GGRNA Home | Help | Advanced search

2024-04-20 06:45:53, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001243007            3878 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens prospero homeobox 2 (PROX2), transcript variant 1,
            mRNA.
ACCESSION   NM_001243007
VERSION     NM_001243007.1  GI:339895888
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3878)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   2  (bases 1 to 3878)
  AUTHORS   Cornelis,M.C., Monda,K.L., Yu,K., Paynter,N., Azzato,E.M.,
            Bennett,S.N., Berndt,S.I., Boerwinkle,E., Chanock,S.,
            Chatterjee,N., Couper,D., Curhan,G., Heiss,G., Hu,F.B.,
            Hunter,D.J., Jacobs,K., Jensen,M.K., Kraft,P., Landi,M.T.,
            Nettleton,J.A., Purdue,M.P., Rajaraman,P., Rimm,E.B., Rose,L.M.,
            Rothman,N., Silverman,D., Stolzenberg-Solomon,R., Subar,A.,
            Yeager,M., Chasman,D.I., van Dam,R.M. and Caporaso,N.E.
  TITLE     Genome-wide meta-analysis identifies regions on 7p21 (AHR) and
            15q24 (CYP1A2) as determinants of habitual caffeine consumption
  JOURNAL   PLoS Genet. 7 (4), E1002033 (2011)
   PUBMED   21490707
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006530.4, BC105927.1 and AK094068.1.
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC105720.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1                 AC006530.4         14236-14236         c
            2-2763              BC105927.1         1-2762
            2764-3878           AK094068.1         1744-2858
FEATURES             Location/Qualifiers
     source          1..3878
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q24.3"
     gene            1..3878
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /note="prospero homeobox 2"
                     /db_xref="GeneID:283571"
                     /db_xref="HGNC:26715"
                     /db_xref="MIM:615094"
     CDS             1..1779
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /note="isoform 1 is encoded by transcript variant 1;
                     homeobox prospero-like protein PROX2"
                     /codon_start=1
                     /product="prospero homeobox protein 2 isoform 1"
                     /protein_id="NP_001229936.1"
                     /db_xref="GI:339895889"
                     /db_xref="GeneID:283571"
                     /db_xref="HGNC:26715"
                     /db_xref="MIM:615094"
                     /translation="
MDPNSILLSPQPQICSHLAEACTEGERSSSPPELDRDSPFPWSQVPSSSPTDPEWFGDEHIQAKRARVETIVRGMCLSPNPLVPGNAQAGVSPRCPKKARERKRKQNLPTPQGLLMPAPAWDQGNRKGGPRVREQLHLLKQQLRHLQEHILQAAKPRDTAQGPGGCGTGKGPLSAKQGNGCGPRPWVVDGDHQQGTSKDLSGAEKHQESEKPSFLPSGAPASLEILRKELTRAVSQAVDSVLQKVLLDPPGHLTQLGRSFQGQVAEGRSEPSPPVGGACKDPLALAALPRRVQLQAGVPVGNLSLAKRLDSPRYPIPPRMTPKPCQDPPANFPLTAPSHIQENQILSQLLGHRYNNGHWSSSPPQDSSSQRHPSSEPALRPWRTTKPQPLVLSQQQCPLPFTSAHLESLPLLPSVKMEQRGLHAVMEALPFSLVHIQEGLNPGHLKKAKLMFFFTRYPSSNLLKVYFPDVQFNRCITSQMIKWFSNFREFYYIQMEKSARQAISDGVTNPKMLVVLRNSELFQALNMHYNKGNDFEVPDCFLEIASLTLQEFFRAVSAGRDSDPSWKKPIYKIISKLDSDIPEIFKSSSYPQ
"
     misc_feature    7..>336
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /note="Homeobox prospero-like protein (PROX1); Region:
                     Prox1; pfam05044"
                     /db_xref="CDD:203159"
     misc_feature    <1276..1761
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /note="Homeobox prospero-like protein (PROX1); Region:
                     Prox1; pfam05044"
                     /db_xref="CDD:203159"
     misc_feature    1486..1776
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3B8N5.3);
                     Region: Prospero-like"
     exon            1..1305
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(24)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199595015"
     variation       complement(40)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376608651"
     variation       complement(41)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372079820"
     variation       complement(42)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371967421"
     variation       complement(55)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146941408"
     variation       complement(68)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368123183"
     variation       complement(69)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375166231"
     variation       complement(76)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201978225"
     variation       complement(103)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180960227"
     variation       complement(105)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374677617"
     variation       complement(116)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371637936"
     variation       complement(155)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200595982"
     variation       complement(175)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376935828"
     variation       complement(198)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373721677"
     variation       complement(212)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370728105"
     variation       complement(218)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201405244"
     variation       complement(224)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199570102"
     variation       complement(232)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117853159"
     variation       complement(236)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200363606"
     variation       complement(276)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374756212"
     variation       complement(279)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189269863"
     variation       complement(282)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184323713"
     variation       complement(333)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61747287"
     variation       complement(380)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115990005"
     variation       complement(381)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61740783"
     variation       complement(391)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372540137"
     variation       complement(434)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368426600"
     variation       complement(448)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377003419"
     variation       complement(504)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372063691"
     variation       complement(551)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201963977"
     variation       complement(563)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367974406"
     variation       complement(565)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79080832"
     variation       complement(567)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374997285"
     variation       complement(594)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200480191"
     variation       complement(632)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368908499"
     variation       complement(647)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192730740"
     variation       complement(669)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201004945"
     variation       complement(682)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201578215"
     variation       complement(686)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376245999"
     variation       complement(707)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372997844"
     variation       complement(720)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61742639"
     variation       complement(807)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375952710"
     variation       complement(808)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199984429"
     variation       complement(850)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373167886"
     variation       complement(901)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368931360"
     variation       complement(923)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370937410"
     variation       complement(953)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114515836"
     variation       complement(986..987)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35111519"
     variation       complement(986)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373470636"
     variation       complement(1067)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369758704"
     variation       complement(1114)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117959226"
     variation       complement(1138)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377153727"
     variation       complement(1143)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372354861"
     variation       complement(1158)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369331892"
     variation       complement(1159)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375198111"
     variation       complement(1160)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371997631"
     variation       complement(1165)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367763340"
     variation       complement(1167)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374137077"
     variation       complement(1168)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372314878"
     variation       complement(1171)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368629680"
     variation       complement(1177)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147805312"
     variation       complement(1187)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374409332"
     variation       complement(1218)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188084626"
     variation       complement(1220)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78451431"
     variation       complement(1229)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200984540"
     variation       complement(1241)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374045919"
     variation       complement(1259)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370632269"
     variation       complement(1271)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376204721"
     variation       complement(1279)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373060395"
     exon            1306..1413
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1350)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369323403"
     variation       complement(1366)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201032196"
     variation       complement(1383)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371301590"
     variation       complement(1385)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368765044"
     exon            1414..1608
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1414)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200953943"
     variation       complement(1420)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368408282"
     variation       complement(1437)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375032981"
     variation       complement(1463)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201972276"
     variation       complement(1475)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370636794"
     variation       complement(1478)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377158531"
     variation       complement(1483)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182446913"
     variation       complement(1494)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370216245"
     variation       complement(1498)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377349470"
     variation       complement(1514)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374516263"
     variation       complement(1515)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371134396"
     exon            1609..3878
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1625)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376745303"
     variation       complement(1672)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368768225"
     variation       complement(1734)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143490627"
     variation       complement(1771)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200874751"
     variation       complement(1802)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200145421"
     variation       complement(1812)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141359648"
     variation       complement(1900)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61978928"
     variation       complement(1906)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146599159"
     variation       complement(2001)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188512911"
     variation       complement(2012)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34893831"
     variation       complement(2051)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114899270"
     variation       complement(2206)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17102763"
     variation       complement(2317..2319)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:368532127"
     variation       complement(2352)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12882109"
     variation       complement(2385)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370329203"
     variation       complement(2403)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145897808"
     variation       complement(2449)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140695864"
     variation       complement(2450)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377010267"
     variation       complement(2567)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145861708"
     variation       complement(2694)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56216877"
     variation       complement(2708)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370161030"
     variation       complement(2714)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139680482"
     variation       complement(2825)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375456732"
     variation       complement(2840..2842)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:201880589"
     variation       complement(2867)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184546582"
     variation       complement(3155)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:66591704"
     variation       complement(3173)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:10220695"
     variation       complement(3260)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374943417"
     variation       complement(3308)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193144203"
     variation       complement(3319)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190537693"
     variation       complement(3331)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185614009"
     variation       complement(3428)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192425701"
     variation       complement(3497)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151072003"
     variation       complement(3571)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:714788"
     variation       complement(3647)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:111575499"
     variation       complement(3704)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116935234"
     variation       complement(3791)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186721912"
     variation       complement(3792)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182077825"
     variation       complement(3800)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76861947"
     variation       complement(3868)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191699750"
     variation       complement(3871)
                     /gene="PROX2"
                     /gene_synonym="PROX-2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145414176"
ORIGIN      
atggatccaaactccatcttgctttctcctcagccccagatctgctcccacctagcagaagcttgtacggaaggcgagagaagctcatcccctccagagctggatagagactccccgtttccctggagtcaggtccccagctccagccctacagaccccgaatggtttggtgatgagcacatccaggcaaagagggccagagtggagaccattgtccgaggcatgtgtctctccccgaatcctctggtgccaggcaatgcgcaagctggggtcagcccacgctgcccaaagaaggcccgagagaggaagaggaagcagaaccttcccacaccgcaaggcctcctgatgccagcccctgcctgggaccagggcaacaggaaggggggccctcgtgtgagagaacaacttcatctgctgaagcaacagctaagacatctgcaagagcacatcctacaggctgccaagcccagggacacagctcaggggccaggaggctgtggcacggggaaaggccctctgagtgcaaagcaggggaatggctgtgggcctcgcccctgggttgtggacggtgaccaccagcaaggtaccagcaaggacctctctggggcagaaaaacaccaagagtctgagaagcccagtttccttccttctggagcaccagcttcactagagattctgaggaaagagctgaccagggcagtgtcccaggctgtggactcggtattacaaaaggtactattggatccaccaggccacctgactcagctgggcagaagcttccaggggcaggtggcagagggtagaagcgagccctcacctcctgtgggaggggcctgtaaagatccacttgctttggctgccttgcccaggagggtccagctacaagctggggtcccagtaggaaatttatcactggccaagcgtctagattctcctaggtaccctatccctccaagaatgacccccaaaccctgtcaggatcccccagcaaactttcccttgactgcaccttcccacatccaggaaaatcagattcttagccagctactgggtcatagatacaacaatggccattggagtagcagtcctccccaggactcatcttcccagaggcacccctcctcagagcctgccctacgaccttggagaactactaagccgcaaccattggtcctgagccagcagcagtgtcccttgcctttcacctctgcccatctggaaagtctaccccttcttccctcggtgaagatggaacagagaggcctgcatgctgtcatggaggcactgcctttctctttggtccacatccaggagggtctaaaccctggtcacttgaagaaggccaaactaatgtttttcttcacacgatatcccagctccaacctcctgaaggtttattttcctgatgttcagttcaaccgctgcattacctcccagatgatcaagtggttcagcaactttcgtgagttttattacatccaaatggaaaaatctgcccggcaagcaatttcagatggtgtcacaaatcccaaaatgctggtggttctccgcaattcagaactttttcaagctctcaatatgcactacaacaagggaaatgactttgaggttccagattgcttcttggaaattgccagcttgacgttacaggagttcttcagggctgtctccgcagggagagactcagatccttcctggaagaaacccatttataaaattatttcgaaactggacagtgacatcccagagatattcaaatcttccagctatccccagtagctgtttcggggttaagatcccacaacgtgaggagtgactggctagggtttcctgggtttgtcttaaagggcaatttagctgtagtcatataaaaagggcacaaggaaatctcctctatcaaaacaggtactattaccattttgatcatttatttccctttccagaatcatcagaaatttaactataaaatgtactaactatattggtgtattggtagtatattgtaaaaggaacacaagtttccaatcagaagacttgaagctcaactccattgtttccaggtgttgtgaccctgggaacttcctggtatctctgtatctgtaaaatgaggttgttaaggattaaaggacagtatgtcctatgcaatgtcattcacacacaaatgtcagttttttgagcccctctttcagataaggttatcttatttggggtttttacaaattgctgtttttagtcacctaattataaagcgccatctatttgctagatactttcacatactttaagcttttcaccctgaaaagtagttattatcatcatttaaaagatgaccaaacagaagctttagaactgcaaggtaactcgccaaagcctatgaggctaggacatctgggttgatagggacagtcaggagcctggaggaaccaagactttctgatgcccaactgcatgctggacccatctcctgcagctaactcaggatctcaagcaggaccccacccctagtaagcatccagcgctgacagggcaccgtcacctgacaactcctgcccagcacttaggagcacttcaccgcccaagatttctgctgatcatttcagcaaactcaagacaaactttatgcaggacttgagtgttgctgtttattcacatttgtctgctggaagagtttatcagctggataatgcaaatagtctccagctgaccattgcaattggtgccccaacctcatatatgcagaagaagctgaacttcagactgtgaaaggtagaaagggccttaggagatcatctggcccatgctgcttaaattgggaaggaagaaccgcagtccagacaggaggcttgcacaggctgtgcacagccttgcagatgataaatggcataactgggacaaatgcagcatcacacagaaatggaaattctcccactccataacaaaattacagtccatggctgaccttccactgatgaaggaattcatgaaatcaacatttccccctgctgctggcccagcacaattgtgacccactcttgagtatataggcaaggcatgtacaaagctgagtaactgcatctgtcttctaagctagtcaggatcaagtctttgtaagcactgccaaaggtacgccgggtggggtggggtgggggtaatacacagctcgggctttgtagtcctgataaggggtgtctgtgagttcattagcttctttcctgtctatataaaacaagtttcatattcggctactcaacttccataatttttctggtggggtgttgctggagcagatgagataaaatccctaaactattactagaactatcagcataaaaagtatgaaagatgaattttcctttgaattttctcttcaaacagctgaaaggaaaaacaaaacagacttagcccaaacccatctttacaggctaaaggttaagtgccctccagtacatccaattgcactcagaagatctttgccctattttcacaaaaatgaaggaatctgccaaacctaagttttaaacacaggcaagcatggagtgctctgagcaagggcaatcagttttctgtgtccggacatagtagaagaaccctctatccagagtgacattacatacctaagttagacatacaggggaaacaagttcacatgactgtccaatagagagcagcccttcttctgtcccaaacctgaaattcattagtgtgtgtttaaagactgagccaagtcacctccagggcagtgaaccttgtctcagggaccaatgagatgaaatgtacaagctcaaattgaaaacatttgtgtactgcagtctttccaggaagtgttctctaaccactgagctaaacacagaagaatgtataaatatgtatgctctgcc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:283571 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:283571 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:283571 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
            GeneID:283571 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:283571 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.