2024-03-29 20:46:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001256135 3459 bp mRNA linear PRI 24-JUN-2013 DEFINITION Homo sapiens CSE1 chromosome segregation 1-like (yeast) (CSE1L), transcript variant 2, mRNA. ACCESSION NM_001256135 VERSION NM_001256135.1 GI:371502111 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3459) AUTHORS Soldini,D., Montagna,C., Schuffler,P., Martin,V., Georgis,A., Thiesler,T., Curioni-Fontecedro,A., Went,P., Bosshard,G., Dehler,S., Mazzuchelli,L. and Tinguely,M. TITLE A new diagnostic algorithm for Burkitt and diffuse large B-cell lymphomas based on the expression of CSE1L and STAT3 and on MYC rearrangement predicts outcome JOURNAL Ann. Oncol. 24 (1), 193-201 (2013) PUBMED 22967991 REMARK GeneRIF: CSE1L- and inhibitor of DNA binding-3 (ID3)-overexpression was associated with the diagnosis of BL and signal transduction and transcription-3 (STAT3) with DLBCL (P<0.001 for all markers). All three markers were associated with patient outcome in DLBCL REFERENCE 2 (bases 1 to 3459) AUTHORS Chang,C.C., Tai,C.J., Su,T.C., Shen,K.H., Lin,S.H., Yeh,C.M., Yeh,K.T., Lin,Y.M. and Jiang,M.C. TITLE The prognostic significance of nuclear CSE1L in urinary bladder urothelial carcinomas JOURNAL Ann Diagn Pathol 16 (5), 362-368 (2012) PUBMED 22476051 REMARK GeneRIF: Nuclear CSE1L may play an oncogenic role in bladder tumor progression and that immunohistochemical staining of nuclear CSE1L may be useful for the prognosis of bladder urothelial carcinomas. REFERENCE 3 (bases 1 to 3459) AUTHORS Zang,H., Zhao,J.M., Ji,D., Sun,Y.L., Zhou,G.D., Zhao,Y.L. and Chen,G.F. TITLE [Expression of CAS in hepatocellular carcinoma tissues and its relationship with HBV infection] JOURNAL Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 26 (4), 285-287 (2012) PUBMED 23189846 REMARK GeneRIF: CAS protein expression is related closely to tumor differentiation in hepatocellular carcinoma tissues. REFERENCE 4 (bases 1 to 3459) AUTHORS Sillars-Hardebol,A.H., Carvalho,B., Belien,J.A., de Wit,M., Delis-van Diemen,P.M., Tijssen,M., van de Wiel,M.A., Ponten,F., Meijer,G.A. and Fijneman,R.J. TITLE CSE1L, DIDO1 and RBM39 in colorectal adenoma to carcinoma progression JOURNAL Cell Oncol (Dordr) 35 (4), 293-300 (2012) PUBMED 22711543 REMARK GeneRIF: Data show that CSE1L, DIDO1 and RBM39 mRNA expression levels correlated with chromosome 20q DNA copy number status. REFERENCE 5 (bases 1 to 3459) AUTHORS Liao,C.F., Lin,S.H., Chen,H.C., Tai,C.J., Chang,C.C., Li,L.T., Yeh,C.M., Yeh,K.T., Chen,Y.C., Hsu,T.H., Shen,S.C., Lee,W.R., Chiou,J.F., Luo,S.F. and Jiang,M.C. TITLE CSE1L, a novel microvesicle membrane protein, mediates Ras-triggered microvesicle generation and metastasis of tumor cells JOURNAL Mol. Med. 18, 1269-1280 (2012) PUBMED 22952058 REMARK GeneRIF: CSE1L may be involved in the 'early' and 'late' metastasis of tumor cells in tumorigenesis. Publication Status: Online-Only REFERENCE 6 (bases 1 to 3459) AUTHORS Herold,A., Truant,R., Wiegand,H. and Cullen,B.R. TITLE Determination of the functional domain organization of the importin alpha nuclear import factor JOURNAL J. Cell Biol. 143 (2), 309-318 (1998) PUBMED 9786944 REFERENCE 7 (bases 1 to 3459) AUTHORS Kutay,U., Bischoff,F.R., Kostka,S., Kraft,R. and Gorlich,D. TITLE Export of importin alpha from the nucleus is mediated by a specific nuclear transport factor JOURNAL Cell 90 (6), 1061-1071 (1997) PUBMED 9323134 REFERENCE 8 (bases 1 to 3459) AUTHORS Brinkmann,U., Brinkmann,E., Gallo,M., Scherf,U. and Pastan,I. TITLE Role of CAS, a human homologue to the yeast chromosome segregation gene CSE1, in toxin and tumor necrosis factor mediated apoptosis JOURNAL Biochemistry 35 (21), 6891-6899 (1996) PUBMED 8639641 REFERENCE 9 (bases 1 to 3459) AUTHORS Brinkmann,U., Gallo,M., Polymeropoulos,M.H. and Pastan,I. TITLE The human CAS (cellular apoptosis susceptibility) gene mapping on chromosome 20q13 is amplified in BT474 breast cancer cells and part of aberrant chromosomes in breast and colon cancer cell lines JOURNAL Genome Res. 6 (3), 187-194 (1996) PUBMED 8963895 REFERENCE 10 (bases 1 to 3459) AUTHORS Brinkmann,U., Brinkmann,E., Gallo,M. and Pastan,I. TITLE Cloning and characterization of a cellular apoptosis susceptibility gene, the human homologue to the yeast chromosome segregation gene CSE1 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (22), 10427-10431 (1995) PUBMED 7479798 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC402014.1, EF426455.1, BC109314.2, AI973168.1 and AI018123.1. Summary: Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]. Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: EF426455.1 [ECO:0000331] RNAseq introns :: single sample supports all introns ERS025084, ERS025086 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-189 DC402014.1 1-189 190-1632 EF426455.1 1-1443 1633-3219 BC109314.2 1714-3300 3220-3442 AI973168.1 1-223 c 3443-3459 AI018123.1 2-18 c FEATURES Location/Qualifiers source 1..3459 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="20" /map="20q13" gene 1..3459 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="CSE1 chromosome segregation 1-like (yeast)" /db_xref="GeneID:1434" /db_xref="HGNC:2431" /db_xref="MIM:601342" exon 1..178 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 32 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:2273533" variation 41 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:2252259" variation 99 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:117725610" misc_feature 121..123 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="upstream in-frame stop codon" exon 179..274 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" CDS 190..2937 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="isoform 2 is encoded by transcript variant 2; importin-alpha re-exporter; cellular apoptosis susceptibility protein; exportin-2; exp2; chromosome segregation 1-like protein" /codon_start=1 /product="exportin-2 isoform 2" /protein_id="NP_001243064.1" /db_xref="GI:371502112" /db_xref="CCDS:CCDS58773.1" /db_xref="GeneID:1434" /db_xref="HGNC:2431" /db_xref="MIM:601342" /translation="
MELSDANLQTLTEYLKKTLDPDPAIRRPAEKFLESVEGNQNYPLLLLTLLEKSQDNVIKVCASVTFKNYIKRNWRIVEDEPNKICEADRVAIKANIVHLMLSSPEQIQKQLSDAISIIGREDFPQKWPDLLTEMVNRFQSGDFHVINGVLRTAHSLFKRYRHEFKSNELWTEIKLVLDAFALPLTNLFKATIELCSTHANDASALRILFSSLILISKLFYSLNFQDLPEFFEDNMETWMNNFHTLLTLDNKLLQTDLVSNAIQFLASVCERPHYKNLFEDQNTLTSICEKVIVPNMEFRAADEEAFEDNSEEYIRRDLEGSDIDTRRRAACDLVRGLCKFFEGPVTGIFSGYVNSMLQEYAKNPSVNWKHKDAAIYLVTSLASKAQTQKHGITQANELVNLTEFFVNHILPDLKSANVNEFPVLKADGIKYIMIFRNQVPKEHLLVSIPLLINHLQAESIVVHTYAAHALERLFTMRGPNNATLFTAAEIAPFVEILLTNLFKALTLPGSSENEYIMKAIMRSFSLLQEAIIPYIPTLITQLTQKLLAVSKNPSKPHFNHYMFEAICLSIRITCKANPAAVVNFEEALFLVFTEILQNDVQEFIPYVFQVMSLLLETHKNDIPSSYMALFPHLLQPVLWERTGNIPALVRLLQAFLERGSNTIASAAADKIPGLLGVFQKLIASKANDHQGFYLLNSIIEHMPPESVDQYRKQIFILLFQRLQNSKTTKFIKSFLVFINLYCIKYGALALQEIFDGIQPKMFGMVLEKIIIPEIQKVSGNVEKKICAVGITKLLTECPPMMDTEYTKLWTPLLQSLIGLFELPEDDTIPDEEHFIDIEDTPGYQTAFSQLAFAGKKEHDPVGQMVNNPKIHLAQSLHKLSTACPGRVPSMVSTSLNAEALQYLQGYLQAASVTLL
" misc_feature 274..495 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="Importin-beta N-terminal domain; Region: IBN_N; smart00913" /db_xref="CDD:197981" misc_feature 655..1599 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="Region: Cse1; pfam08506" /db_xref="CDD:117083" misc_feature 1600..2907 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /note="CAS/CSE protein, C-terminus; Region: CAS_CSE1; pfam03378" /db_xref="CDD:190619" variation 202 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:372551577" variation 222 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:145758236" exon 275..417 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 291 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:369371888" variation 292 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:2664535" variation 315 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:372846963" variation 388 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:2664556" variation 398 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:112333627" variation 416 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:145805814" exon 418..519 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 419 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:200581090" variation 429 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:141564653" variation 433 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:201843660" variation 470 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:377396767" exon 520..665 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 555 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:370077115" variation 630 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:370271126" exon 666..756 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 690 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:368316233" variation 714 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:372336608" variation 741 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:201000044" exon 757..864 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 763 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:370821480" variation 764 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:374191395" variation 775 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:150139793" variation 825 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:2227946" variation 828 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:368656942" exon 865..957 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 881..882 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:3191924" variation 881 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:1131754" variation 882 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:1131755" variation 887 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:1131756" variation 893 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:184951470" variation 915 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:1051528" exon 958..1087 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 975 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="t" /db_xref="dbSNP:374381262" variation 1033 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:377449760" variation 1035 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:140513534" exon 1088..1153 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" exon 1154..1356 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1196 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:142187945" STS 1252..1353 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="YWHAB" /db_xref="UniSTS:265998" variation 1276 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:151168384" variation 1287 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:373272778" variation 1298 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:140221738" variation 1326 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:371810198" variation 1335 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:113209936" variation 1336 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:113526104" exon 1357..1441 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1388 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:377071060" variation 1426 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:201792954" exon 1442..1503 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1460 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:375038710" variation 1503 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:192906243" exon 1504..1640 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1558 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:149873330" variation 1562 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:3209624" variation 1568 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:374403159" variation 1578 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="t" /db_xref="dbSNP:146427669" variation 1584 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:140701703" variation 1606 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:145901767" variation 1614 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:371585267" exon 1641..1744 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1659 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:368726403" variation 1665 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:112036311" variation 1687 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:200292430" variation 1694 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="" /replace="t" /db_xref="dbSNP:35437801" variation 1710..1711 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="" /replace="t" /db_xref="dbSNP:35542902" variation 1717 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:200007210" variation 1744 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:6095427" exon 1745..1842 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1794 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:143358483" variation 1801 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:148320954" variation 1806 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:34221013" variation 1834 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:372016863" exon 1843..1993 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 1851 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:141477153" variation 1873 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:202019379" variation 1897 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:147450179" variation 1924 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:138299846" variation 1926 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:111650807" variation 1944 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:372337206" variation 1962 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:375924098" variation 1983 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:369958107" exon 1994..2202 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2134 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:143688296" variation 2154 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:151233979" variation 2161 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:375067125" variation 2162 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:376962564" variation 2163 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:369869448" variation 2171 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="t" /db_xref="dbSNP:147216191" variation 2173 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:371134165" variation 2197 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:375000731" exon 2203..2300 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2232 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:374989344" variation 2281 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:2229042" exon 2301..2386 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2302 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:201854045" variation 2310 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:199707942" variation 2365 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:372218279" variation 2366 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:139664090" exon 2387..2468 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2407 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:201285684" variation 2430 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:377319144" variation 2454 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:7343500" exon 2469..2615 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2473 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="t" /db_xref="dbSNP:112338228" variation 2516 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:28659989" variation 2550 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:149713430" variation 2571 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:3180705" variation 2607 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:200756398" exon 2616..2847 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2632 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:113498434" variation 2692 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="t" /db_xref="dbSNP:144565007" variation 2777 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:377701705" variation 2778 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:370382903" STS 2844..2969 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="D20S575E" /db_xref="UniSTS:27990" exon 2848..3459 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /inference="alignment:Splign:1.39.8" variation 2853 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:201892069" variation 2870 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="g" /replace="t" /db_xref="dbSNP:148419512" STS 2876..3025 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="D20S1125" /db_xref="UniSTS:1160" STS 2891..3040 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="A003P30" /db_xref="UniSTS:7211" variation 2892 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="c" /db_xref="dbSNP:35367415" variation 2899 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:11965" variation 2923 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:3505" variation 2949 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:1051705" STS 2952..3056 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="G61992" /db_xref="UniSTS:139211" variation 2993 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:1051726" variation 3025 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:17632" polyA_signal 3065..3070 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" polyA_site 3087 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" variation 3119 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:145257031" variation 3150 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:147474671" STS 3157..3268 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /standard_name="RH18314" /db_xref="UniSTS:14814" variation 3186 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:185873544" variation 3211 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="g" /db_xref="dbSNP:189799183" variation 3299 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="c" /replace="t" /db_xref="dbSNP:182415250" variation 3353 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" /replace="a" /replace="g" /db_xref="dbSNP:139989717" polyA_signal 3422..3427 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" polyA_site 3448 /gene="CSE1L" /gene_synonym="CAS; CSE1; XPO2" ORIGIN
agagcattcctggccccgccccctgcagcgggccgctcgctcatgcgctctggcctcaggctcgctgtcgcgccattttgccggggtttgaatgtgaggcggagcggcggcaggagcgggtagtgccagctacggtccgcggctggggttccctcctccgtttctgtatccccacgagatcctatagcaatggaactcagcgatgcaaatctgcaaacactaacagaatatttaaagaaaacacttgatcctgatcctgccatccgacgtccagctgagaaatttcttgaatctgttgaaggaaatcagaattatccactgttgcttttgacattactggagaagtcccaggataatgttatcaaagtatgtgcttcagtaacattcaaaaactatattaaaaggaactggagaattgttgaagatgaaccaaacaaaatttgtgaagccgatcgagtggccattaaagccaacatagtgcacttgatgcttagcagcccagagcaaattcagaagcagttaagtgatgcaattagcattattggcagagaagattttccacagaaatggcctgacttgctgacagaaatggtgaatcgctttcagagtggagatttccatgttattaatggagtcctccgtacagcacattcattatttaaaagataccgtcatgaatttaagtcaaacgagttatggactgaaattaagcttgttctggatgcctttgctttgcctttgactaatctttttaaggccactattgaactctgcagtacccatgcaaatgatgcctctgccctgaggattctgttttcttccctgatcctgatctcaaaattgttctatagtttaaactttcaggatctccctgaattttttgaagataatatggaaacttggatgaataattttcatactctcttaacattggataataagcttttacaaactgatttggtaagtaatgcaattcaatttctggcttcagtttgtgagagacctcattataagaatctatttgaggaccagaacacgctgacaagtatctgtgaaaaggttattgtgcctaacatggaatttagagctgctgatgaagaagcatttgaagataattctgaggagtacataaggagagatttggaaggatctgatattgatactagacgcagggctgcttgtgatctggtacgaggattatgcaagttttttgagggacctgtgacaggaatcttctctggttatgttaattccatgctgcaggaatacgcaaaaaatccatctgtcaactggaaacacaaagatgcagccatctacctagtgacatctttggcatcaaaagcccaaacacagaagcatggaattacacaagcaaatgaacttgtaaacctaactgagttctttgtgaatcacatcctccctgatttaaaatcagctaatgtgaatgaatttcctgtccttaaagctgacggtatcaaatatattatgatttttagaaatcaagtgccaaaagaacatcttttagtctcgattcctctcttgattaatcatcttcaagctgaaagtattgttgttcatacttacgcagctcatgctcttgaacggctctttactatgcgagggcctaacaatgccactctctttacagctgcagaaatcgcaccgtttgttgagattctgctaacaaaccttttcaaagctctcacacttcctggctcttcagaaaatgaatatattatgaaagctatcatgagaagtttttctctcctacaagaagccataatcccctacatccctactctcatcactcagcttacacagaagctattagctgttagtaagaacccaagcaaacctcactttaatcactacatgtttgaagcaatatgtttatccataagaataacttgcaaagctaaccctgctgctgttgtaaattttgaggaggctttgtttttggtgtttactgaaatcttacaaaatgatgtgcaagaatttattccatacgtctttcaagtgatgtctttgcttctggaaacacacaaaaatgacatcccgtcttcctatatggccttatttcctcatctccttcagccagtgctttgggaaagaacaggaaatattcctgctctagtgaggcttcttcaagcattcttagaacgcggttcaaacacaatagcaagtgctgcagctgacaaaattcctgggttactaggtgtctttcagaagctgattgcatccaaagcaaatgaccaccaaggtttttatcttctaaacagtataatagagcacatgcctcctgaatcagttgaccaatataggaaacaaatcttcattctgctattccagagacttcagaattccaaaacaaccaagtttatcaagagttttttagtctttattaatttgtattgcataaaatatggggcactagcactacaagaaatatttgatggtatacaaccaaaaatgtttggaatggttttggaaaaaattattattcctgaaattcagaaggtatctggaaatgtagagaaaaagatctgtgcggttggcataaccaaattactaacagaatgtcccccaatgatggacactgagtataccaaactgtggactccattattacagtctttgattggtctttttgagttacccgaagatgataccattcctgatgaggaacattttattgacatagaagatacaccaggatatcagactgccttctcacagttggcatttgctgggaaaaaagagcatgatcctgtaggtcaaatggtgaataaccccaaaattcacctggcacagtcacttcacaagttgtctaccgcctgtccaggaagggttccatcaatggtgagcaccagcctgaatgcagaagcgctccagtatctccaagggtaccttcaggcagccagtgtgacactgctttaaactgcatttttctaatgggctaaacccagatggtttcctaggaaatcacaggcttctgagcacagctgcattaaaacaaaggaagttctccttttgaacttgtcacgaattccatcttgtaaaggatattaaatgttgctttaacctgaaccttgagcaaattagttggtttgtgtgatcatacagttatgtgggtggcttctagtttgcaacttcaagggacaagtattaatagttcagtgtatggcgttggtttgtgttgagcgtttgcacggtttggataatcttaaattttgacggacactgtggagactttctgttactaaatccttttgttttgaagctgttgctatttgtatttctcttgtcctttatattttttgtctgtttatttacgcttttattggaaatgtgaataagtaaagaattacttgtgttacttgccaagcagtgcacatttcatagtttcaaatctgtaatcagcaataaaaatcctaaaatatgtacctaagaacatcttaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1434 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1434 -> Molecular function: GO:0008262 [importin-alpha export receptor activity] evidence: TAS GeneID:1434 -> Molecular function: GO:0008536 [Ran GTPase binding] evidence: IEA GeneID:1434 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:1434 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS GeneID:1434 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:1434 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.