GGRNA Home | Help | Advanced search

2019-03-23 03:24:51, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001243342            3562 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript
            variant 2, mRNA.
ACCESSION   NM_001243342
VERSION     NM_001243342.1  GI:343183426
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3562)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   2  (bases 1 to 3562)
  AUTHORS   Blanchon,S., Legendre,M., Copin,B., Duquesnoy,P., Montantin,G.,
            Kott,E., Dastot,F., Jeanson,L., Cachanado,M., Rousseau,A.,
            Papon,J.F., Beydon,N., Brouard,J., Crestani,B., Deschildre,A.,
            Desir,J., Dollfus,H., Leheup,B., Tamalet,A., Thumerelle,C.,
            Vojtek,A.M., Escalier,D., Coste,A., de Blic,J., Clement,A.,
            Escudier,E. and Amselem,S.
  TITLE     Delineation of CCDC39/CCDC40 mutation spectrum and associated
            phenotypes in primary ciliary dyskinesia
  JOURNAL   J. Med. Genet. 49 (6), 410-416 (2012)
   PUBMED   22693285
  REMARK    GeneRIF: Aiming to delineate the CCDC39/CCDC40 mutation spectrum
            and associated phenotypes, a large cohort of patients with IDA
            defects were screened. Biallelic CCDC39 or CCDC40 mutations were
            identified in 30/34 unrelated families with IDA defects.
REFERENCE   3  (bases 1 to 3562)
  AUTHORS   Becker-Heck,A., Zohn,I.E., Okabe,N., Pollock,A., Lenhart,K.B.,
            Sullivan-Brown,J., McSheene,J., Loges,N.T., Olbrich,H.,
            Haeffner,K., Fliegauf,M., Horvath,J., Reinhardt,R., Nielsen,K.G.,
            Marthin,J.K., Baktai,G., Anderson,K.V., Geisler,R., Niswander,L.,
            Omran,H. and Burdine,R.D.
  TITLE     The coiled-coil domain containing protein CCDC40 is essential for
            motile cilia function and left-right axis formation
  JOURNAL   Nat. Genet. 43 (1), 79-84 (2011)
   PUBMED   21131974
  REMARK    GeneRIF: CCDC40 mutations in humans result in a variant of primary
            ciliary dyskinesia characterized by misplacement of the central
            pair of microtubules and defective assembly of inner dynein arms
            and dynein regulatory complexes.
REFERENCE   4  (bases 1 to 3562)
  AUTHORS   Wang,J., Lin,J., Chang,Y., Li,P. and Yang,Y.
  TITLE     MCM3AP, a novel HBV integration site in hepatocellular carcinoma
            and its implication in hepatocarcinogenesis
  JOURNAL   J. Huazhong Univ. Sci. Technol. Med. Sci. 30 (4), 425-429 (2010)
   PUBMED   20714864
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB230102.1, BC035251.1,
            DA842356.1, AB046860.1, AC087741.18 and BQ009577.1.
            
            Summary: This gene encodes a protein that is necessary for motile
            cilia function. It functions in correct left-right axis formation
            by regulating the assembly of the inner dynein arm and the dynein
            regulatory complexes, which control ciliary beat. Mutations in this
            gene cause ciliary dyskinesia type 15, a disorder due to defects in
            cilia motility. Alternative splicing results in multiple transcript
            variants. [provided by RefSeq, Aug 2011].
            
            Transcript Variant: This variant (2) differs in the 3' coding
            region and 3' UTR, compared to variant 1. The encoded isoform (2)
            has a distinct and shorter C-terminus, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC035251.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                DB230102.1         1-11
            12-237              BC035251.1         5-230
            238-583             DA842356.1         218-563
            584-1115            BC035251.1         577-1108
            1116-2478           AB046860.1         622-1984
            2479-2882           BC035251.1         2472-2875
            2883-3329           AC087741.18        119569-120015       c
            3330-3562           BQ009577.1         1-233               c
FEATURES             Location/Qualifiers
     source          1..3562
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q25.3"
     gene            1..3562
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /note="coiled-coil domain containing 40"
                     /db_xref="GeneID:55036"
                     /db_xref="HGNC:26090"
                     /db_xref="MIM:613799"
     exon            1..60
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    20..22
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /note="upstream in-frame stop codon"
     CDS             32..3124
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /note="isoform 2 is encoded by transcript variant 2;
                     coiled-coil domain-containing protein 40"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 40 isoform
                     2"
                     /protein_id="NP_001230271.1"
                     /db_xref="GI:343183427"
                     /db_xref="CCDS:CCDS58604.1"
                     /db_xref="GeneID:55036"
                     /db_xref="HGNC:26090"
                     /db_xref="MIM:613799"
                     /translation="
MAEPGGAAGRSHPEDGSASEGEKEGNNESHMVSPPEKDDGQKGEEAVGSTEHPEEVTTQAEAAIEEGEVETEGEAAVEGEEEAVSYGDAESEEEYYYTETSSPEGQISAADTTYPYFSPPQELPGEEAYDSVSGEAGLQGFQQEATGPPESRERRVTSPEPSHGVLGPSEQMGQVTSGPAVGRLTGSTEEPQGQVLPMGVQHRFRLSHGSDIESSDLEEFVSQEPVIPPGVPDAHPREGDLPVFQDQIQQPSTEEGAMAERVESEGSDEEAEDEGSQLVVLDPDHPLMVRFQAALKNYLNRQIEKLKLDLQELVVATKQSRAQRQELGVNLYEVQQHLVHLQKLLEKSHDRHAMASSERRQKEEELQAARALYTKTCAAANEERKKLAALQTEMENLALHLFYMQNIDQDMRDDIRVMTQVVKKAETERIRAEIEKKKQDLYVDQLTTRAQQLEEDIALFEAQYLAQAEDTRILRKAVSEACTEIDAISVEKRRIMQQWASSLVGMKHRDEAHRAVLEALRGCQHQAKSTDGEIEAYKKSIMKEEEKNEKLASILNRTETEATLLQKLTTQCLTKQVALQSQFNTYRLTLQDTEDALSQDQLEQMILTEELQAIRQAIQGELELRRKTDAAIREKLQEHMTSNKTTKYFNQLILRLQKEKTNMMTHLSKINGDIAQTTLDITHTSSRLDAHQKTLVELDQDVKKVNELITNSQSEISRRTILIERKQGLINFLNKQLERMVSELGGEEVGPLELEIKRLSKLIDEHDGKAVQAQVTWLRLQQEMVKVTQEQEEQLASLDASKKELHIMEQKKLRVESKIEQEKKEQKEIEHHMKDLDNDLKKLNMLMNKNRCSSEELEQNNRVTENEFVRSLKASERETIKMQDKLNQLSEEKATLLNQLVEAEHQIMLWEKKIQLAKEMRSSVDSEIGQTEIRAMKGEIHRMKKYCRTTQDAHRHVHEQHGTHAGTCTKNTGRAQARARTTRDARGHVHEQHGTRAGTCTNNTGRAQARARTRDARRHVHEHRTHTARA
"
     misc_feature    2369..2668
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /note="BRE1 E3 ubiquitin ligase; Region: BRE1; pfam08647"
                     /db_xref="CDD:192111"
     variation       59
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377599647"
     exon            61..124
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       63
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111822347"
     variation       76
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370072666"
     variation       82
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141650385"
     variation       84
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376944255"
     exon            125..583
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       140
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370705321"
     variation       173
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2289526"
     variation       211
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185006459"
     variation       221
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367783575"
     variation       238
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2289527"
     variation       270
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:190249222"
     variation       288
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202220442"
     variation       305
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376842482"
     variation       347
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368664430"
     variation       365
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201709592"
     variation       415
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375586063"
     variation       430
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371207249"
     variation       431
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201191082"
     variation       469
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147879748"
     variation       470
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369439725"
     variation       520
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372917306"
     variation       535
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74000351"
     variation       537
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369066468"
     variation       538
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2885349"
     variation       583
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141588728"
     exon            584..707
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       596
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372456780"
     variation       629
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200292678"
     variation       638
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367978204"
     variation       655
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370581662"
     variation       661
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117419007"
     variation       662
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150615436"
     variation       668
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372360189"
     variation       679
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375350606"
     variation       691
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200678214"
     variation       692
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371890970"
     variation       697
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199671771"
     exon            708..886
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       727
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200710012"
     variation       728
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201815496"
     variation       730
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9893189"
     variation       752
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201924332"
     variation       787
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374154296"
     variation       790
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183808038"
     variation       803
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200614903"
     variation       824
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377613873"
     variation       865
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150318323"
     variation       881
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201042940"
     variation       886
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200034484"
     exon            887..970
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       891
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898386"
     variation       904
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2289531"
     variation       932
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201223986"
     variation       933
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191632512"
     exon            971..1190
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       977
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61998241"
     variation       993
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114740534"
     variation       997
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369089505"
     variation       1025
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371604414"
     variation       1037
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376368846"
     variation       1056
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201057426"
     variation       1061
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374337192"
     variation       1063
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377663823"
     variation       1082
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369698429"
     variation       1083
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736668"
     variation       1088
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202123909"
     variation       1090
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374667214"
     variation       1098
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200448007"
     variation       1099
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377156300"
     variation       1106
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370338926"
     variation       1107
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373746597"
     variation       1120
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375609567"
     variation       1136
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371071557"
     variation       1140
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77027689"
     variation       1154
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61734951"
     variation       1158
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372392201"
     variation       1162
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74692882"
     variation       1163
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116795025"
     variation       1169
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199564182"
     variation       1175
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2289532"
     variation       1182
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185083705"
     exon            1191..1348
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       1194
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199948075"
     variation       1195
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367861877"
     variation       1211
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375423897"
     variation       1218
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200701665"
     variation       1232
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201126001"
     variation       1245
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370081372"
     variation       1251
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141185078"
     variation       1253
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377484770"
     variation       1259
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370948871"
     variation       1265
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200512481"
     variation       1278
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199666629"
     variation       1279
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375199947"
     variation       1306
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145013523"
     variation       1311
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370720427"
     variation       1333
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375163840"
     variation       1334
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62000409"
     variation       1343
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371595543"
     variation       1346
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907091"
     exon            1349..1471
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       1357
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369063338"
     variation       1369
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61734950"
     variation       1376
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907093"
     variation       1403
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372976809"
     variation       1406
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183345922"
     variation       1410
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201576715"
     variation       1445
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187993089"
     exon            1472..1593
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       1476
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367601192"
     variation       1480
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116824266"
     variation       1487
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375800869"
     variation       1490
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185157579"
     variation       1497
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61739354"
     variation       1498
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200154414"
     variation       1499
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200902099"
     variation       1510
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201739201"
     variation       1511
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200858130"
     variation       1512
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200084360"
     variation       1540
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200124291"
     variation       1547
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375904127"
     variation       1561
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368929374"
     variation       1562
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59978698"
     variation       1576
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200526079"
     variation       1586
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377717807"
     exon            1594..1837
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       1605
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200272404"
     variation       1628
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370166011"
     variation       1634
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201164121"
     variation       1638
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375662034"
     variation       1675
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368624849"
     variation       1701
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200236937"
     variation       1704
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191736683"
     variation       1711
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201481334"
     variation       1745
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199786478"
     variation       1752
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202093340"
     variation       1753
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201559168"
     variation       1770
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200815406"
     exon            1838..2020
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       1855
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371383125"
     variation       1914
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376363442"
     variation       1920
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61749058"
     variation       1921
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35578653"
     variation       1928
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200551690"
     variation       1980
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201064110"
     variation       1982
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907092"
     exon            2021..2266
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2028
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370564898"
     variation       2036
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373744833"
     variation       2044
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375603538"
     variation       2048
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115850223"
     variation       2082
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200542971"
     variation       2092
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189617808"
     variation       2099
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201907038"
     variation       2116
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371963548"
     variation       2117
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374963474"
     variation       2128
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141983079"
     variation       2183
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368063104"
     variation       2190
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201407989"
     variation       2200
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200641382"
     variation       2223
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376612893"
     variation       2246
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367616783"
     variation       2257
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72849355"
     variation       2258
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201166295"
     variation       2260
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377219039"
     exon            2267..2480
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2282
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141343307"
     variation       2286
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117203086"
     variation       2321
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375753787"
     variation       2324
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199850214"
     variation       2330
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373560340"
     variation       2341
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376945782"
     variation       2342
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371360520"
     variation       2354
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60684213"
     variation       2363
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202075842"
     variation       2366
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192776296"
     variation       2367
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183809462"
     variation       2403
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375170974"
     variation       2408
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367812804"
     variation       2418
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139435501"
     variation       2449
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371612109"
     exon            2481..2650
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2491
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369702545"
     variation       2518
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372937081"
     variation       2519
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374928230"
     variation       2527
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369073881"
     variation       2528
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376911979"
     variation       2545
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372524775"
     variation       2570
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376872623"
     variation       2585
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371138852"
     variation       2607
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373825810"
     variation       2615
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201858385"
     variation       2626
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201254503"
     variation       2632
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200841842"
     variation       2635
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61749027"
     variation       2639
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61749025"
     variation       2640
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373717036"
     variation       2643
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367596393"
     variation       2647
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372369514"
     exon            2651..2742
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2683
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368398257"
     variation       2698
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369253136"
     variation       2701
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371516381"
     variation       2711
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375004715"
     variation       2713
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4889815"
     variation       2724
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373525552"
     exon            2743..2863
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2782
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138219539"
     variation       2815
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118143944"
     variation       2816
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59896146"
     variation       2823
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202141933"
     variation       2832
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143374313"
     variation       2843
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374752606"
     exon            2864..3547
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /inference="alignment:Splign:1.39.8"
     variation       2883..2946
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="aggacgcacacaggcacgtgcacgaacaacacgggacgcacgcaggca
                     cgtgcacgaagaacac"
                     /db_xref="dbSNP:375858249"
     variation       2883
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7210658"
     variation       2890
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7210664"
     variation       2892
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7210665"
     variation       2922
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7210679"
     variation       2941
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4889953"
     variation       2958
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371158080"
     variation       2990
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7207166"
     variation       3022
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374493149"
     variation       3040..3042
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="cac"
                     /db_xref="dbSNP:58374976"
     variation       3042
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="cac"
                     /db_xref="dbSNP:72074187"
     variation       3066..3067
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="aac"
                     /db_xref="dbSNP:201915956"
     variation       3071..3072
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="cac"
                     /db_xref="dbSNP:10693712"
     variation       3071
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74672482"
     variation       3072..3073
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="cac"
                     /db_xref="dbSNP:66504526"
     variation       3094
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60197132"
     variation       3099..3100
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:58064706"
     variation       3101..3102
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="ag"
                     /replace="cg"
                     /db_xref="dbSNP:60798305"
     variation       3101
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190696966"
     variation       3106
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62075573"
     variation       3108
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62075574"
     variation       3110
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62075575"
     variation       3113..3114
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:60807430"
     variation       3122
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56241848"
     variation       3128..3130
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="aca"
                     /db_xref="dbSNP:76140542"
     variation       3132
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55959150"
     variation       3135..3136
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:201721132"
     variation       3142..3143
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11398877"
     variation       3143..3144
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:66655177"
     variation       3144..3206
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="tgtgtgtgtcctgtgttgttcatgcacgtgcttgtgtgtgtcctgtgt
                     tgttcatgcacgtgc"
                     /db_xref="dbSNP:71163918"
     variation       3144..3145
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:59367553"
     variation       3153
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56041769"
     variation       3159..3161
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="aca"
                     /db_xref="dbSNP:58840151"
     variation       3174
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:59101374"
     variation       3225..3226
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:373213000"
     variation       3232
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181118178"
     variation       3235
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150752727"
     variation       3310
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73436194"
     variation       3329
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:9905685"
     polyA_signal    3512..3517
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
     polyA_site      3547
                     /gene="CCDC40"
                     /gene_synonym="CILD15"
ORIGIN      
ggatgttgacagcgtcgcctagcaacgggaaatggcggaaccgggcggcgcggcgggccggtcccatccggaagatggatcggcttctgagggagagaaggaagggaataatgaaagccacatggtgtcaccaccagagaaggatgatggccagaaaggtgaagaagctgtcggtagcacagagcatcctgaggaagtcacaacccaagcggaagctgcaattgaagagggggaggtggagacagaaggggaagcagcagtggaaggggaagaggaggctgtgtcctatggagatgctgaaagcgaagaggaatattactatacagaaacttcatccccggaagggcaaatcagtgctgcagatacgacttacccgtatttcagtcctcctcaggaactgcctggagaggaggcatacgatagtgttagcggggaggctggtctccaaggcttccagcaagaggccaccggtccaccagaatccagagaaaggagggtcacctccccagagccatcccacggagtcttaggcccgtcggagcaaatgggccaggtcacctctgggccagcagtgggcagattgacaggatccacagaggagccccaggggcaggtgctcccaatgggcgtccagcaccgcttccggctgagccacgggagcgacatcgagtcctcagacctggaggagttcgtctcgcaggagccagtgatccccccaggggtgcccgatgcccaccccagggaaggagacctgccagtgttccaggaccagatccagcagcccagcaccgaggagggggccatggcagagagagtggagtccgaggggagtgacgaggaagcagaagacgaagggtcccagctggtggttttggacccagaccaccccctgatggtaagattccaggctgccctgaagaactacctgaaccgacagatcgaaaagttgaagctggacctccaagagctggttgtggctaccaagcagagccgagcccagcggcaggagctgggggtgaatctctatgaggtgcagcagcacctggtacacctgcagaagctgctggagaagagtcacgaccgccacgcaatggcctcgagcgagcgcaggcagaaggaggaggagctgcaggccgcccgcgctctctacaccaagacctgcgcagccgccaacgaggagcgcaaaaagttggcggctctgcagactgagatggagaacttggccctgcatctcttctacatgcagaacatcgaccaggacatgcgtgacgacatccgcgtgatgacacaagtggtaaagaaggccgagacggagaggatccgggcagaaatcgagaagaaaaagcaggacctgtatgtggaccagctcaccactcgagcccagcaactggaagaagacattgccctgtttgaggctcagtacttggcccaagctgaggacacccggattttaaggaaagcagtgagtgaggcctgcaccgagatcgacgccatcagcgtggagaagaggcgcatcatgcagcaatgggccagcagcctggtgggcatgaagcaccgcgacgaggcgcacagggcggtgctggaggcgctcagaggatgccagcatcaagccaaatccaccgacggcgagattgaggcctataagaaatccatcatgaaggaggaagaaaagaacgagaagctggcgagcatcctgaaccggacagagacggaagccacactgctgcagaagctcaccacccagtgcctgaccaagcaggtggccctgcagagccagttcaatacctacaggctcaccctgcaggacacagaggatgccctcagccaggaccagctggaacaaatgatactcacggaggagttgcaggccatccgccaagccatccagggcgagctggagctcaggaggaagacggatgctgccatccgggagaagctgcaggagcacatgacctccaacaagaccaccaaatacttcaaccagctcatcctgaggctgcagaaggagaagaccaacatgatgacacatctttccaaaatcaacggtgacattgcccagaccaccctggacatcacacacaccagcagcaggctggacgcacaccagaagaccctggtggagctggaccaggacgtgaagaaagtcaacgagctcatcaccaacagccagagcgagatctcccggcgcacgatcctgatcgagaggaagcaagggctcatcaacttcctcaacaagcagctggagcggatggtctccgagctggggggggaagaagtggggcccctggagcttgaaatcaaaaggctgagcaagctgatcgacgagcacgatggcaaggcggtccaggcccaggtgacctggctgcgcctgcagcaggagatggtcaaggtgacacaggagcaggaggagcagctggcctccctggacgcatccaagaaggagctccacatcatggagcagaagaaactacgagtagaaagcaagattgagcaggagaagaaggagcagaaggagatcgagcaccacatgaaggacctggacaacgacctgaagaagctcaacatgttgatgaataaaaaccggtgcagctcggaggagctggagcagaacaaccgggtgacagagaatgagttcgtgcgctcgctgaaggcctctgagagggagaccatcaagatgcaggacaagctgaaccagctcagcgaggagaaggcgaccctcctgaatcaactggtggaagcagaacaccagattatgctttgggagaaaaaaatccaactggcaaaagagatgcgttcctcagtggattccgagatcggccagacggagatccgggccatgaagggcgagatccacaggatgaagaaatattgcagaacaacacaggacgcacacaggcacgtgcacgaacaacacgggacgcacgcaggcacgtgcacgaagaacacgggacgcgcgcaggcacgtgcacgaacaacacgggacgcgcgcgggcacgtgcacgaacaacacgggacgcgcgcaggcacgtgcacgaacaacacgggacgcgcgcaggcacgtgcacgaacaagggacgcgcgcaggcacgtgcacgaacacaggacacacacagcacgtgcatgaacaacacaggacacacacagcacgtgcatgaacaacacaggacacacacaagcacgtgcatgaacaacacaggacacacacaagcacgtgcatgtcatctcacaaaacgctgttttattcctactccatgtaatcacagcacgctggtatttttaaatgccggttgtaaccctcaaactttgtgaccctctaacgtatcccactgtgagacagtctcacaccacagaagggctcagagagcacccccatctcatccttcacagccgcgttgtctctccatggtcacaattagatttcattgcctttaaaaggctggtaattaaattgcaagtggtcatcaagctaaaggttcagggccttaaggataacagtaagagcagttcataaaataaatgggcctcactttcaccatgccatgctaaaaaaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:55036 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:55036 -> Biological process: GO:0001947 [heart looping] evidence: IMP
            GeneID:55036 -> Biological process: GO:0003351 [epithelial cilium movement] evidence: IMP
            GeneID:55036 -> Biological process: GO:0003356 [regulation of cilium beat frequency] evidence: IMP
            GeneID:55036 -> Biological process: GO:0030324 [lung development] evidence: IMP
            GeneID:55036 -> Biological process: GO:0035469 [determination of pancreatic left/right asymmetry] evidence: IMP
            GeneID:55036 -> Biological process: GO:0060287 [epithelial cilium movement involved in determination of left/right asymmetry] evidence: IMP
            GeneID:55036 -> Biological process: GO:0070286 [axonemal dynein complex assembly] evidence: IMP
            GeneID:55036 -> Biological process: GO:0071907 [determination of digestive tract left/right asymmetry] evidence: IMP
            GeneID:55036 -> Biological process: GO:0071910 [determination of liver left/right asymmetry] evidence: IMP
            GeneID:55036 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
            GeneID:55036 -> Cellular component: GO:0005929 [cilium] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.