GGRNA Home | Help | Advanced search

2019-03-23 03:28:08, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001253912            5678 bp    mRNA    linear   PRI 14-JUL-2013
DEFINITION  Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
            (TBC1D1), transcript variant 2, mRNA.
ACCESSION   NM_001253912
VERSION     NM_001253912.1  GI:359807034
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5678)
  AUTHORS   Yamazaki,K., Umeno,J., Takahashi,A., Hirano,A., Johnson,T.A.,
            Kumasaka,N., Morizono,T., Hosono,N., Kawaguchi,T., Takazoe,M.,
            Yamada,T., Suzuki,Y., Tanaka,H., Motoya,S., Hosokawa,M.,
            Arimura,Y., Shinomura,Y., Matsui,T., Matsumoto,T., Iida,M.,
            Tsunoda,T., Nakamura,Y., Kamatani,N. and Kubo,M.
  TITLE     A genome-wide association study identifies 2 susceptibility Loci
            for Crohn's disease in a Japanese population
  JOURNAL   Gastroenterology 144 (4), 781-788 (2013)
   PUBMED   23266558
REFERENCE   2  (bases 1 to 5678)
  AUTHORS   Pehmoller,C., Brandt,N., Birk,J.B., Hoeg,L.D., Sjoberg,K.A.,
            Goodyear,L.J., Kiens,B., Richter,E.A. and Wojtaszewski,J.F.
  TITLE     Exercise alleviates lipid-induced insulin resistance in human
            skeletal muscle-signaling interaction at the level of TBC1 domain
            family member 4
  JOURNAL   Diabetes 61 (11), 2743-2752 (2012)
   PUBMED   22851577
  REMARK    GeneRIF: Data suggest that insulin increases phosphorylation of
            signaling nexus TBC1D1 independent of prior exercise or
            lipid/Intralipid administration.
REFERENCE   3  (bases 1 to 5678)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   4  (bases 1 to 5678)
  AUTHORS   Jessen,N., An,D., Lihn,A.S., Nygren,J., Hirshman,M.F., Thorell,A.
            and Goodyear,L.J.
  TITLE     Exercise increases TBC1D1 phosphorylation in human skeletal muscle
  JOURNAL   Am. J. Physiol. Endocrinol. Metab. 301 (1), E164-E171 (2011)
   PUBMED   21505148
  REMARK    GeneRIF: A single bout of exercise regulates TBC1D1 and AS160
            phosphorylation on multiple sites in human skeletal muscle.
REFERENCE   5  (bases 1 to 5678)
  AUTHORS   Park,S.Y., Jin,W., Woo,J.R. and Shoelson,S.E.
  TITLE     Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation
  JOURNAL   J. Biol. Chem. 286 (20), 18130-18138 (2011)
   PUBMED   21454505
  REMARK    GeneRIF: Crystal structures of human TBC1D1 and TBC1D4 (AS160)
            RabGTPase-activating protein (RabGAP) domains reveal critical
            elements for GLUT4 translocation.
REFERENCE   6  (bases 1 to 5678)
  AUTHORS   Chavez,J.A., Roach,W.G., Keller,S.R., Lane,W.S. and Lienhard,G.E.
  TITLE     Inhibition of GLUT4 translocation by Tbc1d1, a Rab
            GTPase-activating protein abundant in skeletal muscle, is partially
            relieved by AMP-activated protein kinase activation
  JOURNAL   J. Biol. Chem. 283 (14), 9187-9195 (2008)
   PUBMED   18258599
REFERENCE   7  (bases 1 to 5678)
  AUTHORS   Roach,W.G., Chavez,J.A., Miinea,C.P. and Lienhard,G.E.
  TITLE     Substrate specificity and effect on GLUT4 translocation of the Rab
            GTPase-activating protein Tbc1d1
  JOURNAL   Biochem. J. 403 (2), 353-358 (2007)
   PUBMED   17274760
  REMARK    GeneRIF: form of Tbc1d1 also inhibited GLUT4 translocation and that
            this effect also required a functional GAP domain
REFERENCE   8  (bases 1 to 5678)
  AUTHORS   Stone,S., Abkevich,V., Russell,D.L., Riley,R., Timms,K., Tran,T.,
            Trem,D., Frank,D., Jammulapati,S., Neff,C.D., Iliev,D., Gress,R.,
            He,G., Frech,G.C., Adams,T.D., Skolnick,M.H., Lanchbury,J.S.,
            Gutin,A., Hunt,S.C. and Shattuck,D.
  TITLE     TBC1D1 is a candidate for a severe obesity gene and evidence for a
            gene/gene interaction in obesity predisposition
  JOURNAL   Hum. Mol. Genet. 15 (18), 2709-2720 (2006)
   PUBMED   16893906
  REMARK    GeneRIF: coding variant R125W affects obesity susceptibility,
            delimits the location of an obesity gene at 4q34-35 and identifies
            a gene/gene interaction that influences the risk for obesity
            predisposition
REFERENCE   9  (bases 1 to 5678)
  AUTHORS   Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
            Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
  TITLE     Immunoaffinity profiling of tyrosine phosphorylation in cancer
            cells
  JOURNAL   Nat. Biotechnol. 23 (1), 94-101 (2005)
   PUBMED   15592455
REFERENCE   10 (bases 1 to 5678)
  AUTHORS   White,R.A., Pasztor,L.M., Richardson,P.M. and Zon,L.I.
  TITLE     The gene encoding TBC1D1 with homology to the tre-2/USP6 oncogene,
            BUB2, and cdc16 maps to mouse chromosome 5 and human chromosome 4
  JOURNAL   Cytogenet. Cell Genet. 89 (3-4), 272-275 (2000)
   PUBMED   10965142
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB036208.1, BC050321.1, AK295746.1, BQ672157.1, AW364769.1,
            CR996632.1 and AK074954.1.
            
            Summary: TBC1D1 is the founding member of a family of proteins
            sharing a 180- to 200-amino acid TBC domain presumed to have a role
            in regulating cell growth and differentiation. These proteins share
            significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and
            CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied
            by OMIM, Mar 2008].
            
            Transcript Variant: This variant (2) has multiple differences in
            the coding region, but maintains the reading frame, compared to
            variant 1. The encoded isoform (2) is shorter than isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK295746.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025083, ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-397               DB036208.1         1-397
            398-1623            BC050321.1         395-1620
            1624-1800           AK295746.1         1447-1623
            1801-1801           BQ672157.1         545-545
            1802-3614           AK295746.1         1625-3437
            3615-3734           AW364769.1         148-267
            3735-4290           CR996632.1         79-634
            4291-5678           AK074954.1         1602-2989
FEATURES             Location/Qualifiers
     source          1..5678
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p14"
     gene            1..5678
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="TBC1 (tre-2/USP6, BUB2, cdc16) domain family,
                     member 1"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
     exon            1..265
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       14
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184741485"
     variation       17
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189147798"
     variation       141
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10029658"
     variation       169
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10029748"
     variation       177
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376732662"
     variation       232
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10008151"
     exon            266..775
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       311
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2279028"
     variation       342
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368274059"
     CDS             359..3838
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="isoform 2 is encoded by transcript variant 2; TBC1
                     domain family member 1"
                     /codon_start=1
                     /product="TBC1 domain family member 1 isoform 2"
                     /protein_id="NP_001240841.1"
                     /db_xref="GI:359807035"
                     /db_xref="CCDS:CCDS58897.1"
                     /db_xref="GeneID:23216"
                     /db_xref="HGNC:11578"
                     /db_xref="MIM:609850"
                     /translation="
MEPITFTARKHLLSNEVSVDFGLQLVGSLPVHSLTTMPMLPWVVAEVRRLSRQSTRKEPVTKQVRLCVSPSGLRCEPEPGRSQQWDPLIYSSIFECKPQRVHKLIHNSHDPSYFACLIKEDAVHRQSICYVFKADDQTKVPEIISSIRQAGKIARQEELHCPSEFDDTFSKKFEVLFCGRVTVAHKKAPPALIDECIEKFNHVSGSRGSESPRPNPPHAAPTGSQEPVRRPMRKSFSQPGLRSLAFRKELQDGGLRSSGFFSSFEESDIENHLISGHNIVQPTDIEENRTMLFTIGQSEVYLISPDTKKIALEKNFKEISFCSQGIRHVDHFGFICRESSGGGGFHFVCYVFQCTNEALVDEIMMTLKQAFTVAAVQQTAKAPAQLCEGCPLQSLHKLCERIEGMNSSKTKLELQKHLTTLTNQEQATIFEEVQKLRPRNEQRENELIISFLRCLYEEKQKEHIHIGEMKQTSQMAAENIGSELPPSATRFRLDMLKNKAKRSLTESLESILSRGNKARGLQEHSISVDLDSSLSSTLSNTSKEPSVCEKEALPISESSFKLLGSSEDLSSDSESHLPEEPAPLSPQQAFRRRANTLSHFPIECQEPPQPARGSPGVSQRKLMRYHSVSTETPHERNVDPSPVGESKHRPGQSSAPAPPPRLNPSASSPNFFKYLKHNSSGEQSGNAVPKSISYRNALRKKLHSSSSVPNFLKFLAPVDENNTSDFMNTKRDFESKANHLGDSGGTPVKTRRHSWRQQIFLRVATPQKACDSSSRYEDYSELGELPPRSPLEPVCEDGPFGPPPEEKKRTSRELRELWQKAILQQILLLRMEKENQKLQASENDLLNKRLKLDYEEITPCLKEVTTVWEKMLSTPGRSKIKFDMEKMHSAVGQGVPRHHRGEIWKFLAEQFHLKHQFPSKQQPKDVPYKELLKQLTSQQHAILIDLGRTFPTHPYFSAQLGAGQLSLYNILKAYSLLDQEVGYCQGLSFVAGILLLHMSEEEAFKMLKFLMFDMGLRKQYRPDMIILQMEKTINQVFEMDIAKQLQAYEVEYHVLQEELIDSSPLSDNQRMDKLEKTNSSLRKQNLDLLEQLQVANGRIQSLEATIEKLLSSESKLKQAMLTLELERSALLQTVEELRRRSAEPSDREPECTQPEPTGD
"
     misc_feature    866..>991
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl00273"
                     /db_xref="CDD:206947"
     misc_feature    <1190..1459
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl00273"
                     /db_xref="CDD:206947"
     misc_feature    order(1223..1243,1250..1270,1316..1330,1349..1363,
                     1403..1417,1442..1459)
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="PH-like core; other site"
                     /db_xref="CDD:176275"
     misc_feature    1877..1879
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q86TI0.2); phosphorylation site"
     misc_feature    2051..2053
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q86TI0.2); phosphorylation site"
     misc_feature    2066..2068
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q86TI0.2); phosphorylation site"
     misc_feature    2075..2077
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q86TI0.2); phosphorylation site"
     misc_feature    2111..2113
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q86TI0.2); phosphorylation site"
     misc_feature    2708..2875
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Domain of unknown function (DUF3350); Region:
                     DUF3350; pfam11830"
                     /db_xref="CDD:152266"
     misc_feature    3029..>3442
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /note="Domain in Tre-2, BUB2p, and Cdc16p. Probable
                     Rab-GAPs; Region: TBC; smart00164"
                     /db_xref="CDD:197550"
     variation       398
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2279027"
     variation       403
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144039014"
     variation       411
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371619257"
     variation       412
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151073867"
     variation       420
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376073388"
     variation       439
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140988541"
     variation       491
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369686577"
     variation       496
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373623298"
     variation       522
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4008480"
     variation       531
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375973693"
     variation       551
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369705792"
     variation       559
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372533862"
     variation       565
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145947299"
     variation       625
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112861825"
     variation       656
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140419305"
     variation       721
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145529203"
     variation       724
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2279026"
     variation       731
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35859249"
     variation       759
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371184104"
     variation       760
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143128138"
     variation       763
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148233374"
     exon            776..1240
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       807
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141193435"
     variation       815
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369744022"
     variation       818
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199907184"
     variation       822
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374116224"
     variation       935
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147361950"
     variation       960
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377732925"
     variation       974
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202141166"
     variation       984
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200336838"
     variation       991
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143318665"
     variation       996
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:59426552"
     variation       997
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:58649791"
     variation       1003
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201858985"
     variation       1017
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11935412"
     variation       1018
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61731587"
     variation       1020
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372198887"
     variation       1041
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10501"
     variation       1056
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368357722"
     variation       1069
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147525296"
     variation       1075
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370249626"
     variation       1079
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371761824"
     variation       1163
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139404167"
     variation       1168
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150047198"
     variation       1171
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145326826"
     variation       1196
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372355633"
     variation       1237
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148752741"
     exon            1241..1330
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1245
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145932557"
     variation       1261
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375742782"
     variation       1265
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373742470"
     variation       1292
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370157598"
     exon            1331..1435
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1338
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112261209"
     variation       1365
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199776035"
     variation       1367
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200300060"
     variation       1378
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182769159"
     variation       1387
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187837863"
     variation       1401
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145572665"
     variation       1408
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146529803"
     exon            1436..1568
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     STS             1447..1570
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="RH92557"
                     /db_xref="UniSTS:90592"
     variation       1450
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187586429"
     variation       1503
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369942681"
     variation       1508
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61731607"
     variation       1523
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61731610"
     variation       1525
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138581395"
     variation       1530
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201580466"
     variation       1531
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34119528"
     exon            1569..1660
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1595
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146950338"
     variation       1612
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112435875"
     variation       1614
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143458673"
     variation       1615
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376905847"
     variation       1626
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74955942"
     variation       1643
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372410857"
     exon            1661..1771
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1696
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140673717"
     variation       1708
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201070135"
     variation       1736
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79973414"
     variation       1748
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111284604"
     variation       1755
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200266191"
     exon            1772..1900
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1787
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141092310"
     variation       1818
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372930518"
     variation       1834
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201258145"
     variation       1835
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11549695"
     variation       1881
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147138668"
     exon            1901..1987
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1932
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374898959"
     variation       1962
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367795610"
     exon            1988..2268
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2000
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200919268"
     variation       2020
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111482397"
     variation       2032
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148173697"
     variation       2047
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142000858"
     variation       2055
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370317412"
     variation       2064
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200329815"
     variation       2067
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150670938"
     variation       2077
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372454900"
     variation       2107
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371632898"
     variation       2112
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61752489"
     variation       2113
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202224734"
     variation       2135
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370134989"
     variation       2170
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150930395"
     variation       2207
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78097286"
     variation       2212
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144237469"
     variation       2214
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145177739"
     variation       2223
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202028456"
     variation       2226
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368638065"
     variation       2239
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371825431"
     variation       2248
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140029744"
     variation       2253
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200637650"
     exon            2269..2430
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2311
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188959191"
     variation       2313
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79179700"
     variation       2331
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193244637"
     variation       2348
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117452860"
     exon            2431..2550
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2441
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58983546"
     variation       2442
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180958473"
     variation       2449
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144452713"
     variation       2453
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146605077"
     variation       2530
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201007789"
     variation       2545
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34201174"
     exon            2551..2690
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2557
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200604910"
     variation       2561
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200893802"
     variation       2562
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375364360"
     variation       2575
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199769916"
     variation       2576
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148919679"
     variation       2595
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200586797"
     variation       2599
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116694238"
     variation       2609
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140253816"
     variation       2652
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201600071"
     variation       2665
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369081896"
     variation       2675
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146980638"
     exon            2691..2876
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2694
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7677030"
     variation       2742
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138058343"
     variation       2758
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373688498"
     variation       2793
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202172601"
     variation       2801
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376244849"
     variation       2822
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201447112"
     exon            2877..3038
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2894
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6850741"
     variation       2896
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146834783"
     variation       2929
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377584682"
     variation       2935
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145804193"
     variation       2982
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138362592"
     variation       3031
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149645940"
     exon            3039..3197
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       3047
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199992726"
     variation       3048
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144365137"
     variation       3064
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148353711"
     variation       3110
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142187678"
     variation       3114
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202235244"
     variation       3181
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146364167"
     variation       3193
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371338316"
     exon            3198..3442
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       3217
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369492733"
     variation       3287
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372955287"
     variation       3350
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139639988"
     variation       3404
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190882933"
     variation       3415
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369737635"
     exon            3443..3463
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     exon            3464..3637
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       3481
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185429602"
     variation       3540
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141434035"
     variation       3595
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200211276"
     variation       3601
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145258995"
     variation       3603
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376683121"
     exon            3638..5678
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /inference="alignment:Splign:1.39.8"
     variation       3641
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147610055"
     variation       3648
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199769631"
     variation       3721
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142082982"
     variation       3738
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13110318"
     variation       3756
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151143743"
     variation       3757
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375379532"
     variation       3762
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140049928"
     variation       3771
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150295101"
     variation       3777
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981524"
     variation       3797
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142224285"
     variation       3798
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145834587"
     variation       3828
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375094591"
     variation       3866
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180778179"
     variation       3906
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9852"
     variation       3907
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187612705"
     STS             3938..4109
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2507E"
                     /db_xref="UniSTS:28882"
     variation       3940
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190339487"
     variation       3956
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182167537"
     STS             3969..4118
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="SHGC-59210"
                     /db_xref="UniSTS:27409"
     variation       4007
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12644032"
     variation       4017..4018
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:140473695"
     variation       4018..4019
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71751139"
     variation       4027
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2882"
     variation       4029
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:15275"
     variation       4040
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:15276"
     variation       4092
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186099739"
     variation       4184
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190469420"
     variation       4186
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181354169"
     variation       4204
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185625994"
     variation       4219
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16994264"
     variation       4263
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75695278"
     variation       4369
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368725051"
     variation       4388
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148588413"
     variation       4433
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11941514"
     variation       4458
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191175689"
     variation       4634..4635
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368675910"
     variation       4668
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75566567"
     variation       4779
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143013479"
     variation       4795
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182546614"
     variation       4866
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375227250"
     variation       4924
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189248409"
     variation       4963..4964
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:371391694"
     variation       4964
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11330073"
     variation       5005
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368299523"
     variation       5043
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62297301"
     variation       5058
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371752989"
     variation       5090
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78069747"
     variation       5240
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140112639"
     variation       5244
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143776110"
     variation       5245
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:16994266"
     variation       5287
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199682170"
     variation       5287
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:3839162"
     STS             5384..5594
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="WI-22198"
                     /db_xref="UniSTS:12477"
     STS             5386..5508
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="RH47722"
                     /db_xref="UniSTS:67692"
     variation       5388
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191975309"
     STS             5398..5492
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /standard_name="D4S2540E"
                     /db_xref="UniSTS:150969"
     variation       5415
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146830672"
     variation       5459
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374944172"
     variation       5478
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77368662"
     variation       5523
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77698656"
     variation       5599
                     /gene="TBC1D1"
                     /gene_synonym="TBC; TBC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371533159"
ORIGIN      
ctcctcttcggctgctgctcctggtgccgccaccgtccgccggtgcctgttgctgccgccgccgcgggacctgctgtgtcctcagctgggtggagaagaggcgggcgccgagccgaggggagccccctccccgtccccccgcggcgggaagagcgcagccagccgggtgcgatggactccccgcccgcccaggccgtccccaggatgcccccaagcacctgcgcgtcccggcccggccccgggctctgagcgcgccgcggcacaggtttctgcatatgaagtgtgtaaaatagattgcttgatccaaaacagaaaaacagtgataactgttttgctgagttcccagacccttcccaagatggaaccaataacattcacagcaaggaaacatctgctttctaacgaggtctcggtggattttggcctgcagctggtgggctccctgcctgtgcattccctgaccaccatgcccatgctgccctgggttgtggctgaggtgcgaagactcagcaggcagtccaccagaaaggaacctgtaaccaagcaagtccggctttgcgtttcaccctctggactgagatgtgaacctgagccagggagaagtcaacagtgggatcccctgatctattccagcatctttgagtgcaagcctcagcgtgttcacaaactgattcacaacagtcatgacccaagttactttgcttgtctgattaaggaagacgctgtccaccggcagagtatctgctatgtgttcaaagccgatgatcaaacaaaagtgcctgagatcatcagctccatccgtcaggcggggaagatcgcccggcaggaggagctgcactgcccgtccgagttcgacgacacgttttccaagaagttcgaggtgctcttctgcggccgcgtgacggtggcgcacaagaaggctccgccggccctgatcgacgagtgcatcgagaagttcaatcacgtcagcggcagccgggggtccgagagcccccgccccaacccgccccatgccgcgcccacagggagccaggagcctgtgcgcaggcccatgcgcaagtccttctcccagcccggcctgcgctcgctggcctttaggaaggagctgcaggatgggggcctccgaagcagcggcttcttcagctccttcgaggagagcgacattgagaaccacctcattagcggacacaatattgtgcagcccacagatatcgaggaaaatcgaactatgctcttcacgattggccagtctgaagtttacctcatcagtcctgacaccaaaaaaatagcattggagaaaaattttaaggagatatccttttgctctcagggcatcagacacgtggaccactttgggtttatctgtcgggagtcttccggaggtggcggctttcattttgtctgttacgtgtttcagtgcacaaatgaggctctggttgatgaaattatgatgaccctgaaacaggccttcacggtggccgcagtgcagcagacagctaaggcgccagcccagctgtgtgagggctgccccctgcaaagcctgcacaagctctgtgagaggatagagggaatgaattcttccaaaacaaaactagaactgcaaaagcacctgacgacattaaccaatcaggagcaggcgactatttttgaagaggttcagaaattgagaccgagaaatgagcagcgagagaatgaattgattatttcttttctgagatgtttatatgaagagaaacagaaagaacacatccatattggggagatgaagcagacatcgcagatggcagcagagaatattggaagtgaattaccacccagtgccactcgatttaggctagatatgctgaaaaacaaagcaaagagatctttaacagagtctttagaaagtattttgtcccggggtaataaagccagaggcctgcaggaacactccatcagtgtggatctggatagctccctgtctagtacattaagtaacaccagcaaagagccatctgtgtgtgaaaaggaggccttgcccatctctgagagctcctttaagctcctcggctcctcggaggacctgtccagtgactcggagagtcatctcccagaagagccagctccgctgtcgccccagcaggccttcaggaggcgagcaaacaccctgagtcacttccccatcgaatgccaggaacctccacaacctgcccgggggtccccgggggtttcgcaaaggaaacttatgaggtatcactcagtgagcacagagacgcctcatgaacgaaatgtggatccttcacctgtgggtgagtctaagcaccgcccaggtcagtcttcagctcctgctcctccacctcgtcttaacccctccgcctcctcgccaaacttttttaagtacctaaaacataattccagtggagaacaaagtgggaatgctgtgccaaagagcatctcctaccgtaatgccctgcggaaaaaacttcattcttcttcctctgtgccaaattttctaaaatttctggctcctgtagatgaaaataacacctctgattttatgaacacaaaaagggactttgaatccaaagcaaaccatcttggtgattctggtgggactcctgtgaagacccggaggcattcctggaggcagcagatattcctccgagtagccaccccgcagaaggcgtgcgattcttccagcagatatgaagattattcagagctgggagagcttcccccacgatctcctttagaaccagtttgtgaagatgggccctttggccccccaccagaggaaaagaaaaggacatctcgtgagctccgagagctgtggcaaaaggctattcttcaacagatactgctgcttagaatggagaaggaaaatcagaagctccaagcctctgaaaatgatttgctgaacaagcgcctgaagctcgattatgaagaaattactccctgtcttaaagaagtaactacagtgtgggaaaagatgcttagcactccaggaagatcaaaaattaagtttgacatggaaaaaatgcactcggctgttgggcaaggtgtgccacgtcatcaccgaggtgaaatctggaaatttctagctgagcaattccaccttaaacaccagtttcccagcaaacagcagccaaaggatgtgccatacaaagaactcttaaagcagctgacttcccagcagcatgcgattcttattgaccttgggcgaacctttcctacacacccatacttctctgcccagcttggagcaggacagctatcgctttacaacattttgaaggcctactcacttctagaccaggaagtgggatattgccaaggtctcagctttgtagcaggcattttgcttcttcatatgagtgaggaagaggcgtttaaaatgctcaagtttctgatgtttgacatggggctgcggaaacagtatcggccagacatgattattttacagatggaaaagaccatcaatcaggtatttgaaatggacatcgctaaacagttacaagcttatgaagttgagtaccacgtccttcaagaagaacttatcgattcctctcctctcagtgacaaccaaagaatggataaattagagaaaaccaacagcagcttacgcaaacagaaccttgacctccttgaacagttgcaggtggcaaatggtaggatccaaagccttgaggccaccattgagaagctcctgagcagtgagagcaagctgaagcaggccatgcttaccttagaactggagcggtcggccctgctgcagacggtggaggagctgcggcggcggagcgcagagcccagcgaccgggagcctgagtgcacgcagcccgagcccacgggcgactgacagctctgcaggagagattgcaacaccatcccacactgtccaggccttaactgagagggacagaagacgctggaaggagagaaggaagcgggaagtgtgcttctcagggaggaaaccggcttgccagcaagtagattcttacgaactccaacttgcaattcagggggcatgtcccagtgttttttttgttgtttttagatactaaatcgtcccttctccagtcctgattactgtacacagtagctttagatggcgtggacgtgaataaatgcaacttatgttttcttgttggttcctttttgagtgtcactgtgtttgtaaagagcattcacaatacggtggaatttcaaaagctggaagagctcgagatcatgcctcaggcaaaggcgtgggtccatcgttcttccgagagggtttgtgtggcgactacaccctcagcgtccctggcaaggtgcagttggctctcgcccattcttgttatggaaacctaagatgatcattgggaagatcagtgatcttgggtcattgatccctggctcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccactagatgtaacttaaaggagttaacatttgaggactttgttctacatcagattttactatttgaatgtttaagatcactttattgaatttgaagatcatcaaattaaataaaatgatttatttaatttggatatcctgatcactgtcaagtgaaatggatctctctctttggtatttaaggaagtttgtctttaaaaaaaaaatagagtgttttcatacatttttgcttatcccataagtacagttgatcaaagtcatagtaggtaaatgctttatgggacagctgacaccttttagaccctaccaggtattgctagcatgtgagctgcagttgtggggtctgagatatttctttgtggtagtttcatacccatactatagagtcatgtatttatttttgcctgttgtgtgatgtaatgcaatcatgttcctttgagtctccatcccttggaaatctgacttcttgcagaaggagtaggcacatcaagatattcaggggtgccccaagagtctgggactttcaaaaaaaaaagatcaggctgaaactgcagtcagatttatgacagctgacagtttttcagaggtcgcacacagtgactctcctctctcaggatgacgaggacctgtgccttcaacaagcaaaatgctgctcacggttgtcctgcttgcagccagtcactgtgtaaagcctctctgatgtgcacttaagagtgggttgctttctcacaaagatggggttctgtgcagtcacaggtcacttccttgacaacacaatcatttctgatctttatcactgtaaccacgtcttctattccataggagtttcttttgattctctcagttgcggggggcatctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgagtctccccggccatttcacgaggagaccacagtgctgccaccagtgcctaaacaggtggctggcattcgagacttcctcctgttccctgggtcagaggatagcggtttccatcataaaccaagatgatgagttcagcctttatccctcgtggttccgctagatgtaacttataggagttaacatttgaggactttgttctgcatcagatcttactatttgaatgtttactgttggattttgggcatcttattactgttactcaaaaacattgactctgcatcaagaaagaaacaagaaagcaataaaacaagaaataattcatgctcacatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:23216 -> Molecular function: GO:0005097 [Rab GTPase activator activity] evidence: IEA
            GeneID:23216 -> Biological process: GO:0016044 [cellular membrane organization] evidence: TAS
            GeneID:23216 -> Biological process: GO:0032880 [regulation of protein localization] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:23216 -> Cellular component: GO:0005829 [cytosol] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.