Home |
Help |
Advanced search
2024-04-26 08:27:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001242644 3740 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript
variant 2, mRNA.
ACCESSION NM_001242644 XR_108913
VERSION NM_001242644.1 GI:336391092
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3740)
AUTHORS de Barsy,M., Jamet,A., Filopon,D., Nicolas,C., Laloux,G.,
Rual,J.F., Muller,A., Twizere,J.C., Nkengfac,B., Vandenhaute,J.,
Hill,D.E., Salcedo,S.P., Gorvel,J.P., Letesson,J.J. and De Bolle,X.
TITLE Identification of a Brucella spp. secreted effector specifically
interacting with human small GTPase Rab2
JOURNAL Cell. Microbiol. 13 (7), 1044-1058 (2011)
PUBMED 21501366
REMARK GeneRIF: The authors identified a specific interaction between the
human small GTPase Rab2 and a Brucella spp. protein named RicA.
REFERENCE 2 (bases 1 to 3740)
AUTHORS Buffa,L., Fuchs,E., Pietropaolo,M., Barr,F. and Solimena,M.
TITLE ICA69 is a novel Rab2 effector regulating ER-Golgi trafficking in
insulinoma cells
JOURNAL Eur. J. Cell Biol. 87 (4), 197-209 (2008)
PUBMED 18187231
REMARK GeneRIF: ICA69 as a novel Rab2 effector and its role in regulating
the early transport of insulin secretory granule proteins
REFERENCE 3 (bases 1 to 3740)
AUTHORS Dong,C. and Wu,G.
TITLE Regulation of anterograde transport of adrenergic and angiotensin
II receptors by Rab2 and Rab6 GTPases
JOURNAL Cell. Signal. 19 (11), 2388-2399 (2007)
PUBMED 17716866
REMARK GeneRIF: These data demonstrate that Rab2 and Rab6 differentially
influence anterograde transport and signaling of GPCRs.
REFERENCE 4 (bases 1 to 3740)
AUTHORS Chi,A., Valencia,J.C., Hu,Z.Z., Watabe,H., Yamaguchi,H.,
Mangini,N.J., Huang,H., Canfield,V.A., Cheng,K.C., Yang,F., Abe,R.,
Yamagishi,S., Shabanowitz,J., Hearing,V.J., Wu,C., Appella,E. and
Hunt,D.F.
TITLE Proteomic and bioinformatic characterization of the biogenesis and
function of melanosomes
JOURNAL J. Proteome Res. 5 (11), 3135-3144 (2006)
PUBMED 17081065
REFERENCE 5 (bases 1 to 3740)
AUTHORS Eathiraj,S., Pan,X., Ritacco,C. and Lambright,D.G.
TITLE Structural basis of family-wide Rab GTPase recognition by
rabenosyn-5
JOURNAL Nature 436 (7049), 415-419 (2005)
PUBMED 16034420
REFERENCE 6 (bases 1 to 3740)
AUTHORS de Leeuw,H.P., Koster,P.M., Calafat,J., Janssen,H., van
Zonneveld,A.J., van Mourik,J.A. and Voorberg,J.
TITLE Small GTP-binding proteins in human endothelial cells
JOURNAL Br. J. Haematol. 103 (1), 15-19 (1998)
PUBMED 9792283
REFERENCE 7 (bases 1 to 3740)
AUTHORS Tisdale,E.J. and Balch,W.E.
TITLE Rab2 is essential for the maturation of pre-Golgi intermediates
JOURNAL J. Biol. Chem. 271 (46), 29372-29379 (1996)
PUBMED 8910601
REFERENCE 8 (bases 1 to 3740)
AUTHORS Khosravi-Far,R., Lutz,R.J., Cox,A.D., Conroy,L., Bourne,J.R.,
Sinensky,M., Balch,W.E., Buss,J.E. and Der,C.J.
TITLE Isoprenoid modification of rab proteins terminating in CC or CXC
motifs
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (14), 6264-6268 (1991)
PUBMED 1648736
REFERENCE 9 (bases 1 to 3740)
AUTHORS Zahraoui,A., Touchot,N., Chardin,P. and Tavitian,A.
TITLE The human Rab genes encode a family of GTP-binding proteins related
to yeast YPT1 and SEC4 products involved in secretion
JOURNAL J. Biol. Chem. 264 (21), 12394-12401 (1989)
PUBMED 2501306
REFERENCE 10 (bases 1 to 3740)
AUTHORS Tachibana,K., Umezawa,A., Kato,S. and Takano,T.
TITLE Nucleotide sequence of a new YPT1-related human cDNA which belongs
to the ras gene superfamily
JOURNAL Nucleic Acids Res. 16 (21), 10368 (1988)
PUBMED 3057444
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA648682.1, AK297576.1,
AC068389.10 and AW301641.1.
On Jun 19, 2011 this sequence version replaced gi:310120219.
Summary: The protein encoded by this gene belongs to the Rab
family, members of which are small molecular weight guanosine
triphosphatases (GTPases) that contain highly conserved domains
involved in GTP binding and hydrolysis. The Rabs are membrane-bound
proteins, involved in vesicular fusion and trafficking. This
protein is a resident of pre-Golgi intermediates, and is required
for protein transport from the endoplasmic reticulum (ER) to the
Golgi complex. Alternatively spliced transcript variants encoding
different isoforms have been found for this gene. [provided by
RefSeq, Oct 2011].
Transcript Variant: This variant (2) lacks an in-frame exon in the
5' coding region compared to variant 1. This results in a shorter
isoform (b) missing an internal protein segment compared to isoform
a.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK297576.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-322 DA648682.1 3-324
323-1084 AK297576.1 297-1058
1085-2055 AC068389.10 53096-54066 c
2056-3281 AC068389.10 51870-53095 c
3282-3740 AW301641.1 1-459 c
FEATURES Location/Qualifiers
source 1..3740
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q12.1"
gene 1..3740
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="RAB2A, member RAS oncogene family"
/db_xref="GeneID:5862"
/db_xref="HGNC:9763"
/db_xref="MIM:179509"
exon 1..344
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 8
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:13248794"
variation 35
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:188897877"
variation 71
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377019145"
variation 180
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11544472"
variation 238
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:79202491"
variation 269
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370633697"
misc_feature 284..286
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="upstream in-frame stop codon"
CDS 299..865
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="isoform b is encoded by transcript variant 2; RAB2,
member RAS oncogene family; ras-related protein Rab-2A;
small GTP binding protein RAB2A"
/codon_start=1
/product="ras-related protein Rab-2A isoform b"
/protein_id="NP_001229573.1"
/db_xref="GI:336391093"
/db_xref="CCDS:CCDS56537.1"
/db_xref="GeneID:5862"
/db_xref="HGNC:9763"
/db_xref="MIM:179509"
/translation="
MAYAYLFKYIIIGDTGVEFGARMITIDGKQIKLQIWDTAGQESFRSITRSYYRGAAGALLVYDITRRDTFNHLTTWLEDARQHSNSNMVIMLIGNKSDLESRREVKKEEGEAFAREHGLIFMETSAKTASNVEEAFINTAKEIYEKIQEGVFDINNEANGIKIGPQHAATNATHAGNQGGQQAGGGCC
"
misc_feature 305..736
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Rat sarcoma (Ras)-like superfamily of small
guanosine triphosphatases (GTPases); Region:
Ras_like_GTPase; cl17170"
/db_xref="CDD:247724"
misc_feature order(341..343,416..418,581..586,590..592,671..679)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="GTP/Mg2+ binding site [chemical binding]; other
site"
/db_xref="CDD:206648"
misc_feature 350..358
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Switch I region; other site"
/db_xref="CDD:206648"
misc_feature 407..418
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G3 box; other site"
/db_xref="CDD:206648"
misc_feature order(413..418,464..469)
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="Switch II region; other site"
/db_xref="CDD:206648"
misc_feature 581..592
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G4 box; other site"
/db_xref="CDD:206648"
misc_feature 671..679
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/note="G5 box; other site"
/db_xref="CDD:206648"
variation 307
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373226742"
exon 345..412
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 355
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368402545"
exon 413..495
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 450
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11544470"
exon 496..588
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 502
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375530419"
exon 589..700
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
variation 613
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:141013917"
variation 655
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370866047"
variation 656
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199581780"
exon 701..769
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
exon 770..3740
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/inference="alignment:Splign:1.39.8"
STS 773..907
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="STS-R00195"
/db_xref="UniSTS:16383"
STS 778..908
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RH70011"
/db_xref="UniSTS:5095"
variation 853
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370628676"
variation 854
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374486741"
STS 856..1353
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RAB2_2543"
/db_xref="UniSTS:280950"
STS 874..1149
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1929"
/db_xref="UniSTS:76818"
variation 892
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:367660654"
variation 893
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201836844"
variation 910
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368529941"
polyA_signal 1012..1017
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_site 1037
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 1128
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:183524386"
variation 1209
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:187759374"
variation 1231
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:76823768"
variation 1258..1259
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace=""
/replace="tt"
/db_xref="dbSNP:200305948"
variation 1293
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:41272433"
variation 1396
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:370058692"
variation 1497
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:113877343"
variation 1534
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374973250"
variation 1636
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79502934"
variation 1759
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77133934"
STS 1825..1976
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1899"
/db_xref="UniSTS:22645"
STS 1825..1948
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="RH92689"
/db_xref="UniSTS:92717"
variation 1904..1905
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace=""
/replace="a"
/db_xref="dbSNP:35329667"
STS 1918..2023
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1405E"
/db_xref="UniSTS:151199"
variation 1938
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140580809"
polyA_signal 1947..1952
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 1965
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:7413"
polyA_site 1976
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_signal 2075..2080
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
polyA_site 2095
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 2204
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369628178"
variation 2246
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373337569"
variation 2339
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:12544487"
variation 2381
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:78628010"
variation 2432
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:629268"
variation 2508
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:150407587"
variation 2541
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79970848"
variation 2662
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:649634"
variation 2731
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138129268"
variation 2758
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:192628540"
variation 2816
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75837686"
variation 2904
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2930041"
STS 2930..3180
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1613"
/db_xref="UniSTS:79309"
variation 2950
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:149557425"
variation 2954
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:9437"
variation 2998
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:118165570"
variation 3002
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:75974140"
STS 3006..3190
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/standard_name="D8S1394E"
/db_xref="UniSTS:45049"
variation 3118
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:186973869"
polyA_signal 3163..3168
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3182
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145073984"
polyA_site 3192
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3240
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:76705987"
variation 3246
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:652422"
variation 3260
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:138862634"
variation 3284
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374444619"
variation 3331
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142611281"
variation 3338
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:113076295"
variation 3344
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:191757602"
variation 3358
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:113490250"
variation 3427
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="g"
/replace="t"
/db_xref="dbSNP:184729393"
variation 3601
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:116372466"
variation 3635
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:189591638"
variation 3644
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:181704218"
polyA_signal 3702..3707
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3715
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:185297839"
polyA_site 3733
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
variation 3740
/gene="RAB2A"
/gene_synonym="LHX; RAB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:664796"
ORIGIN
tttcctccggcggcgccggcggccgcagaacttccgggtcggcgcggaggcggggcggaggcgccgcggcggctgttattgttcggctgggctcggtcgggcgctgtctccctcggctctgcgggtgtcagttcgtccggcttcctcacagcccctcactcccggcggctgacagcagcagcggcggcggcgggcggcgcctggcgtttcgaggctgagcggcaccggggttggggcgcggaggaggagcagcagcgggaggaggagccgtgtgccctggcactgagcggccgcggccatggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagatatgggatacggcagggcaagaatcctttcgttccatcacaaggtcgtattacagaggtgcagcaggagctttactagtttacgatattacacggagagatacattcaaccacttgacaacctggttagaagatgcccgccagcattccaattccaacatggtcattatgcttattggaaataaaagtgatttagaatctagaagagaagtaaaaaaagaagaaggtgaagcttttgcacgagaacatggactcatcttcatggaaacgtctgctaagactgcttccaatgtagaagaggcatttattaatacagcaaaagaaatttatgaaaaaattcaagaaggagtctttgacattaataatgaggcaaatggcattaaaattggccctcagcatgctgctaccaatgcaacacatgcaggcaatcagggaggacagcaggctgggggcggctgctgttgagtctgtttttactgtctagctgcccaacggggcctactcacttattctttcaccccctctcctcctgctcagctgagacatgaaactatttgaaatggctttatgtcacagaagactttaatccgtcaaattcttgtataactttgaataaatggttaatgttcacttaaaagacagattttggagattgtattcatatctatttgcatttgatttctaggtcaattgatgtgattatttttgttaaatgttgtcttgtgcccttaactacgaactgaattgtattaaacactacaaagtcatcttgagtattttaaatcggtttgtgtagttaggtttcccaacatctgtggttacctaatgtttaatattatagaactgtcctcagaaactttgtcaattttcacggctataaggaaacagaaggactcttttaattctgtatttatcatttactttctgtatatatagtttaataacctgcttgggtgtaatttgccaagcttgaattctttaatgcatttgcataaattctatactgtttagagcttaaagctacagaagcattgttaggaattgcttggacactgaattttaaactttttgacattgttaacaagcatgttcatcttttcttgtcactagtccaagaaaaatatgcttaatgtatattacaaaggctttgtatatgttaacctgttttaatgccaaaagtttgctttgtccacaatttccttaagacctcttcagaaagggatttgtttgccttaatgaatactgttgggaaaaaacacagtataatgagtgaaaagggcagaagcaagaaatttctacatcttagcgactccaagaagaatgagtatccacatttagatggcacattatgaggactttaatctttccttaaacacaataatgttttcttttttcttttattcacatgatttctaagtatatttttcatgcaggacagtttttcaaccttgatgtacagtgactgtgtaaaatttttctttcagtggcaacctctataatctttaaaatatggtgagcatcttgtctgttttgaaggggatatgacaataaatctatcagatggaaaatcctgttacaaagtagaaaagctttagtaatttactcagtgtggtggttttatcctttttttctttttctcccttggtctataatgaaattgttacagcagtgcaaaataaaatcctatgtataaaagtgttctttttttttattatgaccacctcttttttaatgtatttttagtccacttacagcttttacatgggtttaagcatgttttttaaaagggtcagaatggttaacactcaaccctttttaaaaattttgctaaaatgcgacaaatctcaccatactgaaattatttttgttgatggtgtaagcagtgtaagcaagtgttttctcctgaactagcacaaaagcacttatgcctgaaagaaagcataaagaagttctaactctgaaactaactactttcatttcgctcatggccttcaactttctacaggtcttccctgaagattcagcagtactctctcaaaggtttgacagtactcttgtgggaaatcaccaaatgctgtcatagttttgttttaactgtctccttgagggcagagggaagggtgagagaaaatctgttttcatgggtatttgtagtacagcctttttttctttcaagtggctgtatcaaattcactggtcttactaatcactgtctttaccagtgagtacaaaaagttaaggcaactaggacaggtactgctctataccaagaagagaatgattctttggaaattgttatttttaagcttctgttaatttttccagaagtttagtgcgtttcttttccatactttctcccctaattcttttatttgaagaagagaacttaatggcaaataaacaacaaaccaggacatgcattttaataccctaaggaaaaatggaaccctcaaatataactcctcccacaaccaccctaatgtgcctcagtctggggcagcaggtggacttctcaatagttcttttccacattctctacaaatcacatctaccgttaaggaatatgttatgaatcctttctgttaattgagaaagcaatgttattgtctgtgatttccagtctttgctcattttattatccctgtcaaataatgtaatattggtacctgcagttgaatttgtaatattgtaattgaatttttagttgatcttcgatcagtttttatagcatctatggacatagaaaatcagtcactgaaaaaaataaacacagctttcaatgtctcactcaacatgtaacattcaaaattgtgatcttcataaagacattgttaccattcgtcttgcaaatttaagacaactgaatgaaaagccaattttttgaaagaatgtggcatataattagatatacaactgaaacaggatatacaactgcatacaatttgtttttaatgatattttaaaatagcctgttagcaggaaaatagtccctatttatctgctaatggtcaaaaagagttaggatataaatcgtaccaaaatgtttccaatcactcagaaaaactgattcatgtctggctttgcaacaccttaaacatttattctgtcatagatagtaaagccccatctcagtttatttagtcctgaggttggcagcatggggtttgactatatgagctaaaagatacacaaagagataacgctgtttcataataaacaggaattgactatacaaataggtaaaccagcatatctacctgtatttctcagagtttagatgtgtgctttatgtttacattaaaataaagcctaacgccacagtagatcatctcatactgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5862 -> Molecular function: GO:0003924 [GTPase activity] evidence: IDA
GeneID:5862 -> Molecular function: GO:0005525 [GTP binding] evidence: IDA
GeneID:5862 -> Molecular function: GO:0019003 [GDP binding] evidence: IDA
GeneID:5862 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: IDA
GeneID:5862 -> Biological process: GO:0006184 [GTP catabolic process] evidence: TAS
GeneID:5862 -> Biological process: GO:0006888 [ER to Golgi vesicle-mediated transport] evidence: TAS
GeneID:5862 -> Biological process: GO:0007264 [small GTPase mediated signal transduction] evidence: IEA
GeneID:5862 -> Biological process: GO:0015031 [protein transport] evidence: IEA
GeneID:5862 -> Cellular component: GO:0000139 [Golgi membrane] evidence: TAS
GeneID:5862 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA
GeneID:5862 -> Cellular component: GO:0033116 [endoplasmic reticulum-Golgi intermediate compartment membrane] evidence: IEA
GeneID:5862 -> Cellular component: GO:0042470 [melanosome] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.