GGRNA Home | Help | Advanced search

2019-03-24 19:52:51, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001253913            3344 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
            (TBC1D1), transcript variant 3, mRNA.
ACCESSION   NM_001253913
VERSION     NM_001253913.1  GI:359807042
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3344)
  AUTHORS   Yamazaki,K., Umeno,J., Takahashi,A., Hirano,A., Johnson,T.A.,
            Kumasaka,N., Morizono,T., Hosono,N., Kawaguchi,T., Takazoe,M.,
            Yamada,T., Suzuki,Y., Tanaka,H., Motoya,S., Hosokawa,M.,
            Arimura,Y., Shinomura,Y., Matsui,T., Matsumoto,T., Iida,M.,
            Tsunoda,T., Nakamura,Y., Kamatani,N. and Kubo,M.
  TITLE     A genome-wide association study identifies 2 susceptibility Loci
            for Crohn's disease in a Japanese population
  JOURNAL   Gastroenterology 144 (4), 781-788 (2013)
   PUBMED   23266558
REFERENCE   2  (bases 1 to 3344)
  AUTHORS   Pehmoller,C., Brandt,N., Birk,J.B., Hoeg,L.D., Sjoberg,K.A.,
            Goodyear,L.J., Kiens,B., Richter,E.A. and Wojtaszewski,J.F.
  TITLE     Exercise alleviates lipid-induced insulin resistance in human
            skeletal muscle-signaling interaction at the level of TBC1 domain
            family member 4
  JOURNAL   Diabetes 61 (11), 2743-2752 (2012)
   PUBMED   22851577
  REMARK    GeneRIF: Data suggest that insulin increases phosphorylation of
            signaling nexus TBC1D1 independent of prior exercise or
            lipid/Intralipid administration.
REFERENCE   3  (bases 1 to 3344)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   4  (bases 1 to 3344)
  AUTHORS   Jessen,N., An,D., Lihn,A.S., Nygren,J., Hirshman,M.F., Thorell,A.
            and Goodyear,L.J.
  TITLE     Exercise increases TBC1D1 phosphorylation in human skeletal muscle
  JOURNAL   Am. J. Physiol. Endocrinol. Metab. 301 (1), E164-E171 (2011)
   PUBMED   21505148
  REMARK    GeneRIF: A single bout of exercise regulates TBC1D1 and AS160
            phosphorylation on multiple sites in human skeletal muscle.
REFERENCE   5  (bases 1 to 3344)
  AUTHORS   Park,S.Y., Jin,W., Woo,J.R. and Shoelson,S.E.
  TITLE     Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation
  JOURNAL   J. Biol. Chem. 286 (20), 18130-18138 (2011)
   PUBMED   21454505
  REMARK    GeneRIF: Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation.
REFERENCE   6  (bases 1 to 3344)
  AUTHORS   Chavez,J.A., Roach,W.G., Keller,S.R., Lane,W.S. and Lienhard,G.E.
  TITLE     Inhibition of GLUT4 translocation by Tbc1d1, a Rab
            GTPase-activating protein abundant in skeletal muscle, is partially
            relieved by AMP-activated protein kinase activation
  JOURNAL   J. Biol. Chem. 283 (14), 9187-9195 (2008)
   PUBMED   18258599
REFERENCE   7  (bases 1 to 3344)
  AUTHORS   Roach,W.G., Chavez,J.A., Miinea,C.P. and Lienhard,G.E.
  TITLE     Substrate specificity and effect on GLUT4 translocation of the Rab
            GTPase-activating protein Tbc1d1
  JOURNAL   Biochem. J. 403 (2), 353-358 (2007)
   PUBMED   17274760
  REMARK    GeneRIF: form of Tbc1d1 also inhibited GLUT4 translocation and that
            this effect also required a functional GAP domain
REFERENCE   8  (bases 1 to 3344)
  AUTHORS   Stone,S., Abkevich,V., Russell,D.L., Riley,R., Timms,K., Tran,T.,
            Trem,D., Frank,D., Jammulapati,S., Neff,C.D., Iliev,D., Gress,R.,
            He,G., Frech,G.C., Adams,T.D., Skolnick,M.H., Lanchbury,J.S.,
            Gutin,A., Hunt,S.C. and Shattuck,D.
  TITLE     TBC1D1 is a candidate for a severe obesity gene and evidence for a
            gene/gene interaction in obesity predisposition
  JOURNAL   Hum. Mol. Genet. 15 (18), 2709-2720 (2006)
   PUBMED   16893906
  REMARK    GeneRIF: coding variant R125W affects obesity susceptibility,
            delimits the location of an obesity gene at 4q34-35 and identifies
            a gene/gene interaction that influences the risk for obesity
            predisposition
REFERENCE   9  (bases 1 to 3344)
  AUTHORS   Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
            Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
  TITLE     Immunoaffinity profiling of tyrosine phosphorylation in cancer
            cells
  JOURNAL   Nat. Biotechnol. 23 (1), 94-101 (2005)
   PUBMED   15592455
REFERENCE   10 (bases 1 to 3344)
  AUTHORS   White,R.A., Pasztor,L.M., Richardson,P.M. and Zon,L.I.
  TITLE     The gene encoding TBC1D1 with homology to the tre-2/USP6 oncogene,
            BUB2, and cdc16 maps to mouse chromosome 5 and human chromosome 4
  JOURNAL   Cytogenet. Cell Genet. 89 (3-4), 272-275 (2000)
   PUBMED   10965142
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK057182.1, AC108933.3, AW364769.1, CR996632.1 and AK074954.1.
            
            Summary: TBC1D1 is the founding member of a family of proteins
            sharing a 180- to 200-amino acid TBC domain presumed to have a role
            in regulating cell growth and differentiation. These proteins share
            significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and
            CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied
            by OMIM, Mar 2008].
            
            Transcript Variant: This variant (3) differs in the 5' UTR, lacks a
            large portion of the 5' coding region and initiates translation at
            a downstream, in-frame start codon, compared to variant 1. Variants
            3 and 4 encode the same isoform (3), which has a significantly
            shorter N-terminus, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK057182.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-331               AK057182.1         1-331
            332-332             AC108933.3         83656-83656
            333-1251            AK057182.1         333-1251
            1252-1400           AW364769.1         119-267
            1401-1956           CR996632.1         79-634
            1957-3344           AK074954.1         1602-2989
FEATURES             Location/Qualifiers
     source          1..3344
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p14"
     gene            1..3344
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="TBC1 (tre-2/USP6, BUB2, cdc16) domain family,
                     member 1"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
     exon            1..554
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       6
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73134642"
     variation       61
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146708685"
     variation       67
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140281559"
     variation       257
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111841013"
     variation       288
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145249450"
     variation       311
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137858930"
     variation       345
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73134643"
     variation       496
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149225039"
     misc_feature    527..529
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="upstream in-frame stop codon"
     exon            555..799
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       574
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369492733"
     variation       644
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372955287"
     CDS             707..1504
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="isoform 3 is encoded by transcript variant 3; TBC1
                     domain family member 1"
                     /codon_start=1
                     /product="TBC1 domain family member 1 isoform 3"
                     /protein_id="NP_001240842.1"
                     /db_xref="GI:359807043"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
                     /translation="
MSEEEAFKMLKFLMFDMGLRKQYRPDMIILQIQMYQLSRLLHDYHRDLYNHLEEHEIGPSLYAAPWFLTMFASQFPLGFVARVFDMIFLQGTEVIFKVALSLLGSHKPLILQHENLETIVDFIKSTLPNLGLVQMEKTINQVFEMDIAKQLQAYEVEYHVLQEELIDSSPLSDNQRMDKLEKTNSSLRKQNLDLLEQLQVANGRIQSLEATIEKLLSSESKLKQAMLTLELERSALLQTVEELRRRSAEPSDREPECTQPEPTGD
"
     misc_feature    <710..1039
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Domain in Tre-2, BUB2p, and Cdc16p. Probable
                     Rab-GAPs; Region: TBC; smart00164"
                     /db_xref="CDD:197550"
     variation       707
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139639988"
     variation       761
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190882933"
     variation       772
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369737635"
     exon            800..959
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       874
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369138939"
     variation       899
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200460442"
     variation       902
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78153714"
     variation       914
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201262200"
     variation       928
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144280377"
     variation       944
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150619808"
     variation       959
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374399526"
     exon            960..1129
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       996
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149746733"
     variation       1032
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191311030"
     variation       1083
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145666066"
     variation       1084
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374150933"
     exon            1130..1303
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1147
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185429602"
     variation       1206
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141434035"
     variation       1261
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200211276"
     variation       1267
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145258995"
     variation       1269
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376683121"
     exon            1304..3344
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1307
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147610055"
     variation       1314
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199769631"
     variation       1387
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142082982"
     variation       1404
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13110318"
     variation       1422
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151143743"
     variation       1423
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375379532"
     variation       1428
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140049928"
     variation       1437
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150295101"
     variation       1443
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981524"
     variation       1463
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142224285"
     variation       1464
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145834587"
     variation       1494
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375094591"
     variation       1532
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180778179"
     variation       1572
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9852"
     variation       1573
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187612705"
     STS             1604..1775
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2507E"
                     /db_xref="UniSTS:28882"
     variation       1606
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190339487"
     variation       1622
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182167537"
     STS             1635..1784
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="SHGC-59210"
                     /db_xref="UniSTS:27409"
     variation       1673
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12644032"
     variation       1683..1684
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:140473695"
     variation       1684..1685
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71751139"
     variation       1693
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2882"
     variation       1695
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:15275"
     variation       1706
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:15276"
     variation       1758
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186099739"
     variation       1850
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190469420"
     variation       1852
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181354169"
     variation       1870
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185625994"
     variation       1885
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16994264"
     variation       1929
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75695278"
     variation       2035
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368725051"
     variation       2054
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148588413"
     variation       2099
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11941514"
     variation       2124
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191175689"
     variation       2300..2301
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368675910"
     variation       2334
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75566567"
     variation       2445
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143013479"
     variation       2461
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182546614"
     variation       2532
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375227250"
     variation       2590
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189248409"
     variation       2629..2630
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:371391694"
     variation       2630
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11330073"
     variation       2671
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368299523"
     variation       2709
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62297301"
     variation       2724
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371752989"
     variation       2756
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78069747"
     variation       2906
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140112639"
     variation       2910
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143776110"
     variation       2911
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:16994266"
     variation       2953
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199682170"
     variation       2953
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:3839162"
     STS             3050..3260
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="WI-22198"
                     /db_xref="UniSTS:12477"
     STS             3052..3174
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="RH47722"
                     /db_xref="UniSTS:67692"
     variation       3054
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191975309"
     STS             3064..3158
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2540E"
                     /db_xref="UniSTS:150969"
     variation       3081
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146830672"
     variation       3125
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374944172"
     variation       3144
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77368662"
     variation       3189
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77698656"
     variation       3265
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371533159"
ORIGIN      
agatgggctctgaatagaggaaggcaggacactcttgagatgggatggggtttctcacagcaccgtacagggaccacctgcaagatctcttgaggggcttgtgaaaaacacatccctgaggtcaccattcttgacctgctgcttattgagtttctgatgcctgggatgtgcaggtttaacaagcccccagatgatcctaataggattcctgcctgaaaattgctgggtgaaggctcttccccctccaagtgataaagaaggaaaagattgatcctggaagaacatccgttagatgagcaaaattttgtggagcacttcatgaagaggaattactaggtcatttagaaatatgtttgaattgtggatcatcttgtaggcctttctggcatatttctccacttagatccacaagacacatcgaatgtctttttataaaggggttttttaatgcccatgtttgaccctctccacttaacagtcccattctcattttatatgtgaaggtaatctgctttacagaaaaatgtaaaggacctgcacttctctgctttgtgggcgaacctttcctacacacccatacttctctgcccagcttggagcaggacagctatcgctttacaacattttgaaggcctactcacttctagaccaggaagtgggatattgccaaggtctcagctttgtagcaggcattttgcttcttcatatgagtgaggaagaggcgtttaaaatgctcaagtttctgatgtttgacatggggctgcggaaacagtatcggccagacatgattattttacagatccagatgtaccagctctcgaggttgcttcatgattaccacagagacctctacaatcacctggaggagcacgagatcggccccagcctctacgctgccccctggttcctcaccatgtttgcctcacagttcccgctgggattcgtagccagagtctttgatatgatttttcttcagggaacagaggtcatatttaaagtggctttaagtctgttgggaagccataagcccttgattctgcagcatgaaaacctagaaaccatagttgactttataaaaagcacgctacccaaccttggcttggtacagatggaaaagaccatcaatcaggtatttgaaatggacatcgctaaacagttacaagcttatgaagttgagtaccacgtccttcaagaagaacttatcgattcctctcctctcagtgacaaccaaagaatggataaattagagaaaaccaacagcagcttacgcaaacagaaccttgacctccttgaacagttgcaggtggcaaatggtaggatccaaagccttgaggccaccattgagaagctcctgagcagtgagagcaagctgaagcaggccatgcttaccttagaactggagcggtcggccctgctgcagacggtggaggagctgcggcggcggagcgcagagcccagcgaccgggagcctgagtgcacgcagcccgagcccacgggcgactgacagctctgcaggagagattgcaacaccatcccacactgtccaggccttaactgagagggacagaagacgctggaaggagagaaggaagcgggaagtgtgcttctcagggaggaaaccggcttgccagcaagtagattcttacgaactccaacttgcaattcagggggcatgtcccagtgttttttttgttgtttttagatactaaatcgtcccttctccagtcctgattactgtacacagtagctttagatggcgtggacgtgaataaatgcaacttatgttttcttgttggttcctttttgagtgtcactgtgtttgtaaagagcattcacaatacggtggaatttcaaaagctggaagagctcgagatcatgcctcaggcaaaggcgtgggtccatcgttcttccgagagggtttgtgtggcgactacaccctcagcgtccctggcaaggtgcagttggctctcgcccattcttgttatggaaacctaagatgatcattgggaagatcagtgatcttgggtcattgatccctggctcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccactagatgtaacttaaaggagttaacatttgaggactttgttctacatcagattttactatttgaatgtttaagatcactttattgaatttgaagatcatcaaattaaataaaatgatttatttaatttggatatcctgatcactgtcaagtgaaatggatctctctctttggtatttaaggaagtttgtctttaaaaaaaaaatagagtgttttcatacatttttgcttatcccataagtacagttgatcaaagtcatagtaggtaaatgctttatgggacagctgacaccttttagaccctaccaggtattgctagcatgtgagctgcagttgtggggtctgagatatttctttgtggtagtttcatacccatactatagagtcatgtatttatttttgcctgttgtgtgatgtaatgcaatcatgttcctttgagtctccatcccttggaaatctgacttcttgcagaaggagtaggcacatcaagatattcaggggtgccccaagagtctgggactttcaaaaaaaaaagatcaggctgaaactgcagtcagatttatgacagctgacagtttttcagaggtcgcacacagtgactctcctctctcaggatgacgaggacctgtgccttcaacaagcaaaatgctgctcacggttgtcctgcttgcagccagtcactgtgtaaagcctctctgatgtgcacttaagagtgggttgctttctcacaaagatggggttctgtgcagtcacaggtcacttccttgacaacacaatcatttctgatctttatcactgtaaccacgtcttctattccataggagtttcttttgattctctcagttgcggggggcatctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgagtctccccggccatttcacgaggagaccacagtgctgccaccagtgcctaaacaggtggctggcattcgagacttcctcctgttccctgggtcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccgctagatgtaacttataggagttaacatttgaggactttgttctgcatcagatcttactatttgaatgtttactgttggattttgggcatcttattactgttactcaaaaacattgactctgcatcaagaaagaaacaagaaagcaataaaacaagaaataattcatgctcacatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:23216 -> Molecular function: GO:0005097 [Rab GTPase activator activity] evidence: IEA
            GeneID:23216 -> Biological process: GO:0016044 [cellular membrane organization] evidence: TAS
            GeneID:23216 -> Biological process: GO:0032880 [regulation of protein localization] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005829 [cytosol] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.