Home |
Help |
Advanced search
2024-04-26 12:37:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001256312 3171 bp mRNA linear PRI 02-JUN-2013
DEFINITION Homo sapiens serine/threonine kinase 3 (STK3), transcript variant
2, mRNA.
ACCESSION NM_001256312
VERSION NM_001256312.1 GI:372622372
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3171)
AUTHORS Romano,D., Maccario,H., Doherty,C., Quinn,N.P., Kolch,W. and
Matallanas,D.
TITLE The differential effects of wild-type and mutated K-Ras on MST2
signaling are determined by K-Ras activation kinetics
JOURNAL Mol. Cell. Biol. 33 (9), 1859-1868 (2013)
PUBMED 23459937
REMARK GeneRIF: The ability of K-Ras to activate MST2 and MST2-dependent
apoptosis is determined by the differential activation kinetics of
mutant K-Ras and wild type K-Ras.
REFERENCE 2 (bases 1 to 3171)
AUTHORS Liu,W., Wu,J., Xiao,L., Bai,Y., Qu,A., Zheng,Z. and Yuan,Z.
TITLE Regulation of neuronal cell death by c-Abl-Hippo/MST2 signaling
pathway
JOURNAL PLoS ONE 7 (5), E36562 (2012)
PUBMED 22590567
REMARK GeneRIF: The identification of the c-Abl tyrosine kinase as a novel
upstream activator of MST2 suggests that the conserved c-Abl-MST
signaling cascade plays an important role in oxidative
stress-induced neuronal cell death.
REFERENCE 3 (bases 1 to 3171)
AUTHORS Matallanas,D., Romano,D., Al-Mulla,F., O'Neill,E., Al-Ali,W.,
Crespo,P., Doyle,B., Nixon,C., Sansom,O., Drosten,M., Barbacid,M.
and Kolch,W.
TITLE Mutant K-Ras activation of the proapoptotic MST2 pathway is
antagonized by wild-type K-Ras
JOURNAL Mol. Cell 44 (6), 893-906 (2011)
PUBMED 22195963
REMARK GeneRIF: The small number of tumors with co-expression of mutant
K-Ras and MST2 has elevated apoptosis rates.
REFERENCE 4 (bases 1 to 3171)
AUTHORS Song,J., Hong,H., Choi,S., Lee,Y.H., Yamashita,E., Bae,S.C.,
Park,I.Y. and Lee,S.J.
TITLE Crystallization and preliminary X-ray crystallographic study of the
human MST2 SARAH domain
JOURNAL Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 67 (PT 11),
1403-1405 (2011)
PUBMED 22102242
REMARK GeneRIF: crystals of MST2 belonged to space group P2, with
unit-cell parameters a = 62.0, b = 119.2, c = 62.0 A, alpha = 90.0,
beta = 90.5, gamma = 90.0 degrees , or to space group P6(1)22, with
unit-cell parameters a = 54.5, b = 54.5, c = 303.1 A
REFERENCE 5 (bases 1 to 3171)
AUTHORS Park,B.H. and Lee,Y.H.
TITLE Phosphorylation of SAV1 by mammalian ste20-like kinase promotes
cell death
JOURNAL BMB Rep 44 (9), 584-589 (2011)
PUBMED 21944251
REMARK GeneRIF: The mammalian ste20-like kinase mediated phosphorylation
of four residues within SAV1 may be important in the induction of
cell death by the MST pathway.
REFERENCE 6 (bases 1 to 3171)
AUTHORS Bren,A., Welch,M., Blat,Y. and Eisenbach,M.
TITLE Signal termination in bacterial chemotaxis: CheZ mediates
dephosphorylation of free rather than switch-bound CheY
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (19), 10090-10093 (1996)
PUBMED 8816756
REFERENCE 7 (bases 1 to 3171)
AUTHORS Creasy,C.L. and Chernoff,J.
TITLE Cloning and characterization of a member of the MST subfamily of
Ste20-like kinases
JOURNAL Gene 167 (1-2), 303-306 (1995)
PUBMED 8566796
REFERENCE 8 (bases 1 to 3171)
AUTHORS Adams,M.D., Kerlavage,A.R., Fleischmann,R.D., Fuldner,R.A.,
Bult,C.J., Lee,N.H., Kirkness,E.F., Weinstock,K.G., Gocayne,J.D.,
White,O. et al.
TITLE Initial assessment of human gene diversity and expression patterns
based upon 83 million nucleotides of cDNA sequence
JOURNAL Nature 377 (6547 SUPPL), 3-174 (1995)
PUBMED 7566098
REFERENCE 9 (bases 1 to 3171)
AUTHORS Creasy,C.L. and Chernoff,J.
TITLE Cloning and characterization of a human protein kinase with
homology to Ste20
JOURNAL J. Biol. Chem. 270 (37), 21695-21700 (1995)
PUBMED 7665586
REFERENCE 10 (bases 1 to 3171)
AUTHORS Schultz,S.J. and Nigg,E.A.
TITLE Identification of 21 novel human protein kinases, including 3
members of a family related to the cell cycle regulator nimA of
Aspergillus nidulans
JOURNAL Cell Growth Differ. 4 (10), 821-830 (1993)
PUBMED 8274451
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK131363.1 and AP003355.2.
Summary: This gene encodes a serine/threonine protein kinase
activated by proapoptotic molecules indicating the encoded protein
functions as a growth suppressor. Cleavage of the protein product
by caspase removes the inhibitory C-terminal portion. The
N-terminal portion is transported to the nucleus where it
homodimerizes to form the active kinase which promotes the
condensation of chromatin during apoptosis. Multiple transcript
variants encoding different isoforms have been found for this gene.
[provided by RefSeq, Jan 2012].
Transcript Variant: This variant (2) differs in the 5' UTR and
coding region, and uses an alternate start codon compared to
variant 1. The resulting protein (isoform 2) has a longer
N-terminus compared to isoform 1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK131363.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025088 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2173 AK131363.1 1-2173
2174-2447 AP003355.2 84610-84883 c
2448-3165 AK131363.1 2448-3165
3166-3171 AP003355.2 83886-83891 c
FEATURES Location/Qualifiers
source 1..3171
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q22.2"
gene 1..3171
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="serine/threonine kinase 3"
/db_xref="GeneID:6788"
/db_xref="HGNC:11406"
/db_xref="MIM:605030"
exon 1..194
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 195..322
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
misc_feature 236..238
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="upstream in-frame stop codon"
exon 323..510
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
CDS 401..1960
/gene="STK3"
/gene_synonym="KRS1; MST2"
/EC_number="2.7.11.1"
/note="isoform 2 is encoded by transcript variant 2;
serine/threonine kinase 3 (STE20 homolog, yeast);
serine/threonine kinase 3 (Ste20, yeast homolog);
serine/threonine-protein kinase 3; MST-2; STE20-like
kinase MST2; mammalian STE20-like protein kinase 2;
serine/threonine-protein kinase Krs-1"
/codon_start=1
/product="serine/threonine-protein kinase 3 isoform 2"
/protein_id="NP_001243241.1"
/db_xref="GI:372622373"
/db_xref="CCDS:CCDS59108.1"
/db_xref="GeneID:6788"
/db_xref="HGNC:11406"
/db_xref="MIM:605030"
/translation="
MLQLMDSGITICLRNGAASVFKKKEWSTQGEENKQDSKLKKLSEDSLTKQPEEVFDVLEKLGEGSYGSVFKAIHKESGQVVAIKQVPVESDLQEIIKEISIMQQCDSPYVVKYYGSYFKNTDLWIVMEYCGAGSVSDIIRLRNKTLIEDEIATILKSTLKGLEYLHFMRKIHRDIKAGNILLNTEGHAKLADFGVAGQLTDTMAKRNTVIGTPFWMAPEVIQEIGYNCVADIWSLGITSIEMAEGKPPYADIHPMRAIFMIPTNPPPTFRKPELWSDDFTDFVKKCLVKNPEQRATATQLLQHPFIKNAKPVSILRDLITEAMEIKAKRHEEQQRELEEEEENSDEDELDSHTMVKTSVESVGTMRATSTMSEGAQTMIEHNSTMLESDLGTMVINSEDEEEEDGTMKRNATSPQVQRPSFMDYFDKQDFKNKSHENCNQNMHEPFPMSKNVFPDNWKVPQDGDFDFLKNLSLEELQMRLKALDPMMEREIEELRQRYTAKRQPILDAMDAKKRRQQNF
"
misc_feature 551..1318
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="Catalytic domain of the Protein Serine/Threonine
Kinases, Mammalian Ste20-like protein kinase 1 and 2;
Region: STKc_MST1_2; cd06612"
/db_xref="CDD:132943"
misc_feature 563..1318
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(581..595,605..607,644..646,650..652,731..733,
779..790,797..802,809..811,920..922,926..937,941..943,
974..976,983..985,1025..1036,1040..1042,1121..1123,
1148..1150)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="active site"
/db_xref="CDD:132943"
misc_feature order(581..595,605..607,644..646,650..652,731..733,
779..790,797..802,809..811,932..937,941..943,974..976)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:132943"
misc_feature order(590..595,920..922,926..934,983..985,1025..1036,
1040..1042,1121..1123,1148..1150)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:132943"
misc_feature order(971..1009,1013..1042)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="activation loop (A-loop); other site"
/db_xref="CDD:132943"
misc_feature 1790..1936
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="C terminal SARAH domain of Mst1; Region:
Mst1_SARAH; pfam11629"
/db_xref="CDD:152065"
exon 511..591
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 592..720
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 721..835
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 836..1000
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1001..1168
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1169..1306
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1307..1432
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
variation 1393
/gene="STK3"
/gene_synonym="KRS1; MST2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1057795"
exon 1433..1625
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1626..1801
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1802..3171
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
STS 2690..2830
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="RH64860"
/db_xref="UniSTS:89236"
STS 2899..3165
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="WI-20184"
/db_xref="UniSTS:54716"
STS 2949..3094
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="D8S1924"
/db_xref="UniSTS:74810"
ORIGIN
gtgcagaaccgtttggttttcccgaggggtaggcagaatttccaaccccacgagctgctccctctttccgcaaacctcctaaccccggggtttttccataaatgtgtttacttcgtccacgccagcctgcgaagttccaaaatggagtctgggccacgccggcgttctgggcacgactacggtctcttgaaaagatttggaattgaccatgtagataatctctgagagcagttcttaaagtgtaatccagaaccggtggaacttgctagaaacgcatattcttcggaccccctccaaatctgctgaatctgagattgtggaggccattcaatgtcccttcttcaggaatttggaaaaaggatggagagatctctctgagctagactcttcagtggaggaaatgttacaactcatggacagtggcattaccatctgccttaggaacggagcagcctctgtcttcaagaaaaaagaatggagcacacaaggagaagaaaacaagcaagacagtaaactaaaaaagctgagtgaagacagtttgactaagcagcctgaagaagtttttgatgtattagagaagcttggagaagggtcttatggaagtgtatttaaagcaatacacaaggaatccggtcaagttgtcgcaattaaacaagtacctgttgaatcagatcttcaggaaataatcaaagaaatttccataatgcagcaatgtgacagcccatatgttgtaaagtactatggcagttattttaagaatacagacctctggattgttatggagtactgtggcgctggctctgtctcagacataattagattacgaaacaagacattaatagaagatgaaattgcaaccattcttaaatctacattgaaaggactagaatatttgcactttatgagaaaaatacacagagatataaaagctggaaatattctcctcaatacagaaggacatgcaaaattggcagattttggagtggctggtcagttaacagatacaatggcaaaacgcaatactgtaataggaactccattttggatggctcctgaggtgattcaagaaataggctataactgtgtggccgacatctggtcccttggcattacttctatagaaatggctgaaggaaaacctccttatgctgatatacatccaatgagggctatttttatgattcccacaaatccaccaccaacattcagaaagccagaactttggtccgatgatttcaccgattttgttaaaaagtgtttggtgaagaatcctgagcagagagctactgcaacacaacttttacagcatccttttatcaagaatgccaaacctgtatcaatattaagagacctgatcacagaagctatggagatcaaagctaaaagacatgaggaacagcaacgagaattggaagaggaagaagaaaattcggatgaagatgagctggattcccacaccatggtgaagactagtgtggagagtgtgggcaccatgcgggccacaagcacgatgagtgaaggggcccagaccatgattgaacataatagcacgatgttggaatccgacttggggaccatggtgataaacagtgaggatgaggaagaagaagatggaactatgaaaagaaatgcaacctcaccacaagtacaaagaccatctttcatggactactttgataagcaagacttcaagaataagagtcacgaaaactgtaatcagaacatgcatgaacccttccctatgtccaaaaacgtttttcctgataactggaaagttcctcaagatggagactttgactttttgaaaaatctaagtttagaagaactacagatgcggttaaaagcactggaccccatgatggaacgggagatagaagaacttcgtcagagatacactgcgaaaagacagcccattctggatgcgatggatgcaaagaaaagaaggcagcaaaacttttgagtctaatttcctctctgtttttaactattctggagaccaagaaaccactaggaattgaaggaatatttggatatttttaatcctaagattttgccctacaattaggcagaggtcaaaaagtgacaatggtacatgcccaggtaaattcccaaaaggcagaattgacagttgtatctgctgtgcattcactctaagatgaggagaacaaaagaagtgtattctcttgttctgtcagctgcataccagtaataaaactgttatgaaatggattttcaaggtctctaaaccttgaaaatccaaagctattgttgcattgtacagcactgaagggctttatgttacaatattctttattcctatctagtatactaggctatttattgtatccccttaggtaaacttatttatttatgctattttgctttgtttcattttttaaggacaagatcaggatagctttggtgaaggtagggtcatattaatatgatgataatgtgcaaccaatttatactttctgcagggagctatggggtacattccttgatttccaggatagtttttcaaataggaaagcaataatggcagtagttctcaaatgggctaggccttttttatattgaagcaataattccatttttaccctttgaaattttgtttttttgatttttgatgtttggtacaaatagaactatatatatttaggtaaaatagatctatcgtgtttaaaaccaaagaaatcaatggaacccttgcacaaaaaagtgtgataaatatttttaaataaaaacttaatacaaatgtaatttgttaatattgtttcatgttttatgtgtagatctaatagctgaactgattcaaactgtaataagctcatcaatttcatttctatgaaaatgtgctctgttgtcacaggatgtttctgttgattttattcatttcctgggaattggtaaacatcatgttcctgatgataacccagtagcaaaaacatttgtactgagtggtacaagccttggggactgaaaaaaaaaagattaaaaccattaaaaagaaactcatttttacgctgaatgaacatttatatgattgcattgggaccagtcatttcctaagctacatatggccatcttgacagtgttttttcttttgtgtgtttaattattatgtgtaaatcataaagacaaataaatttcactgtgccacccagcata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6788 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IDA
GeneID:6788 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:6788 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: EXP
GeneID:6788 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:6788 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6788 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:6788 -> Molecular function: GO:0043539 [protein serine/threonine kinase activator activity] evidence: IDA
GeneID:6788 -> Molecular function: GO:0046983 [protein dimerization activity] evidence: ISS
GeneID:6788 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:6788 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:6788 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:6788 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IDA
GeneID:6788 -> Biological process: GO:0035329 [hippo signaling cascade] evidence: IDA
GeneID:6788 -> Biological process: GO:0035329 [hippo signaling cascade] evidence: TAS
GeneID:6788 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: ISS
GeneID:6788 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IDA
GeneID:6788 -> Biological process: GO:0090090 [negative regulation of canonical Wnt receptor signaling pathway] evidence: IMP
GeneID:6788 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:6788 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:6788 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001243241 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.