GGRNA Home | Help | Advanced search

2019-03-25 14:33:03, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001253914            2990 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
            (TBC1D1), transcript variant 4, mRNA.
ACCESSION   NM_001253914
VERSION     NM_001253914.1  GI:359807050
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2990)
  AUTHORS   Yamazaki,K., Umeno,J., Takahashi,A., Hirano,A., Johnson,T.A.,
            Kumasaka,N., Morizono,T., Hosono,N., Kawaguchi,T., Takazoe,M.,
            Yamada,T., Suzuki,Y., Tanaka,H., Motoya,S., Hosokawa,M.,
            Arimura,Y., Shinomura,Y., Matsui,T., Matsumoto,T., Iida,M.,
            Tsunoda,T., Nakamura,Y., Kamatani,N. and Kubo,M.
  TITLE     A genome-wide association study identifies 2 susceptibility Loci
            for Crohn's disease in a Japanese population
  JOURNAL   Gastroenterology 144 (4), 781-788 (2013)
   PUBMED   23266558
REFERENCE   2  (bases 1 to 2990)
  AUTHORS   Pehmoller,C., Brandt,N., Birk,J.B., Hoeg,L.D., Sjoberg,K.A.,
            Goodyear,L.J., Kiens,B., Richter,E.A. and Wojtaszewski,J.F.
  TITLE     Exercise alleviates lipid-induced insulin resistance in human
            skeletal muscle-signaling interaction at the level of TBC1 domain
            family member 4
  JOURNAL   Diabetes 61 (11), 2743-2752 (2012)
   PUBMED   22851577
  REMARK    GeneRIF: Data suggest that insulin increases phosphorylation of
            signaling nexus TBC1D1 independent of prior exercise or
            lipid/Intralipid administration.
REFERENCE   3  (bases 1 to 2990)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   4  (bases 1 to 2990)
  AUTHORS   Jessen,N., An,D., Lihn,A.S., Nygren,J., Hirshman,M.F., Thorell,A.
            and Goodyear,L.J.
  TITLE     Exercise increases TBC1D1 phosphorylation in human skeletal muscle
  JOURNAL   Am. J. Physiol. Endocrinol. Metab. 301 (1), E164-E171 (2011)
   PUBMED   21505148
  REMARK    GeneRIF: A single bout of exercise regulates TBC1D1 and AS160
            phosphorylation on multiple sites in human skeletal muscle.
REFERENCE   5  (bases 1 to 2990)
  AUTHORS   Park,S.Y., Jin,W., Woo,J.R. and Shoelson,S.E.
  TITLE     Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation
  JOURNAL   J. Biol. Chem. 286 (20), 18130-18138 (2011)
   PUBMED   21454505
  REMARK    GeneRIF: Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation.
REFERENCE   6  (bases 1 to 2990)
  AUTHORS   Chavez,J.A., Roach,W.G., Keller,S.R., Lane,W.S. and Lienhard,G.E.
  TITLE     Inhibition of GLUT4 translocation by Tbc1d1, a Rab
            GTPase-activating protein abundant in skeletal muscle, is partially
            relieved by AMP-activated protein kinase activation
  JOURNAL   J. Biol. Chem. 283 (14), 9187-9195 (2008)
   PUBMED   18258599
REFERENCE   7  (bases 1 to 2990)
  AUTHORS   Roach,W.G., Chavez,J.A., Miinea,C.P. and Lienhard,G.E.
  TITLE     Substrate specificity and effect on GLUT4 translocation of the Rab
            GTPase-activating protein Tbc1d1
  JOURNAL   Biochem. J. 403 (2), 353-358 (2007)
   PUBMED   17274760
  REMARK    GeneRIF: form of Tbc1d1 also inhibited GLUT4 translocation and that
            this effect also required a functional GAP domain
REFERENCE   8  (bases 1 to 2990)
  AUTHORS   Stone,S., Abkevich,V., Russell,D.L., Riley,R., Timms,K., Tran,T.,
            Trem,D., Frank,D., Jammulapati,S., Neff,C.D., Iliev,D., Gress,R.,
            He,G., Frech,G.C., Adams,T.D., Skolnick,M.H., Lanchbury,J.S.,
            Gutin,A., Hunt,S.C. and Shattuck,D.
  TITLE     TBC1D1 is a candidate for a severe obesity gene and evidence for a
            gene/gene interaction in obesity predisposition
  JOURNAL   Hum. Mol. Genet. 15 (18), 2709-2720 (2006)
   PUBMED   16893906
  REMARK    GeneRIF: coding variant R125W affects obesity susceptibility,
            delimits the location of an obesity gene at 4q34-35 and identifies
            a gene/gene interaction that influences the risk for obesity
            predisposition
REFERENCE   9  (bases 1 to 2990)
  AUTHORS   Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
            Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
  TITLE     Immunoaffinity profiling of tyrosine phosphorylation in cancer
            cells
  JOURNAL   Nat. Biotechnol. 23 (1), 94-101 (2005)
   PUBMED   15592455
REFERENCE   10 (bases 1 to 2990)
  AUTHORS   White,R.A., Pasztor,L.M., Richardson,P.M. and Zon,L.I.
  TITLE     The gene encoding TBC1D1 with homology to the tre-2/USP6 oncogene,
            BUB2, and cdc16 maps to mouse chromosome 5 and human chromosome 4
  JOURNAL   Cytogenet. Cell Genet. 89 (3-4), 272-275 (2000)
   PUBMED   10965142
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK074954.1 and CR996632.1.
            
            Summary: TBC1D1 is the founding member of a family of proteins
            sharing a 180- to 200-amino acid TBC domain presumed to have a role
            in regulating cell growth and differentiation. These proteins share
            significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and
            CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied
            by OMIM, Mar 2008].
            
            Transcript Variant: This variant (4) differs in the 5' UTR, lacks a
            large portion of the 5' coding region and initiates translation at
            a downstream, in-frame start codon, compared to variant 1. Variants
            3 and 4 encode the same isoform (3), which has a significantly
            shorter N-terminus, compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK074954.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1336              AK074954.1         1-1336
            1337-1602           CR996632.1         369-634
            1603-2990           AK074954.1         1602-2989
FEATURES             Location/Qualifiers
     source          1..2990
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p14"
     gene            1..2990
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="TBC1 (tre-2/USP6, BUB2, cdc16) domain family,
                     member 1"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
     exon            1..200
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       98
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74432580"
     variation       103
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184292039"
     variation       119
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17497866"
     misc_feature    167..169
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="upstream in-frame stop codon"
     exon            201..445
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       220
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369492733"
     variation       290
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372955287"
     CDS             353..1150
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="isoform 3 is encoded by transcript variant 4; TBC1
                     domain family member 1"
                     /codon_start=1
                     /product="TBC1 domain family member 1 isoform 3"
                     /protein_id="NP_001240843.1"
                     /db_xref="GI:359807051"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
                     /translation="
MSEEEAFKMLKFLMFDMGLRKQYRPDMIILQIQMYQLSRLLHDYHRDLYNHLEEHEIGPSLYAAPWFLTMFASQFPLGFVARVFDMIFLQGTEVIFKVALSLLGSHKPLILQHENLETIVDFIKSTLPNLGLVQMEKTINQVFEMDIAKQLQAYEVEYHVLQEELIDSSPLSDNQRMDKLEKTNSSLRKQNLDLLEQLQVANGRIQSLEATIEKLLSSESKLKQAMLTLELERSALLQTVEELRRRSAEPSDREPECTQPEPTGD
"
     misc_feature    <356..685
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Domain in Tre-2, BUB2p, and Cdc16p. Probable
                     Rab-GAPs; Region: TBC; smart00164"
                     /db_xref="CDD:197550"
     variation       353
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139639988"
     variation       407
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190882933"
     variation       418
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369737635"
     exon            446..605
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       520
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369138939"
     variation       545
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200460442"
     variation       548
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78153714"
     variation       560
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201262200"
     variation       574
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144280377"
     variation       590
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150619808"
     variation       605
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374399526"
     exon            606..775
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       642
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149746733"
     variation       678
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191311030"
     variation       729
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145666066"
     variation       730
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374150933"
     exon            776..949
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       793
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185429602"
     variation       852
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141434035"
     variation       907
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200211276"
     variation       913
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145258995"
     variation       915
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376683121"
     exon            950..2990
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       953
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147610055"
     variation       960
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199769631"
     variation       1033
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142082982"
     variation       1050
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13110318"
     variation       1068
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151143743"
     variation       1069
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375379532"
     variation       1074
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140049928"
     variation       1083
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150295101"
     variation       1089
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981524"
     variation       1109
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142224285"
     variation       1110
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145834587"
     variation       1140
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375094591"
     variation       1178
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180778179"
     variation       1218
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9852"
     variation       1219
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187612705"
     STS             1250..1421
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2507E"
                     /db_xref="UniSTS:28882"
     variation       1252
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190339487"
     variation       1268
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182167537"
     STS             1281..1430
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="SHGC-59210"
                     /db_xref="UniSTS:27409"
     variation       1319
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12644032"
     variation       1329..1330
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:140473695"
     variation       1330..1331
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71751139"
     variation       1339
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2882"
     variation       1341
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:15275"
     variation       1352
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:15276"
     variation       1404
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186099739"
     variation       1496
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190469420"
     variation       1498
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181354169"
     variation       1516
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185625994"
     variation       1531
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16994264"
     variation       1575
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75695278"
     variation       1681
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368725051"
     variation       1700
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148588413"
     variation       1745
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11941514"
     variation       1770
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191175689"
     variation       1946..1947
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368675910"
     variation       1980
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75566567"
     variation       2091
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143013479"
     variation       2107
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182546614"
     variation       2178
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375227250"
     variation       2236
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189248409"
     variation       2275..2276
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:371391694"
     variation       2276
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11330073"
     variation       2317
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368299523"
     variation       2355
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62297301"
     variation       2370
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371752989"
     variation       2402
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78069747"
     variation       2552
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140112639"
     variation       2556
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143776110"
     variation       2557
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:16994266"
     variation       2599
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199682170"
     variation       2599
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:3839162"
     STS             2696..2906
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="WI-22198"
                     /db_xref="UniSTS:12477"
     STS             2698..2820
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="RH47722"
                     /db_xref="UniSTS:67692"
     variation       2700
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191975309"
     STS             2710..2804
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2540E"
                     /db_xref="UniSTS:150969"
     variation       2727
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146830672"
     variation       2771
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374944172"
     variation       2790
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77368662"
     variation       2835
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77698656"
     variation       2911
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371533159"
ORIGIN      
acagctgttccccagcctggtagtgaacccagaggcctgtcttgctgtgcagtgggacaggaagttgcatttgggagtctcatagaacacactggaagatgtgttttagcttggccagtttcatgcaggacagattttctgcataaagaaaatcaatgacagtttctgaaactgcatcctggaagccttgaccagtttggggcgaacctttcctacacacccatacttctctgcccagcttggagcaggacagctatcgctttacaacattttgaaggcctactcacttctagaccaggaagtgggatattgccaaggtctcagctttgtagcaggcattttgcttcttcatatgagtgaggaagaggcgtttaaaatgctcaagtttctgatgtttgacatggggctgcggaaacagtatcggccagacatgattattttacagatccagatgtaccagctctcgaggttgcttcatgattaccacagagacctctacaatcacctggaggagcacgagatcggccccagcctctacgctgccccctggttcctcaccatgtttgcctcacagttcccgctgggattcgtagccagagtctttgatatgatttttcttcagggaacagaggtcatatttaaagtggctttaagtctgttgggaagccataagcccttgattctgcagcatgaaaacctagaaaccatagttgactttataaaaagcacgctacccaaccttggcttggtacagatggaaaagaccatcaatcaggtatttgaaatggacatcgctaaacagttacaagcttatgaagttgagtaccacgtccttcaagaagaacttatcgattcctctcctctcagtgacaaccaaagaatggataaattagagaaaaccaacagcagcttacgcaaacagaaccttgacctccttgaacagttgcaggtggcaaatggtaggatccaaagccttgaggccaccattgagaagctcctgagcagtgagagcaagctgaagcaggccatgcttaccttagaactggagcggtcggccctgctgcagacggtggaggagctgcggcggcggagcgcagagcccagcgaccgggagcctgagtgcacgcagcccgagcccacgggcgactgacagctctgcaggagagattgcaacaccatcccacactgtccaggccttaactgagagggacagaagacgctggaaggagagaaggaagcgggaagtgtgcttctcagggaggaaaccggcttgccagcaagtagattcttacgaactccaacttgcaattcagggggcatgtcccagtgttttttttgttgtttttagatactaaatcgtcccttctccagtcctgattactgtacacagtagctttagatggcgtggacgtgaataaatgcaacttatgttttcttgttggttcctttttgagtgtcactgtgtttgtaaagagcattcacaatacggtggaatttcaaaagctggaagagctcgagatcatgcctcaggcaaaggcgtgggtccatcgttcttccgagagggtttgtgtggcgactacaccctcagcgtccctggcaaggtgcagttggctctcgcccattcttgttatggaaacctaagatgatcattgggaagatcagtgatcttgggtcattgatccctggctcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccactagatgtaacttaaaggagttaacatttgaggactttgttctacatcagattttactatttgaatgtttaagatcactttattgaatttgaagatcatcaaattaaataaaatgatttatttaatttggatatcctgatcactgtcaagtgaaatggatctctctctttggtatttaaggaagtttgtctttaaaaaaaaaatagagtgttttcatacatttttgcttatcccataagtacagttgatcaaagtcatagtaggtaaatgctttatgggacagctgacaccttttagaccctaccaggtattgctagcatgtgagctgcagttgtggggtctgagatatttctttgtggtagtttcatacccatactatagagtcatgtatttatttttgcctgttgtgtgatgtaatgcaatcatgttcctttgagtctccatcccttggaaatctgacttcttgcagaaggagtaggcacatcaagatattcaggggtgccccaagagtctgggactttcaaaaaaaaaagatcaggctgaaactgcagtcagatttatgacagctgacagtttttcagaggtcgcacacagtgactctcctctctcaggatgacgaggacctgtgccttcaacaagcaaaatgctgctcacggttgtcctgcttgcagccagtcactgtgtaaagcctctctgatgtgcacttaagagtgggttgctttctcacaaagatggggttctgtgcagtcacaggtcacttccttgacaacacaatcatttctgatctttatcactgtaaccacgtcttctattccataggagtttcttttgattctctcagttgcggggggcatctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgagtctccccggccatttcacgaggagaccacagtgctgccaccagtgcctaaacaggtggctggcattcgagacttcctcctgttccctgggtcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccgctagatgtaacttataggagttaacatttgaggactttgttctgcatcagatcttactatttgaatgtttactgttggattttgggcatcttattactgttactcaaaaacattgactctgcatcaagaaagaaacaagaaagcaataaaacaagaaataattcatgctcacatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:23216 -> Molecular function: GO:0005097 [Rab GTPase activator activity] evidence: IEA
            GeneID:23216 -> Biological process: GO:0016044 [cellular membrane organization] evidence: TAS
            GeneID:23216 -> Biological process: GO:0032880 [regulation of protein localization] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005829 [cytosol] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.