccgagtgcataccaatgccacaataagaaatactgaattcactgtgccagaccttaaaatgggccagaaatattccttcagagttgctgccgtgaacgtgaagggtatgagcgaatacagcgaatcaattgctgaaattgagcccgtggaaagaatagaaataccagatcttgagcttgcagatgatctaaagaagactgtgaccatcagggctggggcctccttgcgcttgatggtgtctgtatctggaagaccacctcctgtcataacgtggagcaagcagggcattgaccttgcaagccgggcaattattgacaccactgagagctactcattgctaatagtggacaaagttaatcggtacgatgctggaaaatacacaattgaagctgaaaaccaatctggcaagaaatcagcaacagtccttgttaaagtctatgatactcctggtccctgtccttcagtgaaagttaaggaagtatcaagagattctgtgactataacttgggaaattcccacgattgatggtggagctccagtcaacaattacatcgttgagaagcgtgaagctgctatgagagcattcaaaacagtaactaccaaatgcagcaagacactttacagaatttctggacttgtagaaggaaccatgtactatttcagagtgctgccagaaaatatttatggcattggagaaccttgtgaaacatctgatgcagtactggtctcagaagtgcctttggtgcctgcaaagctagaagtggtcgatgtcaccaaatccactgttacccttgcctgggaaaaaccactctacgatggtggtagccgactcactggatatgttctcgaggcctgcaaagctggcacagagagatggatgaaggttgtcaccttaaaacccacagtcctagagcacactgttacttccttaaatgaaggtgaacaatacttatttagaataagggcacaaaatgagaaaggtgtgtcagaaccaagagagactgtcacagccgtgactgtacaagacctcagagtgttgccaacaatcgatctttctacaatgcctcagaagaccatccatgtcccagctggcagaccagtagagctggtgatacctattgctggccgtccacctcctgctgcttcctggttctttgctggttctaaactgagagaatcagagcgtgtcacagttgaaactcacactaaagtagctaaattaaccatccgtgaaaccactatcagagatactggagaatacacacttgaattgaagaatgttaccggaactacttcagaaaccattaaagttatcattcttgacaagcctggtccaccaacaggacctattaagattgatgaaattgatgctacatcaattaccatttcctgggaaccacctgaattggacggtggtgctccactgagtggttatgtggtagaacaacgtgacgctcatcgtccaggatggctgcccgtttctgaatcagtgactaggtccacgtttaagtttaccagactcaccgaaggaaatgagtatgtgttccgtgtggctgcaacaaaccgcttcgggattggctcttacttgcagtctgaggtcatagagtgtcgcagcagcatccgtattcctggacccccagaaacattacagatatttgatgtttcccgtgatggcatgacacttacttggtacccaccagaggatgacggtggctcccaagtgactggatatattgtggagcgcaaagaagtgagagcagatcgatgggtccgtgtaaataaagtacctgtgacaatgacacggtaccgctccactggccttactgaaggcttagaatatgaacaccgtgtcacagccattaatgcaagagggtctgggaaaccaagtcgtccttccaaacccatcgttgccatggatccaattgctcctccaggaaagccacaaaacccaagagttactgatacaacaaggacatcagtctccctggcctggagtgttccagaagatgaaggaggatctaaagtcacaggctacttgattgaaatgcaaaaagtagatcaacatgaatggaccaagtgtaacaccactccaaccaagattcgagagtatactctaacacacctacctcagggtgcagaatacaggttccgcgtcctagcttgtaatgctggtggacctggtgagcctgctgaggtaccaggaacagtcaaagtcactgaaatgcttgaatatcctgattatgaacttgatgaaagataccaagaaggtatctttgtaaggcaaggtggcgtcatcagacttaccataccaatcaaaggaaaaccattcccaatatgtaaatggaccaaggaaggccaggatattagtaagcgtgccatgattgcaacatctgaaacacacactgagcttgtgatcaaagaagcagacaggggtgattctggcacttatgacctggttctggaaaataaatgtggcaagaaggctgtctacatcaaggtcagggtgataggaagtcccaacagtccagaagggccactggaatatgatgacatccaagtccgctctgtgagggtcagctggagacctcctgctgatgatggtggtgctgacatcttaggctacatcctcgagagacgagaagtgcctaaagccgcctggtataccattgattccagagtccgaggtacatctctggtggtaaaaggcctcaaagagaatgtagaataccatttccgtgtttcagcagaaaaccagtttggcataagcaaacccttgaaatctgaggaaccagtcacaccaaaaacaccattgaatcctccagaacctccaagcaatcctccagaagtactcgatgtaaccaagagttctgttagcttgtcctggtcccggcccaaagatgatggtggttctagagtcacaggctactacatcgaacgcaaagagacatccactgacaagtgggtcagacacaacaagactcagatcaccaccacaatgtacactgtcacagggcttgttcccgatgctgagtatcagttccgcatcatcgcacagaatgatgttggcctgagtgagaccagccctgcttctgaaccagttgtttgcaaagatccatttgataaaccaagccaaccaggagaacttgagattctttcaatatccaaagatagtgtcactctacagtgggagaaacctgaatgtgatggtggtaaagaaattcttggatactgggttgaatatagacagtctggagacagtgcctggaagaagagcaataaggaacgtattaaggacaagcaattcacaataggaggtttgctggaagctactgagtatgaattcagggtttttgctgagaatgagactgggctgagcagacctcgcagaactgctatgtctataaagactaaactcacatctggagaggccccaggaatacgcaaagaaatgaaggatgttaccacaaaattgggtgaagctgctcaactctcatgccagattgttggaaggcctcttcctgacattaaatggtacagatttggtaaagagctcatacaaagccggaaatacaaaatgtcttcagatggacgcacacacactcttacagtaatgacagaggaacaggaagatgaaggtgtttatacctgcatagccaccaatgaggttggagaagtagaaaccagtagtaagcttctcctgcaagcaacaccgcagttccatcctggttacccactgaaagagaaatattatggagctgtgggttccacacttcggcttcatgttatgtacattggtcgtccagtacctgccatgacttggttccatggtcagaaacttttgcaaaactcagaaaacattactattgaaaacactgagcactatactcatcttgtcatgaagaatgtccaacgtaagactcatgctgggaaatacaaagtccagctcagcaatgtttttggaacagttgatgccatccttgatgtggaaatacaagataaaccagacaaacctacaggaccaattgtgatcgaagctctattgaagaactccgcagtgatcagctggaaaccacccgcagatgacggaggctcctggatcaccaactatgtggtggaaaaatgtgaggccaaggagggggctgaatggcaattggtgtcttcagccatctcagtgacaacctgtagaattgtgaacctcacagaaaatgctggctattacttccgggtttcagctcagaacactttcggcatcagtgaccctctagaagtgtcctcagttgtgatcattaagagtccatttgaaaagccaggtgctcctggcaaaccaactattactgctgtcacaaaagattcttgtgttgtggcctggaagccacctgccagtgatggaggtgcaaagattagaaattactaccttgagaagcgtgagaagaagcagaataaatggatttctgtgacaacagaagaaattcgagaaactgtcttttcagtgaaaaaccttattgaaggtcttgaatacgagtttcgtgtgaaatgtgaaaatctaggtggggaaagtgaatggagtgaaatatcagaacccatcactcccaaatctgatgtcccaattcaggcaccacactttaaagaggaactgagaaatctaaatgtcagatatcagagcaatgctaccttggtctgcaaagtgactggtcatccaaaacctatcgtcaaatggtacagacaaggcaaagaaatcattgcagatggattaaaatataggattcaagaatttaagggtggctaccaccagctcatcattgcaagtgtcacagatgatgatgccacagtttaccaagtcagagctaccaaccaagggggatctgtgtctggcactgcctccttggaagtggaagttccagctaagatacacttacctaaaactcttgaaggcatgggagcagttcatgctctccgaggtgaagtggtcagcatcaagattcctttcagtggcaaaccagatcctgtgatcacctggcagaaaggacaagatctcattgacaataatggccactaccaagttattgtcacaagatccttcacatcacttgttttccccaatggggtagagagaaaagatgctggtttctatgtggtctgtgctaaaaacagatttggaattgatcagaagacagttgaactggatgtggctgatgttcctgacccacccagaggagtcaaagttagtgatgtctcacgagattctgtcaacttaacatggactgagccagcctctgatggtggcagcaaaatcaccaactacattgttgaaaaatgtgcaactactgcagaaagatggctccgtgtaggacaggcccgagaaacacgttataccgtgatcaacttatttggaaaaacaagttaccagttccgggtaatagctgaaaataaatttggtctgagcaagccttcagagccttcagaaccaaccataaccaaagaagataagaccagagctatgaactatgatgaagaggtagatgaaaccagggaagtctccatgactaaagcatctcactcttcaaccaaggaactctatgagaaatatatgattgctgaagatcttgggcgtggtgagtttggaattgtccatcgttgtgttgaaacatcctcaaagaagacatacatggccaaatttgttaaagtcaaagggactgatcaggttttggtaaagaaggaaatttccattctgaatattgctaggcatagaaacatcttacacctccatgaatcatttgaaagcatggaagaattagttatgatctttgagtttatatcaggacttgacatatttgagcgcattaacacaagtgcttttgaacttaatgaaagagaaattgtaagttatgttcaccaggtctgtgaagcacttcagtttttacacagtcataatattggacactttgacattagaccagaaaatatcatttaccaaaccagaagaagctctaccattaaaatcatagaatttggtcaagcccgtcagctgaaaccaggggacaacttcaggcttctattcactgccccagaatactatgcacctgaagtccaccagcatgatgttgtcagcacagccacagacatgtggtcacttggaacactggtatatgtgctattgagtggtatcaacccattcctggctgaaactaaccaacagatcattgagaatatcatgaatgctgaatatactttcgatgaggaagcattcaaagagattagcattgaagccatggattttgttgaccggttgttagtgaaagagaggaaatctcgcatgacagcatcggaggctctccagcacccatggttgaagcagaagatagaaagagtcagtactaaagttatcagaacattaaaacaccggcgttattaccacaccctgatcaagaaagacctcaacatggttgtgtcagcagcccggatctcctgtggtggtgcaattcgatctcagaagggagtgagtgttgctaaagttaaagtggcatccattgaaattggcccagtttctgggcagataatgcatgcagttggtgaagaaggaggacatgtcaaatatgtatgcaaaattgaaaattatgatcagtctacccaagtgacttggtactttggcgtccgacagctggagaacagtgagaaatacgaaatcacctacgaagatggagtggccatcctctatgtcaaagacattaccaaattagatgatggtacctacagatgcaaagtagtcaatgactatggtgaagacagttcttatgcagagctatttgttaaaggtgtgagagaagtctatgactattactgccgtagaaccatgaagaaaattaagcgcagaacagacacaatgagactcctggaaaggccaccagaatttaccctgcctctctataataagacagcttatgtaggtgaaaatgtccggtttggagtaactataactgtccacccagagcctcatgtaacatggtataaatcaggtcagaaaatcaaaccaggtgacaatgacaagaagtacacatttgagtcagacaagggtctttaccaattaacaatcaacagtgtcactacagatgatgacgctgaatatactgttgtggcaaggaacaaatatggtgaagacagctgtaaagcaaagctgacagtaaccctacacccacctccaacagatagtaccttaagacccatgttcaaaaggttactggcaaatgcagaatgccaagaaggccaaagtgtctgctttgagatcagagtgtctggcatccccccaccaacattaaaatgggagaaagatggtcagccactgtccctcgggcctaacattgaaattatccatgaaggcttggattattatgctctgcacatcagggacactttgcctgaagacacgggttattatagagtcacagccactaacacagctgggtccaccagctgccaggctcacctacaagtggaacgcctgaggtacaagaaacaggaattcaagagtaaggaggagcatgagcgacacgtacaaaaacaaattgacaaaaccctcagaatggctgaaattctttctggaactgaaagtgtaccactgacacaggtagctaaagaggctctgagagaagctgctgtcctttataaaccggctgtaagcaccaagactgtaaaaggggaattcagacttgagatagaagaaaagaaggaggagagaaaactccggatgccttatgatgtaccagagccacgcaagtataagcagactaccatagaagaagaccaacgcatcaagcagttcgtgcccatgtctgacatgaagtggtataaaaagatacgtgatcagtatgaaatgcctgggaaacttgacagagttgtacagaaacgacccaagcgcatccgcctttcaagatgggaacagttctatgtgatgcctcttccacgcattacagatcaatacagacctaaatggcgtattcctaaactgtcccaagatgatcttgagatagtgagaccagcccgccggcgtacaccttctcctgattatgacttttactaccgacctagaagacgttctcttggggacatctctgatgaagaattactcctccccattgatgactacttagcaatgaaaagaacagaggaagagaggctgcgtcttgaagaagagcttgagttaggtttttcagcttcacccccaagtcgaagccctccacactttgagctttctagcctacgttactcttcaccacaagctcatgtcaaggtggaggaaacaagaaaagacttcaggtattcaacctatcacatcccaacgaaggctgaagctagtacaagttatgcagaactgagggaacggcatgcccaggctgcgtacagacagccaaagcaacggcaaagaatcatggctgagagggaggatgaagagttgcttcgcccagttacgaccacccagcatctctcagaatacaaaagcgaacttgacttcatgtcaaaggaggaaaagtctagaaagaaatcaaggcgacaaagagaagtgacagaaataacagaaattgaggaagaatacgaaatctcaaaacatgctcaaagagaatcatcctcatctgcgtctagactactgagacgacggcgctccctgtctccaacttatattgagttaatgaggccagtgtctgagctgatccggtcacgtccacaaccggctgaggaatacgaagatgacacagaaagaaggtcacctactccagagagaactcgcccacgatcccccagccctgtgtctagtgagagatcactctcgagatttgagaggtctgcaagatttgatatcttttccaggtatgagtccatgaaagctgctttaaaaactcagaagacatcagaaaggaagtatgaagttttgagtcagcagcctttcacactggaccatgcccctcgaatcacactgagaatgcgctcgcacagggtaccatgtggccaaaatacacgttttattttaaatgttcagtctaagccaactgccgaggttaaatggtaccacaatggtgtggaactccaagaaagcagtaagattcattacaccaacacgagtggagtcctcaccctggaaattctggactgtcatactgatgacagtggaacctaccgtgctgtgtgcaccaactacaagggcgaagcttctgactatgcaacgttggacgtgacaggaggggattataccacctatgcttcccaacgcagagatgaagaggtccccagatctgttttccctgagctgacaagaacagaggcgtatgctgtttcatcatttaagaaaacatctgagatggaagcttcgtcttctgtcagggaagtgaaatcacagatgacggagacaagggaaagtctctcctcatatgaacactctgcatctgcagaaatgaaaagtgctgcattagaagaaaagtcactggaagaaaaatccacaaccagaaagatcaagacgactttggcagcaagaattctaacaaagccacggtccatgaccgtctacgagggcgagtctgcaaggttttcttgtgacaccgatggtgagccggtaccaactgtgacctggctgcgtaaaggacaagtgctaagtacttctgcccgccaccaagtgaccaccacaaagtacaaatcaacctttgagatctcttcagtccaggcttccgatgagggcaattacagcgtggtggtagaaaacagtgaagggaaacaagaagcagagttcactctgactattcaaaaggccagggtaactgaaaaggctgtgacatcaccaccaagagtcaaatccccagagcctcgggtgaaatccccagaagcagttaagtctccaaaacgagtgaaatctccagaaccttctcacccgaaagccgtatcacccacagagacaaaaccaacaccaacagagaaagttcagcacctcccagtctctgccccaccaaagattactcagttcctgaaagcagaagcttctaaagagattgcaaaactgacctgtgtggttgaaagcagtgtattaagggcaaaagaggtcacctggtataaagatggcaagaaactgaaggaaaatgggcatttccagtttcattattcagcagatggtacctatgagctcaaaatcaataacctcactgaatctgatcaaggagaatatgtttgtgagatttctggtgaaggtggaacgtctaaaaccaacttacaatttatggggcaagcctttaagagtatccatgagaaggtatcaaaaatatcagaaactaagaaatcagatcagaaaaccactgagtcaacagtaaccagaaaaactgaaccaaaagctcctgaaccaatttcctcaaaaccagtaattgttactgggttgcaggatacaactgtttcttcagacagtgttgctaaatttgcagttaaggctactggagaaccccggccaactgccatctggacaaaagatggaaaggccattacacaaggaggtaaatataaactctctgaagacaagggagggttcttcttagaaattcataagactgatacttctgacagtggactttatacttgtacagtaaaaaattcagctggatctgtgtcctctagctgcaaattaacaataaaagctataaaagatactgaggcacagaaagtctctacacaaaagacttctgaaattacacctcagaagaaagctgttgtccaagaggaaatttcccaaaaagccctaaggtctgaagaaattaagatgtcagaggcaaaatctcaagaaaagttagccctcaaagaggaagcttcaaaggttctgatttctgaagaagtcaagaaatcagcagcaacctccctggaaaaatccattgtccatgaggaaatcactaaaacatcacaggcatcagaagaagtcagaactcatgctgagattaaagcattttctactcagatgagcataaacgaaggtcaaagactggttttaaaagccaacattgctggtgccactgatgtgaaatgggtactgaatggcgtagagcttaccaactctgaggagtaccgatatggtgtctcaggcagcgatcagaccctaaccatcaagcaagccagtcacagagatgaaggaatcctcacctgcataagcaaaaccaaggaaggaatcgtcaagtgtcagtatgatttgacactgagcaaagaactctcagatgctccagccttcatctcacagcctagatctcaaaatattaatgaaggacaaaatgttctctttacttgtgaaatcagtggcgagccatcccctgaaatcgaatggtttaaaaacaacctgccaatttctatttcttcaaatgtcagcataagccgctccagaaatgtatactcccttgaaatccgaaatgcatcagtcagcgacagtggaaagtacacaattaaggccaaaaatttccgtggccagtgttcagctacagcttccttaatggtccttcctctagttgaagaaccttccagagaggtagtattgagaacaagtggtgacacaagcttgcaaggaagcttctcgtctcagtcagtccaaatgtctgcctccaagcaggaggcctccttcagcagtttcagcagcagcagtgctagcagcatgactgagatgaaatttgcaagcatgtctgcccaaagcatgtcctccatgcaagagtcctttgtagaaatgagttccagcagctttatgggaatatctaatatgacacaactggaaagctcaactagtaaaatgcttaaagcaggcataagaggaattccgcctaaaattgaagctcttccatctgatatcagcattgatgaaggcaaagttctaacagtagcctgtgctttcacgggtgagcctaccccagaagtaacatggtcctgtggtggaagaaaaatccacagtcaagaacaggggaggttccacattgaaaacacagatgacctgacaaccctgatcatcatggacgtacagaaacaagatggtggactttataccctgagtttagggaatgaatttggatctgactctgccactgtgaatatacatattcgatccatttaagagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacggactaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaatgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatataatacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagttttgtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggagaaagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacatactgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtccacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaatcagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgtcttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaagtgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctgaatagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtattcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgtggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagcaaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaattgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagttataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctcaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7273 -> Molecular function: GO:0002020 [protease binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IMP
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: ISS
            GeneID:7273 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0043621 [protein self-association] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051015 [actin filament binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:7273 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0002576 [platelet degranulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0003300 [cardiac muscle hypertrophy] evidence: IMP
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0007076 [mitotic chromosome condensation] evidence: IEP
            GeneID:7273 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030240 [skeletal muscle thin filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0030241 [skeletal muscle myosin thick filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0035995 [detection of muscle stretch] evidence: TAS
            GeneID:7273 -> Biological process: GO:0043056 [forward locomotion] evidence: IEA
            GeneID:7273 -> Biological process: GO:0045214 [sarcomere organization] evidence: IMP
            GeneID:7273 -> Biological process: GO:0045859 [regulation of protein kinase activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048739 [cardiac muscle fiber development] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048769 [sarcomerogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0050790 [regulation of catalytic activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0051592 [response to calcium ion] evidence: IDA
            GeneID:7273 -> Biological process: GO:0055003 [cardiac myofibril assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0055008 [cardiac muscle tissue morphogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:7273 -> Cellular component: GO:0000794 [condensed nuclear chromosome] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005865 [striated muscle thin filament] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0030018 [Z disc] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IEA
            GeneID:7273 -> Cellular component: GO:0031674 [I band] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001243779 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.