2024-04-26 05:08:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001242644 3740 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 2, mRNA. ACCESSION NM_001242644 XR_108913 VERSION NM_001242644.1 GI:336391092 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3740) AUTHORS de Barsy,M., Jamet,A., Filopon,D., Nicolas,C., Laloux,G., Rual,J.F., Muller,A., Twizere,J.C., Nkengfac,B., Vandenhaute,J., Hill,D.E., Salcedo,S.P., Gorvel,J.P., Letesson,J.J. and De Bolle,X. TITLE Identification of a Brucella spp. secreted effector specifically interacting with human small GTPase Rab2 JOURNAL Cell. Microbiol. 13 (7), 1044-1058 (2011) PUBMED 21501366 REMARK GeneRIF: The authors identified a specific interaction between the human small GTPase Rab2 and a Brucella spp. protein named RicA. REFERENCE 2 (bases 1 to 3740) AUTHORS Buffa,L., Fuchs,E., Pietropaolo,M., Barr,F. and Solimena,M. TITLE ICA69 is a novel Rab2 effector regulating ER-Golgi trafficking in insulinoma cells JOURNAL Eur. J. Cell Biol. 87 (4), 197-209 (2008) PUBMED 18187231 REMARK GeneRIF: ICA69 as a novel Rab2 effector and its role in regulating the early transport of insulin secretory granule proteins REFERENCE 3 (bases 1 to 3740) AUTHORS Dong,C. and Wu,G. TITLE Regulation of anterograde transport of adrenergic and angiotensin II receptors by Rab2 and Rab6 GTPases JOURNAL Cell. Signal. 19 (11), 2388-2399 (2007) PUBMED 17716866 REMARK GeneRIF: These data demonstrate that Rab2 and Rab6 differentially influence anterograde transport and signaling of GPCRs. REFERENCE 4 (bases 1 to 3740) AUTHORS Chi,A., Valencia,J.C., Hu,Z.Z., Watabe,H., Yamaguchi,H., Mangini,N.J., Huang,H., Canfield,V.A., Cheng,K.C., Yang,F., Abe,R., Yamagishi,S., Shabanowitz,J., Hearing,V.J., Wu,C., Appella,E. and Hunt,D.F. TITLE Proteomic and bioinformatic characterization of the biogenesis and function of melanosomes JOURNAL J. Proteome Res. 5 (11), 3135-3144 (2006) PUBMED 17081065 REFERENCE 5 (bases 1 to 3740) AUTHORS Eathiraj,S., Pan,X., Ritacco,C. and Lambright,D.G. TITLE Structural basis of family-wide Rab GTPase recognition by rabenosyn-5 JOURNAL Nature 436 (7049), 415-419 (2005) PUBMED 16034420 REFERENCE 6 (bases 1 to 3740) AUTHORS de Leeuw,H.P., Koster,P.M., Calafat,J., Janssen,H., van Zonneveld,A.J., van Mourik,J.A. and Voorberg,J. TITLE Small GTP-binding proteins in human endothelial cells JOURNAL Br. J. Haematol. 103 (1), 15-19 (1998) PUBMED 9792283 REFERENCE 7 (bases 1 to 3740) AUTHORS Tisdale,E.J. and Balch,W.E. TITLE Rab2 is essential for the maturation of pre-Golgi intermediates JOURNAL J. Biol. Chem. 271 (46), 29372-29379 (1996) PUBMED 8910601 REFERENCE 8 (bases 1 to 3740) AUTHORS Khosravi-Far,R., Lutz,R.J., Cox,A.D., Conroy,L., Bourne,J.R., Sinensky,M., Balch,W.E., Buss,J.E. and Der,C.J. TITLE Isoprenoid modification of rab proteins terminating in CC or CXC motifs JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (14), 6264-6268 (1991) PUBMED 1648736 REFERENCE 9 (bases 1 to 3740) AUTHORS Zahraoui,A., Touchot,N., Chardin,P. and Tavitian,A. TITLE The human Rab genes encode a family of GTP-binding proteins related to yeast YPT1 and SEC4 products involved in secretion JOURNAL J. Biol. Chem. 264 (21), 12394-12401 (1989) PUBMED 2501306 REFERENCE 10 (bases 1 to 3740) AUTHORS Tachibana,K., Umezawa,A., Kato,S. and Takano,T. TITLE Nucleotide sequence of a new YPT1-related human cDNA which belongs to the ras gene superfamily JOURNAL Nucleic Acids Res. 16 (21), 10368 (1988) PUBMED 3057444 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA648682.1, AK297576.1, AC068389.10 and AW301641.1. On Jun 19, 2011 this sequence version replaced gi:310120219. Summary: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region compared to variant 1. This results in a shorter isoform (b) missing an internal protein segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK297576.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025098 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-322 DA648682.1 3-324 323-1084 AK297576.1 297-1058 1085-2055 AC068389.10 53096-54066 c 2056-3281 AC068389.10 51870-53095 c 3282-3740 AW301641.1 1-459 c FEATURES Location/Qualifiers source 1..3740 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q12.1" gene 1..3740 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="RAB2A, member RAS oncogene family" /db_xref="GeneID:5862" /db_xref="HGNC:9763" /db_xref="MIM:179509" exon 1..344 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 8 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:13248794" variation 35 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:188897877" variation 71 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:377019145" variation 180 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:11544472" variation 238 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:79202491" variation 269 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370633697" misc_feature 284..286 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="upstream in-frame stop codon" CDS 299..865 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="isoform b is encoded by transcript variant 2; RAB2, member RAS oncogene family; ras-related protein Rab-2A; small GTP binding protein RAB2A" /codon_start=1 /product="ras-related protein Rab-2A isoform b" /protein_id="NP_001229573.1" /db_xref="GI:336391093" /db_xref="CCDS:CCDS56537.1" /db_xref="GeneID:5862" /db_xref="HGNC:9763" /db_xref="MIM:179509" /translation="
MAYAYLFKYIIIGDTGVEFGARMITIDGKQIKLQIWDTAGQESFRSITRSYYRGAAGALLVYDITRRDTFNHLTTWLEDARQHSNSNMVIMLIGNKSDLESRREVKKEEGEAFAREHGLIFMETSAKTASNVEEAFINTAKEIYEKIQEGVFDINNEANGIKIGPQHAATNATHAGNQGGQQAGGGCC
" misc_feature 305..736 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170" /db_xref="CDD:247724" misc_feature order(341..343,416..418,581..586,590..592,671..679) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="GTP/Mg2+ binding site [chemical binding]; other site" /db_xref="CDD:206648" misc_feature 350..358 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Switch I region; other site" /db_xref="CDD:206648" misc_feature 407..418 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G3 box; other site" /db_xref="CDD:206648" misc_feature order(413..418,464..469) /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="Switch II region; other site" /db_xref="CDD:206648" misc_feature 581..592 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G4 box; other site" /db_xref="CDD:206648" misc_feature 671..679 /gene="RAB2A" /gene_synonym="LHX; RAB2" /note="G5 box; other site" /db_xref="CDD:206648" variation 307 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:373226742" exon 345..412 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 355 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:368402545" exon 413..495 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 450 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:11544470" exon 496..588 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 502 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:375530419" exon 589..700 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" variation 613 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:141013917" variation 655 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370866047" variation 656 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:199581780" exon 701..769 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" exon 770..3740 /gene="RAB2A" /gene_synonym="LHX; RAB2" /inference="alignment:Splign:1.39.8" STS 773..907 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="STS-R00195" /db_xref="UniSTS:16383" STS 778..908 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RH70011" /db_xref="UniSTS:5095" variation 853 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:370628676" variation 854 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374486741" STS 856..1353 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RAB2_2543" /db_xref="UniSTS:280950" STS 874..1149 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1929" /db_xref="UniSTS:76818" variation 892 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:367660654" variation 893 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:201836844" variation 910 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:368529941" polyA_signal 1012..1017 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_site 1037 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 1128 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:183524386" variation 1209 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="c" /db_xref="dbSNP:187759374" variation 1231 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:76823768" variation 1258..1259 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="" /replace="tt" /db_xref="dbSNP:200305948" variation 1293 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:41272433" variation 1396 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:370058692" variation 1497 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:113877343" variation 1534 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374973250" variation 1636 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:79502934" variation 1759 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:77133934" STS 1825..1976 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1899" /db_xref="UniSTS:22645" STS 1825..1948 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="RH92689" /db_xref="UniSTS:92717" variation 1904..1905 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="" /replace="a" /db_xref="dbSNP:35329667" STS 1918..2023 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1405E" /db_xref="UniSTS:151199" variation 1938 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:140580809" polyA_signal 1947..1952 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 1965 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:7413" polyA_site 1976 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_signal 2075..2080 /gene="RAB2A" /gene_synonym="LHX; RAB2" polyA_site 2095 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 2204 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:369628178" variation 2246 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:373337569" variation 2339 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:12544487" variation 2381 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:78628010" variation 2432 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:629268" variation 2508 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:150407587" variation 2541 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:79970848" variation 2662 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:649634" variation 2731 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:138129268" variation 2758 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:192628540" variation 2816 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:75837686" variation 2904 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:2930041" STS 2930..3180 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1613" /db_xref="UniSTS:79309" variation 2950 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:149557425" variation 2954 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:9437" variation 2998 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="c" /db_xref="dbSNP:118165570" variation 3002 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:75974140" STS 3006..3190 /gene="RAB2A" /gene_synonym="LHX; RAB2" /standard_name="D8S1394E" /db_xref="UniSTS:45049" variation 3118 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:186973869" polyA_signal 3163..3168 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3182 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:145073984" polyA_site 3192 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3240 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:76705987" variation 3246 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="g" /db_xref="dbSNP:652422" variation 3260 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:138862634" variation 3284 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:374444619" variation 3331 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:142611281" variation 3338 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:113076295" variation 3344 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="t" /db_xref="dbSNP:191757602" variation 3358 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:113490250" variation 3427 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="g" /replace="t" /db_xref="dbSNP:184729393" variation 3601 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="c" /replace="t" /db_xref="dbSNP:116372466" variation 3635 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:189591638" variation 3644 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:181704218" polyA_signal 3702..3707 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3715 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:185297839" polyA_site 3733 /gene="RAB2A" /gene_synonym="LHX; RAB2" variation 3740 /gene="RAB2A" /gene_synonym="LHX; RAB2" /replace="a" /replace="g" /db_xref="dbSNP:664796" ORIGIN
tttcctccggcggcgccggcggccgcagaacttccgggtcggcgcggaggcggggcggaggcgccgcggcggctgttattgttcggctgggctcggtcgggcgctgtctccctcggctctgcgggtgtcagttcgtccggcttcctcacagcccctcactcccggcggctgacagcagcagcggcggcggcgggcggcgcctggcgtttcgaggctgagcggcaccggggttggggcgcggaggaggagcagcagcgggaggaggagccgtgtgccctggcactgagcggccgcggccatggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagatatgggatacggcagggcaagaatcctttcgttccatcacaaggtcgtattacagaggtgcagcaggagctttactagtttacgatattacacggagagatacattcaaccacttgacaacctggttagaagatgcccgccagcattccaattccaacatggtcattatgcttattggaaataaaagtgatttagaatctagaagagaagtaaaaaaagaagaaggtgaagcttttgcacgagaacatggactcatcttcatggaaacgtctgctaagactgcttccaatgtagaagaggcatttattaatacagcaaaagaaatttatgaaaaaattcaagaaggagtctttgacattaataatgaggcaaatggcattaaaattggccctcagcatgctgctaccaatgcaacacatgcaggcaatcagggaggacagcaggctgggggcggctgctgttgagtctgtttttactgtctagctgcccaacggggcctactcacttattctttcaccccctctcctcctgctcagctgagacatgaaactatttgaaatggctttatgtcacagaagactttaatccgtcaaattcttgtataactttgaataaatggttaatgttcacttaaaagacagattttggagattgtattcatatctatttgcatttgatttctaggtcaattgatgtgattatttttgttaaatgttgtcttgtgcccttaactacgaactgaattgtattaaacactacaaagtcatcttgagtattttaaatcggtttgtgtagttaggtttcccaacatctgtggttacctaatgtttaatattatagaactgtcctcagaaactttgtcaattttcacggctataaggaaacagaaggactcttttaattctgtatttatcatttactttctgtatatatagtttaataacctgcttgggtgtaatttgccaagcttgaattctttaatgcatttgcataaattctatactgtttagagcttaaagctacagaagcattgttaggaattgcttggacactgaattttaaactttttgacattgttaacaagcatgttcatcttttcttgtcactagtccaagaaaaatatgcttaatgtatattacaaaggctttgtatatgttaacctgttttaatgccaaaagtttgctttgtccacaatttccttaagacctcttcagaaagggatttgtttgccttaatgaatactgttgggaaaaaacacagtataatgagtgaaaagggcagaagcaagaaatttctacatcttagcgactccaagaagaatgagtatccacatttagatggcacattatgaggactttaatctttccttaaacacaataatgttttcttttttcttttattcacatgatttctaagtatatttttcatgcaggacagtttttcaaccttgatgtacagtgactgtgtaaaatttttctttcagtggcaacctctataatctttaaaatatggtgagcatcttgtctgttttgaaggggatatgacaataaatctatcagatggaaaatcctgttacaaagtagaaaagctttagtaatttactcagtgtggtggttttatcctttttttctttttctcccttggtctataatgaaattgttacagcagtgcaaaataaaatcctatgtataaaagtgttctttttttttattatgaccacctcttttttaatgtatttttagtccacttacagcttttacatgggtttaagcatgttttttaaaagggtcagaatggttaacactcaaccctttttaaaaattttgctaaaatgcgacaaatctcaccatactgaaattatttttgttgatggtgtaagcagtgtaagcaagtgttttctcctgaactagcacaaaagcacttatgcctgaaagaaagcataaagaagttctaactctgaaactaactactttcatttcgctcatggccttcaactttctacaggtcttccctgaagattcagcagtactctctcaaaggtttgacagtactcttgtgggaaatcaccaaatgctgtcatagttttgttttaactgtctccttgagggcagagggaagggtgagagaaaatctgttttcatgggtatttgtagtacagcctttttttctttcaagtggctgtatcaaattcactggtcttactaatcactgtctttaccagtgagtacaaaaagttaaggcaactaggacaggtactgctctataccaagaagagaatgattctttggaaattgttatttttaagcttctgttaatttttccagaagtttagtgcgtttcttttccatactttctcccctaattcttttatttgaagaagagaacttaatggcaaataaacaacaaaccaggacatgcattttaataccctaaggaaaaatggaaccctcaaatataactcctcccacaaccaccctaatgtgcctcagtctggggcagcaggtggacttctcaatagttcttttccacattctctacaaatcacatctaccgttaaggaatatgttatgaatcctttctgttaattgagaaagcaatgttattgtctgtgatttccagtctttgctcattttattatccctgtcaaataatgtaatattggtacctgcagttgaatttgtaatattgtaattgaatttttagttgatcttcgatcagtttttatagcatctatggacatagaaaatcagtcactgaaaaaaataaacacagctttcaatgtctcactcaacatgtaacattcaaaattgtgatcttcataaagacattgttaccattcgtcttgcaaatttaagacaactgaatgaaaagccaattttttgaaagaatgtggcatataattagatatacaactgaaacaggatatacaactgcatacaatttgtttttaatgatattttaaaatagcctgttagcaggaaaatagtccctatttatctgctaatggtcaaaaagagttaggatataaatcgtaccaaaatgtttccaatcactcagaaaaactgattcatgtctggctttgcaacaccttaaacatttattctgtcatagatagtaaagccccatctcagtttatttagtcctgaggttggcagcatggggtttgactatatgagctaaaagatacacaaagagataacgctgtttcataataaacaggaattgactatacaaataggtaaaccagcatatctacctgtatttctcagagtttagatgtgtgctttatgtttacattaaaataaagcctaacgccacagtagatcatctcatactgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5862 -> Molecular function: GO:0003924 [GTPase activity] evidence: IDA GeneID:5862 -> Molecular function: GO:0005525 [GTP binding] evidence: IDA GeneID:5862 -> Molecular function: GO:0019003 [GDP binding] evidence: IDA GeneID:5862 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: IDA GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: TAS GeneID:5862 -> Biological process: GO:0006888 [ER to Golgi vesicle-mediated transport] evidence: TAS GeneID:5862 -> Biological process: GO:0007264 [small GTPase mediated signal transduction] evidence: IEA GeneID:5862 -> Biological process: GO:0015031 [protein transport] evidence: IEA GeneID:5862 -> Cellular component: GO:0000139 [Golgi membrane] evidence: TAS GeneID:5862 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA GeneID:5862 -> Cellular component: GO:0033116 [endoplasmic reticulum-Golgi intermediate compartment membrane] evidence: IEA GeneID:5862 -> Cellular component: GO:0042470 [melanosome] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.