GGRNA Home | Help | Advanced search

2020-10-24 07:17:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001244189            6043 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens KIAA0586 (KIAA0586), transcript variant 1, mRNA.
ACCESSION   NM_001244189
VERSION     NM_001244189.1  GI:346644660
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6043)
  AUTHORS   Yin,Y., Bangs,F., Paton,I.R., Prescott,A., James,J., Davey,M.G.,
            Whitley,P., Genikhovich,G., Technau,U., Burt,D.W. and Tickle,C.
  TITLE     The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is
            essential for primary cilia formation
  JOURNAL   Development 136 (4), 655-664 (2009)
   PUBMED   19144723
REFERENCE   2  (bases 1 to 6043)
  AUTHORS   Davey,M.G., Paton,I.R., Yin,Y., Schmidt,M., Bangs,F.K.,
            Morrice,D.R., Smith,T.G., Buxton,P., Stamataki,D., Tanaka,M.,
            Munsterberg,A.E., Briscoe,J., Tickle,C. and Burt,D.W.
  TITLE     The chicken talpid3 gene encodes a novel protein essential for
            Hedgehog signaling
  JOURNAL   Genes Dev. 20 (10), 1365-1377 (2006)
   PUBMED   16702409
  REMARK    GeneRIF: The chicken ortholog functions in regulation of the Gli
            repressor and activator proteins in the Hedgehog signaling pathway.
REFERENCE   3  (bases 1 to 6043)
  AUTHORS   Wood,R., Chumbler,F. and Wiegand,R.
  TITLE     Incorporation of dietary cis and trans isomers of octadecenoate in
            lipid classes of liver and hepatoma
  JOURNAL   J. Biol. Chem. 252 (6), 1965-1970 (1977)
   PUBMED   191447
  REMARK    GeneRIF: The chicken ortholog encodes a centrosomal protein
            containing a highly conserved region necessary for ciliogenesis,
            neural tube patterning, and Hedgehog signaling.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK302836.1, AY359881.1, AL139021.6, AL135752.6, AI378482.1 and
            CN281643.1.
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK302836.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1521              AK302836.1         1-1521
            1522-2930           AY359881.1         1245-2653
            2931-2931           AL139021.6         134344-134344
            2932-3569           AY359881.1         2655-3292
            3570-4946           AK302836.1         3570-4946
            4947-4947           AL135752.6         66195-66195         c
            4948-5226           AK302836.1         4948-5226
            5227-5570           AI378482.1         1-344               c
            5571-6043           CN281643.1         1-473               c
FEATURES             Location/Qualifiers
     source          1..6043
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q23.1"
     gene            1..6043
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="KIAA0586"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
     exon            1..253
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       10..11
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:370910907"
     variation       24..25
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:370158049"
     variation       30
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:118123619"
     misc_feature    230..232
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="upstream in-frame stop codon"
     CDS             245..5179
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="isoform 1 is encoded by transcript variant 1;
                     ortholog of chicken talpid{3}; protein TALPID3"
                     /codon_start=1
                     /product="protein TALPID3 isoform 1"
                     /protein_id="NP_001231118.1"
                     /db_xref="GI:346644661"
                     /db_xref="CCDS:CCDS58320.1"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
                     /translation="
MFWCGTCFVTNNMKGSEVSLEKKKKIKMPVKRLREVVSQNHGDHLVLLKDELPCVPPALSANKRLPVGTGTSLNGTSRGSSDLTSARNCYQPLLENPMVSESDFSKDVAVQVLPLDKIEENNKQKANDIFISQYTMGQKDALRTVLKQNVSLCLTGWSDHSGVITTHCSLYLLRLMRSSHLSLPSSWDYRAQSMPVFKEVKVHLLEDAGIEKDAVTQETRISPSGIDSATTVAAATAAAIATAAPLIKVQSDLEAKVNSVTELLSKLQETDKHLQRVTEQQTSIQRKQEKLHCHDHEKQMNVFMEQHIRHLEKLQQQQIDIQTHFISAALKTSSFQPVSMPSSRAVEKYSVKPEHPNLGSCNPSLYNTFASKQAPLKEVEDTSFDKQKSPLETPAPRRFAPVPVSRDDELSKRENLLEEKENMEVSCHRGNVRLLEQILNNNDSLTRKSESSNTTSLTRSKIGWTPEKTNRFPSCEELETTKVTMQKSDDVLHDLGQKEKETNSMVQPKESLSMLKLPDLPQNSVKLQTTNTTRSVLKDAEKILRGVQNNKKVLEENLEAIIRAKDGAAMYSLINALSTNREMSEKIRIRKTVDEWIKTISAEIQDELSRTDYEQKRFDQKNQRTKKGQNMTKDIRTNTQDKTVNKSVIPRKHSQKQIEEHFRNLPMRGMPASSLQKERKEGLLKATTVIQDEDYMLQVYGKPVYQGHRSTLKKGPYLRFNSPSPKSRPQRPKVIERVKGTKVKSIRTQTDFYATKPKKMDSKMKHSVPVLPHGDQQYLFSPSREMPTFSGTLEGHLIPMAILLGQTQSNSDTMPPAGVIVSKPHPVTVTTSIPPSSRKVETGVKKPNIAIVEMKSEKKDPPQLTVQVLPSVDIDSISNSSADVLSPLSSPKEASLPPVQTWIKTPEIMKVDEEEVKFPGTNFDEIIDVIQEEEKCDEIPDSEPILEFNRSVKADSTKYNGPPFPPVASTFQPTADILDKVIERKETLENSLIQWVEQEIMSRIISGLFPVQQQIAPSISVSVSETSEPLTSDIVEGTSSGALQLFVDAGVPVNSNVIKHFVNEALAETIAVMLGDREAKKQGPVATGVSGDASTNETYLPARVCTPLPTPQPTPPCSPSSPAKECVLVKTPDSSPCDSDHDMAFPVKEICAEKGDDMPAIMLVNTPTVTPTTTPPPAAAVFTPTLSDISIDKLKVSSPELPKPWGDGDLPLEEENPNSPQEELHPRAIVMSVAKDEEPESMDFPAQPPPPEPVPFMPFPAGTKAPSPSQMPGSDSSTLESTLSVTVTETETLDKPISEGEILFSCGQKLAPKILEDIGLYLTNLNDSLSSTLHDAVEMEDDPPSEGQVIRMSHKKFHADAILSFAKQNQESAVSQQAVYHSEDLENSVGELSEGQRPQLTAAAENILMGHSLYMQPPVTNTQSLDQQCDPKPLSRQFDTVSGSIYEDSCASHGPMSLGELELEPNSKLVLPTTLLTAQENDVNLPVAAEDFSQYQLKQNQDVKQVEHKPSQSYLRVRNKSDIAPSQQQVSPGDMDRTQIELNPYLTCVFSGLGVHVKKVSCIGKLGLWRFVIQIISSPRWESSATLRFTDAPCQDVSDAAVSEPRGLLSVSESQHNAGGHGVFGGRYLLNGKRQPAQCLCHWF
"
     exon            254..479
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       274
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368726079"
     variation       276
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372615752"
     variation       277
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375579488"
     variation       295
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199554737"
     variation       316
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372215354"
     variation       344
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202124602"
     variation       380
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186659284"
     variation       397
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190089844"
     variation       447
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201315284"
     variation       451
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372659413"
     variation       462
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183168709"
     exon            480..550
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       482
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147119902"
     variation       495
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201393625"
     variation       517
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370677508"
     variation       537
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74055693"
     exon            551..620
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       566
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189943424"
     variation       591
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376005040"
     variation       609
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373836349"
     exon            621..690
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       627
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376113173"
     variation       643
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368352741"
     variation       647
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183240083"
     variation       675
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200627657"
     exon            691..813
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     exon            814..988
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       825
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735931"
     variation       885
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11622776"
     variation       935
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374972438"
     variation       979
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369143869"
     exon            989..1210
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       995
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375374719"
     variation       1003
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61738360"
     variation       1023
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199837404"
     variation       1046
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201097695"
     variation       1101
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193056942"
     variation       1126
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373333959"
     variation       1133
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376338487"
     variation       1186
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370332963"
     variation       1188
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376289224"
     exon            1211..1364
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1215
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368574051"
     variation       1253
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371179268"
     variation       1272
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186378072"
     variation       1341
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191232589"
     exon            1365..1532
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1377
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144456198"
     variation       1459
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148006211"
     variation       1471
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376048205"
     variation       1480
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199623501"
     variation       1483
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200094677"
     variation       1487
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371365932"
     variation       1500
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:59248588"
     variation       1512
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369845308"
     variation       1522
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748971"
     exon            1533..1656
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1546
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370408761"
     variation       1633
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10135645"
     variation       1640
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377325998"
     variation       1643
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147844088"
     exon            1657..1765
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1662
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187783779"
     variation       1672
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190675549"
     variation       1739
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371477725"
     exon            1766..1986
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1796
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376681702"
     variation       1810
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200446131"
     variation       1826
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78468862"
     variation       1842
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745119"
     variation       1847
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375472516"
     variation       1848
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369211190"
     variation       1925
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745095"
     variation       1973
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61742715"
     exon            1987..2059
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2056
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374601841"
     exon            2060..2287
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2188
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371990780"
     variation       2282
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191704222"
     exon            2288..2462
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2306
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375173927"
     variation       2320
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376649351"
     variation       2365
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199777168"
     variation       2390
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370560098"
     variation       2393
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202025419"
     variation       2413
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185266107"
     variation       2435
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190081177"
     exon            2463..2657
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2480
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200735064"
     variation       2495
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371583234"
     variation       2526
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373601253"
     variation       2548
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78009437"
     variation       2566
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368904420"
     variation       2604
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372160214"
     variation       2630
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192490416"
     exon            2658..2845
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2661
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369552863"
     variation       2698
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200937470"
     variation       2757
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372212501"
     variation       2772
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376797336"
     variation       2775
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78460691"
     variation       2789
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369070060"
     variation       2799
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369850927"
     variation       2828
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201629494"
     variation       2840
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373130060"
     exon            2846..2956
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2852
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370111393"
     variation       2889
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200219991"
     variation       2906
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113040775"
     variation       2914
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377409718"
     variation       2931
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1748986"
     variation       2934
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200490147"
     variation       2936
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377023593"
     exon            2957..3037
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2960
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367573993"
     variation       2961
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45478500"
     variation       2987
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372915104"
     variation       2992
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374585380"
     variation       2998
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368361783"
     variation       3033
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377015806"
     variation       3034
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367998141"
     exon            3038..3228
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3138
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139493302"
     variation       3139
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368984896"
     variation       3141
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202051871"
     variation       3209
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61974537"
     exon            3229..3347
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3234
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181400417"
     variation       3235
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373201020"
     variation       3247
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374762003"
     variation       3287
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376119494"
     variation       3311
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368808852"
     variation       3315
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783696"
     variation       3346
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370778483"
     exon            3348..3547
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3387
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368583200"
     variation       3406
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199537542"
     variation       3441
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375690080"
     variation       3445
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368251704"
     variation       3449
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141771152"
     variation       3450
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372259984"
     variation       3456
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182274649"
     variation       3463
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201263653"
     variation       3507
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77860620"
     variation       3513
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367811307"
     variation       3532
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371456681"
     variation       3538
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374691292"
     variation       3546
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369859399"
     exon            3548..3707
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3569
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1617510"
     variation       3586
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369590767"
     variation       3650
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373431045"
     variation       3669
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187091758"
     variation       3680
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77810875"
     variation       3686
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140565291"
     variation       3695
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374459469"
     exon            3708..3930
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3771
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377332917"
     variation       3777
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898983"
     variation       3810
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200148591"
     variation       3850..3851
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368765650"
     variation       3853
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199517530"
     variation       3867
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3929708"
     variation       3870
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200085678"
     exon            3931..4184
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3956
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200722491"
     variation       3959
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368136238"
     variation       3967
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371957302"
     variation       3983
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373763986"
     variation       4004
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376675866"
     variation       4007
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199743989"
     variation       4027
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367676896"
     variation       4047
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201709033"
     variation       4048
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375360391"
     variation       4066
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201202020"
     variation       4091
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143158234"
     variation       4101
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201702546"
     variation       4116
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369318614"
     variation       4118
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201889432"
     variation       4122
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190271845"
     variation       4132
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377467641"
     variation       4177
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199982600"
     exon            4185..4261
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4189
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374590484"
     variation       4208
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377000129"
     variation       4244
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371424977"
     variation       4252
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113191202"
     variation       4253
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374292446"
     variation       4259
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377275619"
     exon            4262..4393
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4264
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188676684"
     variation       4265
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181413894"
     variation       4294..4295
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35666852"
     variation       4323
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783697"
     variation       4328
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376234883"
     variation       4383
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201929144"
     variation       4391
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373649439"
     exon            4394..4571
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4450
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729923"
     variation       4516
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200906427"
     variation       4528
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148016417"
     variation       4537
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369759253"
     variation       4540
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372138430"
     variation       4563
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376795880"
     variation       4565
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369067010"
     variation       4569
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373357386"
     exon            4572..4726
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4601
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140874828"
     variation       4609
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369935221"
     variation       4614
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192561585"
     variation       4708
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144692893"
     variation       4709
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202235093"
     variation       4718
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200405048"
     exon            4727..4832
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4728
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200127338"
     variation       4729
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139175231"
     exon            4833..4898
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4839
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374096160"
     variation       4864
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11611"
     variation       4875
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370303493"
     exon            4899..4983
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4947
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28535751"
     exon            4984..6034
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     STS             4998..5287
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="WI-20905"
                     /db_xref="UniSTS:31105"
     variation       5007
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140026883"
     variation       5041
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377020452"
     variation       5048
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45568037"
     variation       5060
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371910625"
     variation       5061
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375085808"
     STS             5071..5203
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="RH15628"
                     /db_xref="UniSTS:59832"
     STS             5087..5211
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="D14S696E"
                     /db_xref="UniSTS:151575"
     variation       5111
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188723128"
     variation       5115..5119
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="tcggg"
                     /db_xref="dbSNP:199504537"
     variation       5117
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745066"
     variation       5132
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373503925"
     variation       5137
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376691503"
     variation       5212
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375948139"
     variation       5240
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74607305"
     variation       5362
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370422091"
     variation       5414
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369997201"
     variation       5478
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139596781"
     variation       5484
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397560"
     variation       5485
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149751065"
     STS             5538..5676
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="G30978"
                     /db_xref="UniSTS:64038"
     variation       5563
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145442381"
     variation       5577
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545286"
     variation       5580
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139072701"
     variation       5626
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181452208"
     variation       5655
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185323978"
     variation       5795
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74058013"
     variation       5831
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144014186"
ORIGIN      
aatttacctaatcccacgtccctaacggtcttcggaagcgaagcagtgtcaacagtccctggtaaacacaagtagtattacaagtcgggagctcttcaagtcttggatgagactgtagagcggtcttgtgcggcaatgtgctaccttaaaataaataaataaataaacccctgttatgtccggagtttgtttccacccggagaggaatggaagagcaccagagagcgcttagctttctggttggatgttttggtgtgggacttgttttgtgaccaacaatatgaaaggctctgaggtcagcttggagaagaaaaaaaagattaagatgccagtgaagagacttcgtgaggtagtttctcaaaatcatggagatcatttggttttgctgaaagatgagttgccctgtgttcctccggcattgtctgcaaataaacgtcttcctgttggaacggggactagtttgaatggaacatcacgtggttcatcagacttaacttctgctagaaattgttaccagcctctattagaaaatcccatggtgtcagaaagtgatttttctaaagacgttgcagtgcaagtgttgcctttggataaaatagaagagaacaacaagcaaaaagcaaatgacatcttcatttctcagtatacaatgggacagaaagatgctctaagaacagttttaaagcaaaatgtctcactttgtctcacaggctggagtgatcacagtggggtgatcacaactcactgcagtctctacctcctcaggctcatgagatcctcccacctcagcctcccgagtagctgggactacagagctcaaagcatgcctgtttttaaggaagtaaaggtacatctgttagaagatgcaggcatagagaaggatgctgttactcaggagactagaatttcacccagtggaattgattcagctacaaccgtggctgcagcaactgctgctgccattgcaaccgcagctccgttgataaaggtgcagagtgatttggaagcaaaagtcaattctgttacagaattacttagtaaattacaggagactgataaacacctgcaacgtgttacagagcagcaaacaagcattcagaggaaacaagagaaattacattgtcatgatcacgaaaagcaaatgaatgtgtttatggagcagcacataaggcatcttgaaaagttacaacaacaacaaatagatattcagactcattttattagtgctgcactcaagactagtagttttcagcctgttagtatgccctcctccagagcagtggaaaagtattccgtaaaaccagaacaccctaatcttggtagctgtaatccatctttatataacacatttgcttccaaacaagcacctttaaaagaagttgaagatacgagttttgataaacagaaatctcctttggagacaccagcacctcgcagatttgctcctgtacctgtttcaagggatgatgaactatcaaagagggaaaatcttttggaagaaaaagaaaatatggaagtgtcgtgtcacagaggaaatgtaagactattggaacaaattttgaataataatgattctttgacaagaaaaagtgaatcatcaaacaccacctcactaactaggtcaaaaataggatggactcctgagaaaacaaacagatttccttcctgtgaagagctagaaacaactaaagtgactatgcagaagtctgatgatgttcttcatgaccttggccaaaaagagaaagaaacaaatagcatggtccagccaaaagaatctctgagtatgttgaagcttccagatcttccacagaattctgttaagcttcaaacaaccaatacaacaagatctgtattgaaagatgctgagaagattttgagaggagtacaaaacaataaaaaagtacttgaagaaaacctggaagctattattcgtgcaaaagatggagctgccatgtattcgcttatcaatgctttatctaccaacagagagatgtcagagaaaattaggatcagaaagacagtggatgaatggattaaaactatttctgcagaaattcaggatgaactgtcaagaacagattatgaacaaaaaagatttgatcagaagaatcagagaaccaagaaaggtcagaatatgactaaagatattagaaccaacacacaagataaaactgtcaacaaatctgtaattccaagaaaacattctcaaaagcaaatagaagagcattttagaaatctacctatgaggggcatgcctgcttcaagtttacagaaagagagaaaggaagggcttttgaaagcaaccacagtaatacaagatgaagattatatgttacaagtctatggaaagccagtttatcagggccatcgaagcactcttaaaaaaggaccatatctcagatttaattctccatctcctaagtccagaccacagagaccaaaagtaatagaacgagttaaaggcactaaggtaaagtcaataagaacacagactgacttctatgcaacaaaacctaagaagatggattctaaaatgaaacattctgttcctgtgttacctcatggcgatcagcaatatttgttcagcccaagtagagaaatgcctactttttcaggtacattggaaggtcatctgattcctatggcaattcttttaggacaaacccaaagtaatagtgataccatgccacctgctggagtgattgtcagcaagccacaccctgtaactgtgactacttctattcctccatcatctcgaaaagtagaaactggagtaaagaaacctaacatagccattgtagaaatgaagtcagaaaaaaaggatcctcctcagcttactgtgcaggtattacccagtgtagatattgacagcatttcaaatagtagtgctgatgtcctttcacctctgtctagccccaaagaagcatctcttcctcctgtgcaaacttggataaagactccagaaattatgaaggtagatgaagaagaggtgaagtttccaggaactaactttgatgaaataatcgatgtcatacaggaagaagaaaaatgtgatgaaattccagactctgaaccaattctggagtttaacagaagtgttaaagctgattctacaaaatataatggtcctccatttccgccagttgcttctacttttcagcccactgctgatattctggataaagtaattgagagaaaagaaacactggaaaatagcttaattcaatgggtagagcaagaaataatgtcaagaattatctctgggctctttccagtccagcaacagattgcacctagtatcagtgtttcagtcagtgagacaagtgaaccactgacttctgacattgtggaaggaacaagcagtggcgccctccagctttttgttgatgctggtgttcctgtgaactcaaatgtgattaaacattttgttaacgaagctcttgctgagaccattgctgtcatgctgggtgacagagaagcaaagaagcaaggtcctgttgctacaggtgtttctggggatgcttcaacaaatgaaacatatttgccggcaagagtgtgcaccccactgcctaccccacagcctacgcctccttgctcaccttcatcacctgctaaggagtgtgttttggtaaagactccagattcttctccctgtgattcggatcatgatatggcttttcctgtgaaagaaatatgtgctgaaaaaggagatgatatgcctgccatcatgcttgttaatactccaacagttacccctactactacacctcctccagcggcggcagtttttaccccaactttgtcagatatttccattgataaattgaaggtatcaagcccagagcttcccaagccatggggtgatggagacctgccactggaagaagagaaccctaactcacctcaagaagaacttcatccaagagctattgtaatgtctgtggctaaggatgaagaaccagagagtatggatttccctgctcagcctccacctccagagccagttccctttatgccatttcctgccggcaccaaggccccttccccctcacagatgccaggttctgattcatcaacactggagagcacattgagtgttactgtcactgaaactgaaactttagataaacccatctctgaaggagagattttatttagctgtggtcaaaaattggcccccaagattttagaagatataggactgtacctgacaaaccttaatgatagcttatccagcactctgcatgatgccgttgaaatggaggatgatcctcctagtgaagggcaagtgattaggatgtcccataaaaaatttcatgcagatgcaattctttcttttgctaaacaaaaccaggagtcagcagtttcccagcaagcagtctatcattcagaggacttggaaaacagtgtgggtgaacttagtgaaggacaaagaccccagctaacagcggcagcagagaacatcttaatgggacattctctctatatgcagccacctgtcactaatacacagtctttggatcaacaatgtgatcctaaaccattatctcggcaatttgacacagtttcaggtagtatttatgaagattcatgtgctagtcatggtccaatgagtttgggagaattggagttggagccaaattctaagctggttcttcccacaacacttctgacagcacaagaaaatgatgttaatttaccagtagccgctgaagatttttcccagtaccaactaaagcaaaatcaggatgttaagcaagttgaacacaaaccatcacaaagttacctacgtgttagaaataaatctgatattgcaccttcacagcaacaagtttcaccaggtgatatggatcggacacaaattgagcttaatccgtacctcacatgtgtattttcaggtttgggggtacatgtgaagaaggtttcctgtataggtaaactcgggctgtggaggtttgtcatacagattatttcatcacccaggtgggaaagcagtgccactctccgcttcacagatgccccctgccaagatgtcagtgatgctgccgtcagtgaacctcgaggactgctctcagtctctgagtctcagcacaatgcaggaggacatggagtcttcgggggcagataccttctgaacgggaagagacagccagcacagtgtttatgccactggttttaaagtcattttaccttggcttaaaaccctctctcagactgtttggtttttgagcatattctgaaaaaaaaattccaatattttaaaataaaacaaaaagcataatttgggtatttaaagtttttaaataaaataagtataagtcattataagtctgattgtgagttgtttcttagaatcctgagatagcatagagtagtgaaagggcatggcttttgacatctaggcatttaatctataggtgtaattatctgtatgtatttataaaattatgtagctcaaggttattcattctaacatttttataacagcaaatagaaaaaatcaaatgtctatcaataatagactggttttaaagtgatggtacatcagtacaatggaatactatgtattacaaaaaaaaatttaaaaagtttattgatatggaataatctttgagatgcactgttaaagtgaaaaaagccatgtgcaaaatagtgtgtgaactatgcagttgttgaaattatttaaaatggggtggggaggaattcaaatgtatggtatgtcacatattcttacatgtatttgcttgtaaatatattatataaacaagaaactgctaagtttgtctccagggagtagaattgttggctgggtgataggagaggctaagtgataggaatcaaggataatcgtggttactatgtatttgaacttcagttgtgatagaaaaaaatcatcagtgagattaatttttatatgccttatgtataccatataaacctttataaacctgtgaaacatgtaactctattaccttttgcaacataaatacataaaattaaaggaaaataaaaagcattgcttcgtaatcagataaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9786 -> Biological process: GO:0007224 [smoothened signaling pathway] evidence: ISS
            GeneID:9786 -> Biological process: GO:0060271 [cilium morphogenesis] evidence: ISS
            GeneID:9786 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:9786 -> Cellular component: GO:0005813 [centrosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.