GGRNA Home | Help | Advanced search

2024-04-26 21:08:05, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001256379            4102 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens minichromosome maintenance complex binding protein
            (MCMBP), transcript variant 3, mRNA.
ACCESSION   NM_001256379
VERSION     NM_001256379.1  GI:373838728
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4102)
  AUTHORS   Jagannathan,M., Sakwe,A.M., Nguyen,T. and Frappier,L.
  TITLE     The MCM-associated protein MCM-BP is important for human nuclear
            morphology
  JOURNAL   J. Cell. Sci. 125 (PT 1), 133-143 (2012)
   PUBMED   22250201
  REMARK    GeneRIF: results suggest that MCM-BP makes multiple contributions
            to human cells that are not limited to unloading of the MCM complex
REFERENCE   2  (bases 1 to 4102)
  AUTHORS   Nguyen,T., Jagannathan,M., Shire,K. and Frappier,L.
  TITLE     Interactions of the human MCM-BP protein with MCM complex
            components and Dbf4
  JOURNAL   PLoS ONE 7 (4), E35931 (2012)
   PUBMED   22540012
  REMARK    GeneRIF: MCM-BP can decrease phosphorylation by DDK but is not a
            substrate.
REFERENCE   3  (bases 1 to 4102)
  AUTHORS   Nishiyama,A., Frappier,L. and Mechali,M.
  TITLE     MCM-BP regulates unloading of the MCM2-7 helicase in late S phase
  JOURNAL   Genes Dev. 25 (2), 165-175 (2011)
   PUBMED   21196493
  REMARK    GeneRIF: MCM-BP silencing in human cells also delays MCM
            dissociation in late S phase
REFERENCE   4  (bases 1 to 4102)
  AUTHORS   Takahashi,N., Quimbaya,M., Schubert,V., Lammens,T., Vandepoele,K.,
            Schubert,I., Matsui,M., Inze,D., Berx,G. and De Veylder,L.
  TITLE     The MCM-binding protein ETG1 aids sister chromatid cohesion
            required for postreplicative homologous recombination repair
  JOURNAL   PLoS Genet. 6 (1), E1000817 (2010)
   PUBMED   20090939
  REMARK    GeneRIF: Knockdown of the human ETG1 results in defective chromatid
            cohesion.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 4102)
  AUTHORS   Sakwe,A.M., Nguyen,T., Athanasopoulos,V., Shire,K. and Frappier,L.
  TITLE     Identification and characterization of a novel component of the
            human minichromosome maintenance complex
  JOURNAL   Mol. Cell. Biol. 27 (8), 3044-3055 (2007)
   PUBMED   17296731
  REMARK    GeneRIF: MCM-BP is conserved in multicellular eukaryotes and shares
            limited homology with MCM proteins. MCM-BP formed a complex with
            MCM3 to MCM7, which excluded MCM2.
REFERENCE   6  (bases 1 to 4102)
  AUTHORS   Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
  TITLE     A probability-based approach for high-throughput protein
            phosphorylation analysis and site localization
  JOURNAL   Nat. Biotechnol. 24 (10), 1285-1292 (2006)
   PUBMED   16964243
REFERENCE   7  (bases 1 to 4102)
  AUTHORS   Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
            Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
            Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
            Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
            Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
            Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
            Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
  TITLE     A scan of chromosome 10 identifies a novel locus showing strong
            association with late-onset Alzheimer disease
  JOURNAL   Am. J. Hum. Genet. 78 (1), 78-88 (2006)
   PUBMED   16385451
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA381502.1, AK094075.1 and AC027672.12.
            
            Summary: This gene encodes a protein which is a component of the
            hexameric minichromosome maintenance (MCM) complex which regulates
            initiation and elongation of DNA. Multiple transcript variants
            encoding different isoforms have been found for this gene.
            [provided by RefSeq, Jan 2012].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and
            coding region, and uses a downstream start codon compared to
            variant 1. The resulting protein (isoform 3) is shorter and has a
            shorter N-terminus compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK094075.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-7                 DA381502.1         1-7
            8-1390              AK094075.1         2-1384
            1391-1391           AC027672.12        176894-176894
            1392-1930           AK094075.1         1386-1924
            1931-1931           AC027672.12        183980-183980
            1932-2305           AK094075.1         1926-2299
            2306-4102           AC027672.12        184355-186151
FEATURES             Location/Qualifiers
     source          1..4102
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q26.11"
     gene            1..4102
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /note="minichromosome maintenance complex binding protein"
                     /db_xref="GeneID:79892"
                     /db_xref="HGNC:25782"
                     /db_xref="MIM:610909"
     exon            1..198
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            199..284
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            285..425
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            426..467
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            468..560
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    482..484
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /note="upstream in-frame stop codon"
     exon            561..683
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     CDS             629..2032
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /note="isoform 3 is encoded by transcript variant 3;
                     MCM-binding protein; minichromosome maintenance
                     complex-binding protein; mini-chromosome maintenance
                     complex-binding protein"
                     /codon_start=1
                     /product="mini-chromosome maintenance complex-binding
                     protein isoform 3"
                     /protein_id="NP_001243308.1"
                     /db_xref="GI:373838729"
                     /db_xref="GeneID:79892"
                     /db_xref="HGNC:25782"
                     /db_xref="MIM:610909"
                     /translation="
MDLQPNKQKDQHAGARQAGSVGGLQWCGEPKRLETEASTGQQLNSLNLSSPFDLNFPLPGEKGPACLVKVYEDWDCFKVNDILELYGILSVDPVLSILNNDERDASALLDPMECTDTAEEQRVHSPPASLVPRIHVILAQKLQHINPLLPACLNKEESKTFVSSFMSELSPVRAELLGFLTHALLGDSLAAEYLILHLISTVYTRRDVLPLGKFTVNLSGCPRNSTFTEHLYRIIQHLVPASFRLQMTIENMNHLKFIPHKDYTANRLVSGLLQLPSNTSLVIDETLLEQGQLDTPGVHNVTALSNLITWQKVDYDFSYHQMEFPCNINVFITSEGRSLLPADCQIHLQPQLIPPNMEEYMNSLLSAVLPSVLNKFRIYLTLLRFLEYSISDEITKAVEDDFVEMRKNDPQSITADDLHQLLVVARCLSLSAGQTTLSRERWLRAKQLESLRRTRLQQQKCVNGNEL
"
     misc_feature    1157..1456
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /note="Putative alanine racemase; Region: Racemase_4;
                     pfam13615"
                     /db_xref="CDD:205793"
     variation       663
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35175048"
     exon            684..835
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            836..936
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            937..1109
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     variation       994
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35484984"
     variation       1045
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34297798"
     exon            1110..1233
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            1234..1351
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            1352..1517
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            1518..1651
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     variation       1561
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34118671"
     exon            1652..1816
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            1817..1905
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     exon            1906..4102
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /inference="alignment:Splign:1.39.8"
     variation       1914
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35371199"
     variation       2167..2168
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:28362484"
     variation       3244
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10550"
     STS             3484..3598
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /standard_name="A005M41"
                     /db_xref="UniSTS:7490"
     STS             3484..3598
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /standard_name="G32243"
                     /db_xref="UniSTS:116846"
     variation       3616
                     /gene="MCMBP"
                     /gene_synonym="C10orf119; MCM-BP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6881"
ORIGIN      
attttccaaattgcctcagcaaaaggctgctgtagtcggtcttcgtagcttccttctccagggtatcctagcggcgcgcagtgcaggagcctcgcaccgctccccgacggcggctgccagcttccagacagacgccgacccggtgttcgcaaccagggcgcaggccgggcccggagcgtttagagcgcccgcccctcgcccaaaatggagttaatcctgactgggagaagaaagtaattgagtattttaaggaaaagctgaaggaaaataatgctcctaagtgggtaccatcactgaacgaagttccccttcattatttgaaacctaatagttttgtgaaatttcgttgcatgattcaggatatgtttgaccctgagttttacatgggagtttatgaaacggttaaccaaaacacaaaagcacatgttcttcattttggaaaatatagagatgtagcagagtgtgggcctcaacaagaacttgatttaaactctccacgaaataccactttggaaagacagactttctattgtgttccggtgcctggggaatctacgtggctcgagtcagtccctcaacatcctacactcctagtcgccacaagaggagttatgaagatgatgacgatatggacctacagcccaataagcagaaagaccaacatgcaggtgccagacaagcagggagtgttggtggtcttcaatggtgtggagagccaaaacgtttagaaactgaagcttctactgggcaacagctgaactctctgaacttgtcttctccttttgatttgaattttccattgccaggagagaagggccctgcatgccttgtgaaggtttatgaagattgggattgtttcaaagtaaatgacattcttgagctatatggcatactgtctgtggatcctgtgctgagtatactgaataatgatgaaagggatgcctctgcactgctggatccgatggagtgcacagacacagcagaggagcagagagtacacagtcctcctgcttcattagtgccgagaattcatgtgatcttagcccagaagttgcaacacatcaacccattattgcctgcctgccttaacaaagaggagagcaaaacctttgtttcaagtttcatgtccgaattgtctccagtcagagcagaacttcttgggttccttactcatgcccttctgggggatagtttggctgctgaataccttatattacatctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttacagttaacttgagtggttgcccacggaatagtaccttcacagaacacttgtatcgaattattcaacatcttgttccagcatcttttcgtctgcagatgactatagagaacatgaaccatttgaaattcattccccacaaagactacacagccaatcgcttggtcagtgggctcctccagctgcccagcaatacttcccttgtaatcgatgagactctcctggaacaggggcagctggataccccaggtgttcataatgtgacagccctgagcaacctcataacgtggcagaaggtggattatgacttcagctaccatcagatggaattcccctgcaatattaacgttttcattacttcggaggggaggtcactcctcccggcagactgccagattcacttacagccccagctaattccaccaaacatggaggagtacatgaacagccttctctcagcggtgctgccttccgtgctgaacaaattccgcatttatctaactcttttgagattcttggaatatagcatatctgatgaaataaccaaggcagttgaagatgactttgtggaaatgcggaagaacgaccctcagagcatcactgctgatgatcttcaccagctgctcgtggtggctcggtgtctgtctctcagtgctggtcagacaacgctgtcaagagaacgatggctgagagcaaagcagctagagtctttaagaagaacgaggcttcagcagcaaaaatgtgtgaatggaaatgaactttaaagatgtaatacctatgaagagtaatgggcaaactgtagccacataattgtaaaattcagatattcatttataccacattgttttataggtaatttctatcacaaaccagtgacatttcctgaaatcaagcctggtaacacctgatgtttatatgatattcagtaaggacttttaccttactgatttcatggagcttttgaagtttgttttataataattatataaattagtaatgatgtaaaaaaagtatttgatattaaaagtttaatattgataatgttgctgattgtaccatttccttagcttcagctgagtcataggccagactgttgaaatgctgaaatgaagaaggttgttgcagtttcaaagtcagaggaatcgtgcttcggatttcttatgttttctagttctctgtttttccagttcacagtgggttggggtgcattcagtagtccatctttggggaacggaggcgtacttgccattgattcacatgactacatgaaattctgtactgtcatttcccagatgtttggccacagaaactttttcccacttaacatttgttaacagcctgcaaaactaaacttgtacatggcagtggttcccagacttttgtattttatggaccggtagtaatatttccaaaaatctggggtactataaggttgccaatttaccttgccaagtaatccgaataaatcactgtattatcaccatttttttcataaaaggaaaggacaatctatctctgaataagaggagtcctttaaacggaatgaatgtggcttttgggggcaaaagaaaccaagacactacattgtctttattttctcctatcccagtgcatttgagaaccatgcataagggaatgctgtgctacaaagctgtgcccaaatatgaaaacaaaataggaaacttaaaaagcaataccccctttagaaagtttttattttcttaaatgtcattgagttgctttgattctattggatttttggcattttttatgggatcatcagttggttccaagtatgttagatcagctaacatctgctactccagtaacagcctcgtacaactgcaggtaggttttctccagaccaattagttttaatagagcaaactaacaacagactgtagtagcatggttatggcaaccagaatcttcagaaaggttaggacattactttttaagctgtcagtggtatcaaataacttacctagttggaggcagataaaggatcccttacgttttttcctataaggcctaaattgaaattgttaaccaaggaaacagggtcagccttgaaaaatcaaggaattcattgtacctaataactgaagtaaaaataactagttgttcaacttttcctaaactcaaatctatttttataaacaaatgtaaataatgtttatattagagttgaactggttttcatttttataactggtagactagaccttccttaaacttttagaaataaaatgaaggcttcactggatttgtgaggataaaatacattttctttaattgtcctagagcaaagtacattagtcaccatgtgttttttgtgccaatgtaaattgtaatttaccaaagaaaaatacatacattgcttggtcttgcagaaaagttcccttgaaagaacctttccaataaataaaacgtcccaaattagcagtaccttgggctgtttttcatgagtaagaagattcaccatcccatgtgatctgtgtggaaaaagaccatgtcctcttggtggaagacatgagagagctgaactgaagtggaggaggtggtgcaagagggaccttcctgctcaaggcccgcccaggcagcggaatggagtgcagtgcttggctgcagaaaccctttgtccctcacctatatatacacggacagtcaagtttgttgctctaacgtaaggcacagcgttaatcctgtatggccaggaaactgagtagactcctgtgtaaccctgtttggaactttgccttcttaaaatgatttttcaaagatctctttcgaactaatttctgtagagtttaaacgtgtattttatcacctaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:79892 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
            GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: IMP
            GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: TAS
            GeneID:79892 -> Biological process: GO:0006261 [DNA-dependent DNA replication] evidence: IMP
            GeneID:79892 -> Biological process: GO:0007062 [sister chromatid cohesion] evidence: IMP
            GeneID:79892 -> Biological process: GO:0007067 [mitosis] evidence: IEA
            GeneID:79892 -> Biological process: GO:0051301 [cell division] evidence: IEA
            GeneID:79892 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:79892 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:79892 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:79892 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:79892 -> Cellular component: GO:0042555 [MCM complex] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.