Home |
Help |
Advanced search
2024-04-24 05:54:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001244134 2782 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens mitogen-activated protein kinase kinase kinase 8
(MAP3K8), transcript variant 2, mRNA.
ACCESSION NM_001244134
VERSION NM_001244134.1 GI:346644794
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2782)
AUTHORS Gkirtzimanaki,K., Gkouskou,K.K., Oleksiewicz,U., Nikolaidis,G.,
Vyrla,D., Liontos,M., Pelekanou,V., Kanellis,D.C., Evangelou,K.,
Stathopoulos,E.N., Field,J.K., Tsichlis,P.N., Gorgoulis,V.,
Liloglou,T. and Eliopoulos,A.G.
TITLE TPL2 kinase is a suppressor of lung carcinogenesis
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (16), E1470-E1479 (2013)
PUBMED 23533274
REMARK GeneRIF: TPL2 was found to antagonize oncogene-induced cell
transformation and survival through a pathway involving p53
downstream of cJun N-terminal kinase (JNK) and be required for
optimal p53 response to genotoxic stress.
REFERENCE 2 (bases 1 to 2782)
AUTHORS Tunca,B., Tezcan,G., Cecener,G., Egeli,U., Zorluoglu,A.,
Yilmazlar,T., Ak,S., Yerci,O., Ozturk,E., Umut,G. and Evrensel,T.
TITLE Overexpression of CK20, MAP3K8 and EIF5A correlates with poor
prognosis in early-onset colorectal cancer patients
JOURNAL J. Cancer Res. Clin. Oncol. 139 (4), 691-702 (2013)
PUBMED 23322277
REMARK GeneRIF: Overexpression of MAP3K8 is associated with early-onset
colorectal cancer.
REFERENCE 3 (bases 1 to 2782)
AUTHORS Kim,G., Khanal,P., Lim,S.C., Yun,H.J., Ahn,S.G., Ki,S.H. and
Choi,H.S.
TITLE Interleukin-17 induces AP-1 activity and cellular transformation
via upregulation of tumor progression locus 2 activity
JOURNAL Carcinogenesis 34 (2), 341-350 (2013)
PUBMED 23125217
REMARK GeneRIF: High TPL2 expression is associated with tumor progression.
REFERENCE 4 (bases 1 to 2782)
AUTHORS Jostins,L., Ripke,S., Weersma,R.K., Duerr,R.H., McGovern,D.P.,
Hui,K.Y., Lee,J.C., Schumm,L.P., Sharma,Y., Anderson,C.A.,
Essers,J., Mitrovic,M., Ning,K., Cleynen,I., Theatre,E.,
Spain,S.L., Raychaudhuri,S., Goyette,P., Wei,Z., Abraham,C.,
Achkar,J.P., Ahmad,T., Amininejad,L., Ananthakrishnan,A.N.,
Andersen,V., Andrews,J.M., Baidoo,L., Balschun,T., Bampton,P.A.,
Bitton,A., Boucher,G., Brand,S., Buning,C., Cohain,A., Cichon,S.,
D'Amato,M., De Jong,D., Devaney,K.L., Dubinsky,M., Edwards,C.,
Ellinghaus,D., Ferguson,L.R., Franchimont,D., Fransen,K.,
Gearry,R., Georges,M., Gieger,C., Glas,J., Haritunians,T., Hart,A.,
Hawkey,C., Hedl,M., Hu,X., Karlsen,T.H., Kupcinskas,L.,
Kugathasan,S., Latiano,A., Laukens,D., Lawrance,I.C., Lees,C.W.,
Louis,E., Mahy,G., Mansfield,J., Morgan,A.R., Mowat,C., Newman,W.,
Palmieri,O., Ponsioen,C.Y., Potocnik,U., Prescott,N.J.,
Regueiro,M., Rotter,J.I., Russell,R.K., Sanderson,J.D., Sans,M.,
Satsangi,J., Schreiber,S., Simms,L.A., Sventoraityte,J.,
Targan,S.R., Taylor,K.D., Tremelling,M., Verspaget,H.W., De Vos,M.,
Wijmenga,C., Wilson,D.C., Winkelmann,J., Xavier,R.J., Zeissig,S.,
Zhang,B., Zhang,C.K., Zhao,H., Silverberg,M.S., Annese,V.,
Hakonarson,H., Brant,S.R., Radford-Smith,G., Mathew,C.G.,
Rioux,J.D., Schadt,E.E., Daly,M.J., Franke,A., Parkes,M.,
Vermeire,S., Barrett,J.C. and Cho,J.H.
CONSRTM International IBD Genetics Consortium (IIBDGC)
TITLE Host-microbe interactions have shaped the genetic architecture of
inflammatory bowel disease
JOURNAL Nature 491 (7422), 119-124 (2012)
PUBMED 23128233
REFERENCE 5 (bases 1 to 2782)
AUTHORS Ballester,A., Tobena,R., Lisbona,C., Calvo,V. and Alemany,S.
TITLE Cot kinase regulation of IL-2 production in Jurkat T cells
JOURNAL J. Immunol. 159 (4), 1613-1618 (1997)
PUBMED 9257820
REFERENCE 6 (bases 1 to 2782)
AUTHORS Salmeron,A., Ahmad,T.B., Carlile,G.W., Pappin,D., Narsimhan,R.P.
and Ley,S.C.
TITLE Activation of MEK-1 and SEK-1 by Tpl-2 proto-oncoprotein, a novel
MAP kinase kinase kinase
JOURNAL EMBO J. 15 (4), 817-826 (1996)
PUBMED 8631303
REFERENCE 7 (bases 1 to 2782)
AUTHORS Aoki,M., Hamada,F., Sugimoto,T., Sumida,S., Akiyama,T. and
Toyoshima,K.
TITLE The human cot proto-oncogene encodes two protein serine/threonine
kinases with different transforming activities by alternative
initiation of translation
JOURNAL J. Biol. Chem. 268 (30), 22723-22732 (1993)
PUBMED 8226782
REFERENCE 8 (bases 1 to 2782)
AUTHORS Chan,A.M., Chedid,M., McGovern,E.S., Popescu,N.C., Miki,T. and
Aaronson,S.A.
TITLE Expression cDNA cloning of a serine kinase transforming gene
JOURNAL Oncogene 8 (5), 1329-1333 (1993)
PUBMED 8479752
REFERENCE 9 (bases 1 to 2782)
AUTHORS Aoki,M., Akiyama,T., Miyoshi,J. and Toyoshima,K.
TITLE Identification and characterization of protein products of the cot
oncogene with serine kinase activity
JOURNAL Oncogene 6 (9), 1515-1519 (1991)
PUBMED 1833717
REFERENCE 10 (bases 1 to 2782)
AUTHORS Miyoshi,J., Higashi,T., Mukai,H., Ohuchi,T. and Kakunaga,T.
TITLE Structure and transforming potential of the human cot oncogene
encoding a putative protein kinase
JOURNAL Mol. Cell. Biol. 11 (8), 4088-4096 (1991)
PUBMED 2072910
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB271664.1, AK290320.1 and
AL161651.13.
Summary: This gene is an oncogene that encodes a member of the
serine/threonine protein kinase family. The encoded protein
localizes to the cytoplasm and can activate both the MAP kinase and
JNK kinase pathways. This protein was shown to activate IkappaB
kinases, and thus induce the nuclear production of NF-kappaB. This
protein was also found to promote the production of TNF-alpha and
IL-2 during T lymphocyte activation. This gene may also utilize a
downstream in-frame translation start codon, and thus produce an
isoform containing a shorter N-terminus. The shorter isoform has
been shown to display weaker transforming activity. Alternate
splicing results in multiple transcript variants that encode the
same protein. [provided by RefSeq, Sep 2011].
Transcript Variant: This variant (2) differs in the 5' UTR compared
to variant 1. Both variants 1 and 2 encode the same protein.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK290320.1, AK313295.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-104 DB271664.1 1-104
105-605 AK290320.1 1-501
606-615 AL161651.13 121754-121763
616-1974 AK290320.1 512-1870
1975-2782 AL161651.13 143617-144424
FEATURES Location/Qualifiers
source 1..2782
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10p11.23"
gene 1..2782
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="mitogen-activated protein kinase kinase kinase 8"
/db_xref="GeneID:1326"
/db_xref="HGNC:6860"
/db_xref="MIM:191195"
exon 1..358
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 77
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:8176952"
misc_feature 139..141
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="upstream in-frame stop codon"
variation 164
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:8176953"
variation 168
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:8176954"
variation 214
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372356298"
variation 278
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369075210"
variation 352
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269691"
exon 359..717
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
CDS 382..1785
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/EC_number="2.7.11.25"
/note="cot (cancer Osaka thyroid) oncogene; Ewing sarcoma
transformant; proto-oncogene serine/threoine protein
kinase; proto-oncogene c-Cot; tumor progression locus 2"
/codon_start=1
/product="mitogen-activated protein kinase kinase kinase
8"
/protein_id="NP_001231063.1"
/db_xref="GI:346644795"
/db_xref="CCDS:CCDS7166.1"
/db_xref="GeneID:1326"
/db_xref="HGNC:6860"
/db_xref="MIM:191195"
/translation="
MEYMSTGSDNKEEIDLLIKHLNVSDVIDIMENLYASEEPAVYEPSLMTMCQDSNQNDERSKSLLLSGQEVPWLSSVRYGTVEDLLAFANHISNTAKHFYGQRPQESGILLNMVITPQNGRYQIDSDVLLIPWKLTYRNIGSDFIPRGAFGKVYLAQDIKTKKRMACKLIPVDQFKPSDVEIQACFRHENIAELYGAVLWGETVHLFMEAGEGGSVLEKLESCGPMREFEIIWVTKHVLKGLDFLHSKKVIHHDIKPSNIVFMSTKAVLVDFGLSVQMTEDVYFPKDLRGTEIYMSPEVILCRGHSTKADIYSLGATLIHMQTGTPPWVKRYPRSAYPSYLYIIHKQAPPLEDIADDCSPGMRELIEASLERNPNHRPRAADLLKHEALNPPREDQPRCQSLDSALLERKRLLSRKELELPENIADSSCTGSTEESEMLKRQRSLYIDLGALAGYFNLVRGPPTLEYG
"
misc_feature 469..471
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="Region: alternative start codon"
misc_feature 619..621
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P41279.2); phosphorylation site"
misc_feature 808..1536
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="Protein Kinases, catalytic domain; Region:
PKc_like; cl09925"
/db_xref="CDD:213116"
misc_feature order(811..825,835..837,874..876,880..882,952..954,
1000..1011,1021..1023,1027..1029,1138..1140,1144..1146,
1150..1155,1189..1191,1198..1200,1246..1257)
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(811..825,835..837,874..876,880..882,952..954,
1000..1011,1021..1023,1138..1140,1144..1146,1150..1155,
1189..1191)
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature 817..1539
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(823..825,1021..1023,1027..1029,1138..1140,
1144..1146,1150..1152,1198..1200,1246..1257)
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(1186..1206,1246..1257)
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 1579..1581
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P41279.2); phosphorylation site"
misc_feature 1708..1710
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P41279.2); phosphorylation site"
variation 423
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:372120772"
variation 463
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150579938"
variation 475
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139640494"
variation 478
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:374430565"
variation 540
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77186746"
variation 550
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150001848"
variation 556
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:117396201"
variation 557
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146728212"
variation 571
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377410996"
variation 603
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:55962705"
variation 609
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:370656437"
variation 611
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:549474"
variation 615
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042058"
variation 624
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145696701"
exon 718..885
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 724
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368515552"
variation 756
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:112441933"
variation 757
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201540136"
variation 765
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375673139"
variation 783
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376205657"
variation 799
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:201892819"
variation 817
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369295837"
variation 818
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143041571"
variation 822
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200843234"
variation 823
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3751449"
variation 853
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:368789124"
variation 876
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143662794"
exon 886..1147
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 895
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:151108315"
variation 938
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373057774"
variation 954
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201649487"
variation 968
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142650056"
variation 976
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:146749791"
variation 1011
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377297760"
variation 1022
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3087944"
exon 1148..1254
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 1212
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373977741"
variation 1214
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:139293295"
exon 1255..1407
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 1272
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace=""
/replace="g"
/db_xref="dbSNP:66989210"
variation 1296
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:8177062"
variation 1329
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:114464695"
exon 1408..1654
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 1437
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:137991584"
variation 1509
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149450278"
variation 1510
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143874924"
variation 1519
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368578451"
variation 1530
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201275234"
variation 1534
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77316331"
variation 1550
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138733925"
variation 1551
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141896473"
variation 1556
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371438608"
variation 1577
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:374373740"
variation 1581
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146241749"
variation 1603
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:200350013"
variation 1650
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139333853"
exon 1655..2782
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/inference="alignment:Splign:1.39.8"
variation 1661
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143676953"
variation 1662
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150841663"
variation 1666
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374109727"
variation 1675
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:375251313"
variation 1677
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369517029"
variation 1678
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145710720"
variation 1693
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:190610498"
variation 1695
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372877014"
variation 1719
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375876692"
variation 1720
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139316352"
variation 1725
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:8177034"
variation 1728
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368281659"
variation 1739
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:372679892"
variation 1748
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376945200"
variation 1822
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:76259773"
STS 1837..2042
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/standard_name="SHGC-35244"
/db_xref="UniSTS:59219"
variation 1915
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:3034"
variation 1923
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:181810063"
variation 1924
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:187247240"
variation 2100
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:191999092"
variation 2166
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:182628550"
variation 2215..2216
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace=""
/replace="aa"
/db_xref="dbSNP:201417879"
variation 2216..2217
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace=""
/replace="tt"
/db_xref="dbSNP:143503665"
variation 2216
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace=""
/replace="tt"
/db_xref="dbSNP:8177035"
variation 2303
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:186978828"
STS 2334..2641
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/standard_name="SHGC-78707"
/db_xref="UniSTS:95584"
variation 2400..2401
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace=""
/replace="t"
/db_xref="dbSNP:35579124"
variation 2415
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:3802631"
variation 2462
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:190217524"
variation 2518
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:369084396"
variation 2615
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:182807011"
variation 2664
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:8177036"
variation 2677
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:8177037"
polyA_signal 2714..2719
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
polyA_site 2738
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
variation 2739
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:8177038"
variation 2744
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:8177039"
polyA_signal 2760..2765
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
polyA_site 2782
/gene="MAP3K8"
/gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2"
ORIGIN
accctgcaaccgggcagtctctttctgtttacggagagaaaggggaaatggaaaagtcggggaggcggtggctggcgtccgctgcgccgcccctgggcaggctcagacgccgtgagtcaggggcagagcagggcggtctgagcgtgcgggcgacgcgggtctcactcgtccgctccgctctggactgcgcgccacgctctggggtccggcgccctggttcctgcttctgccgctgccgccgccggatcccagtggcccggcgtgctcggctcccacaggcctgcagccagcatcgcaccgaaccttcggggggccgcggctggagcgctcggccggcgtgggagcgccaaggccgcagactctccagaaagagcaacagtaatggagtacatgagcactggaagtgacaataaagaagagattgatttattaattaaacatttaaatgtgtctgatgtaatagacattatggaaaatctttatgcaagtgaagagccagcagtttatgaacccagtctaatgaccatgtgtcaagacagtaatcaaaacgatgagcgttctaagtctctgctgcttagtggccaagaggtaccatggttgtcatcagtcagatatggaactgtggaggatttgcttgcttttgcaaaccatatatccaacactgcaaagcatttttatggacaacgaccacaggaatctggaattttattaaacatggtcatcactccccaaaatggacgttaccaaatagattccgatgttctcctgatcccctggaagctgacttacaggaatattggttctgattttattcctcggggcgcctttggaaaggtatacttggcacaagatataaagacgaagaaaagaatggcgtgtaaactgatcccagtagatcaatttaagccatctgatgtggaaatccaggcttgcttccggcacgagaacatcgcagagctgtatggcgcagtcctgtggggtgaaactgtccatctctttatggaagcaggcgagggagggtctgttctggagaaactggagagctgtggaccaatgagagaatttgaaattatttgggtgacaaagcatgttctcaagggacttgattttctacactcaaagaaagtgatccatcatgatattaaacctagcaacattgttttcatgtccacaaaagctgttttggtggattttggcctaagtgttcaaatgaccgaagatgtctattttcctaaggacctccgaggaacagagatttacatgagcccagaggtcatcctgtgcaggggccattcaaccaaagcagacatctacagcctgggggccacgctcatccacatgcagacgggcaccccaccctgggtgaagcgctaccctcgctcagcctatccctcctacctgtacataatccacaagcaagcacctccactggaagacattgcagatgactgcagtccagggatgagagagctgatagaagcttccctggagagaaaccccaatcaccgcccaagagccgcagacctactaaaacatgaggccctgaacccgcccagagaggatcagccacgctgtcagagtctggactctgccctcttggagcgcaagaggctgctgagtaggaaggagctggaacttcctgagaacattgctgattcttcgtgcacaggaagcaccgaggaatctgagatgctcaagaggcaacgctctctctacatcgacctcggcgctctggctggctacttcaatcttgttcggggaccaccaacgcttgaatatggctgaaggatgccatgtttgctctaaattaagacagcattgatctcctggaggctggttctgctgcctctacacaggggccctgtacagtgaatggtgccattttcgaaggagcagtgtgacctcctgtgacccatgaatgtgcctccaagcggccctgtgtgtttgacatgtgaagctatttgatatgcaccaggtctcaaggttctcatttctcaggtgacgtgattctaaggcaggaatttgagagttcacagaaggatcgtgtctgctgactgtttcattcactgtgcactttgctcaaaattttaaaaataccaatcacaaggataatagagtagcctaaaattactattcttggttcttatttaagtatggaatattcattttactcagaatagctgttttgtgtatattggtgtatattatataactctttgagcctttattggtaaattctggtatacattgaattcattataatttgggtgactagaacaacttgaagattgtagcaataagctggactagtgtcctaaaaatggctaactgatgaattagaagccatctgacagcaggccactagtgacagtttcttttgtgttcctatggaaacattttatactgtacatgctatgctgaagacattcaaaacgtgatgttttgaatgtggataaaactgtgtaaaccacataatttttgtacatcccaaaggatgagaatgtgacctttaagaaaaatgaaaacttttgtaaattattgatgattttgtaattcttatgactaaattttcttttaagcatttgtatattaaaatagcatactgtgtatgttttatatcaaatgccttcatgaatctttcatacatatatatatttgtaacattgtaaagtatgtgagtagtcttatgtaaagtatgtttttacattatgcaaataaaacccaatacttttgtccaatgtggttggtcaaatcaactgaataaattcagtattttgcctta
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1326 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA
GeneID:1326 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:1326 -> Molecular function: GO:0004709 [MAP kinase kinase kinase activity] evidence: IEA
GeneID:1326 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1326 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:1326 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:1326 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:1326 -> Biological process: GO:0031295 [T cell costimulation] evidence: TAS
GeneID:1326 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:1326 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001231063 -> EC 2.7.11.25
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.