Home |
Help |
Advanced search
2024-04-27 04:52:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001242329 1593 bp mRNA linear PRI 01-MAY-2013
DEFINITION Homo sapiens ubiquitin specific peptidase 17-like family member 5
(USP17L5), mRNA.
ACCESSION NM_001242329 XM_001130437
VERSION NM_001242329.1 GI:334191678
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1593)
AUTHORS Ramakrishna,S., Suresh,B., Lee,E.J., Lee,H.J., Ahn,W.S. and
Baek,K.H.
TITLE Lys-63-specific deubiquitination of SDS3 by USP17 regulates HDAC
activity
JOURNAL J. Biol. Chem. 286 (12), 10505-10514 (2011)
PUBMED 21239494
REFERENCE 2 (bases 1 to 1593)
AUTHORS de la Vega,M., Kelvin,A.A., Dunican,D.J., McFarlane,C.,
Burrows,J.F., Jaworski,J., Stevenson,N.J., Dib,K., Rappoport,J.Z.,
Scott,C.J., Long,A. and Johnston,J.A.
TITLE The deubiquitinating enzyme USP17 is essential for GTPase
subcellular localization and cell motility
JOURNAL Nat Commun 2, 259 (2011)
PUBMED 21448158
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1593)
AUTHORS Ramakrishna,S., Suresh,B., Kang,I.C. and Baek,K.H.
TITLE Polyclonal and monoclonal antibodies specific for USP17, a
proapoptotic deubiquitinating enzyme
JOURNAL Hybridoma (Larchmt) 29 (4), 311-319 (2010)
PUBMED 20715989
REFERENCE 4 (bases 1 to 1593)
AUTHORS McFarlane,C., Kelvin,A.A., de la Vega,M., Govender,U., Scott,C.J.,
Burrows,J.F. and Johnston,J.A.
TITLE The deubiquitinating enzyme USP17 is highly expressed in tumor
biopsies, is cell cycle regulated, and is required for G1-S
progression
JOURNAL Cancer Res. 70 (8), 3329-3339 (2010)
PUBMED 20388806
REFERENCE 5 (bases 1 to 1593)
AUTHORS Burrows,J.F., Scott,C.J. and Johnston,J.A.
TITLE The DUB/USP17 deubiquitinating enzymes: a gene family within a
tandemly repeated sequence, is also embedded within the copy number
variable beta-defensin cluster
JOURNAL BMC Genomics 11, 250 (2010)
PUBMED 20403174
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 1593)
AUTHORS Burrows,J.F., McGrattan,M.J. and Johnston,J.A.
TITLE The DUB/USP17 deubiquitinating enzymes, a multigene family within a
tandemly repeated sequence
JOURNAL Genomics 85 (4), 524-529 (2005)
PUBMED 15780755
REFERENCE 7 (bases 1 to 1593)
AUTHORS Burrows,J.F., McGrattan,M.J., Rascle,A., Humbert,M., Baek,K.H. and
Johnston,J.A.
TITLE DUB-3, a cytokine-inducible deubiquitinating enzyme that blocks
proliferation
JOURNAL J. Biol. Chem. 279 (14), 13993-14000 (2004)
PUBMED 14699124
REFERENCE 8 (bases 1 to 1593)
AUTHORS Okada,T., Gondo,Y., Goto,J., Kanazawa,I., Hadano,S. and Ikeda,J.E.
TITLE Unstable transmission of the RS447 human megasatellite tandem
repetitive sequence that contains the USP17 deubiquitinating enzyme
gene
JOURNAL Hum. Genet. 110 (4), 302-313 (2002)
PUBMED 11941478
REFERENCE 9 (bases 1 to 1593)
AUTHORS Saitoh,Y., Miyamoto,N., Okada,T., Gondo,Y., Showguchi-Miyata,J.,
Hadano,S. and Ikeda,J.E.
TITLE The RS447 human megasatellite tandem repetitive sequence encodes a
novel deubiquitinating enzyme with a functional promoter
JOURNAL Genomics 67 (3), 291-300 (2000)
PUBMED 10936051
REFERENCE 10 (bases 1 to 1593)
AUTHORS Gondo,Y., Okada,T., Matsuyama,N., Saitoh,Y., Yanagisawa,Y. and
Ikeda,J.E.
TITLE Human megasatellite DNA RS447: copy-number polymorphisms and
interspecies conservation
JOURNAL Genomics 54 (1), 39-49 (1998)
PUBMED 9806828
COMMENT INFERRED REFSEQ: This record is predicted by genome sequence
analysis and is not yet supported by experimental evidence. The
reference sequence was derived from AC116655.7.
On May 28, 2011 this sequence version replaced gi:113415481.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
CCDS Note: This CCDS representation lacks full-length human
transcript support and it is therefore inferred, but it is
supported by data in PMID:10936051.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1593 AC116655.7 228146-229738 c
FEATURES Location/Qualifiers
source 1..1593
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4p16.1"
gene 1..1593
/gene="USP17L5"
/note="ubiquitin specific peptidase 17-like family member
5"
/db_xref="GeneID:728386"
/db_xref="HGNC:37177"
CDS 1..1593
/gene="USP17L5"
/EC_number="3.4.19.12"
/note="deubiquitinating enzyme 17-like protein 5;
ubiquitin thiolesterase 17-like protein 5;
ubiquitin-specific-processing protease 17-like protein 5;
ubiquitin thioesterase 17-like protein 5; ubiquitin
specific peptidase 17-like 5"
/codon_start=1
/product="ubiquitin carboxyl-terminal hydrolase 17-like
protein 5"
/protein_id="NP_001229258.1"
/db_xref="GI:334191679"
/db_xref="CCDS:CCDS59467.1"
/db_xref="GeneID:728386"
/db_xref="HGNC:37177"
/translation="
MEDDSLYLRGEWQFNHFSKLTSSRPDAAFAEIQRTSLPEKSPLSCETRVDLCDDLAPVARQLAPREKLPLSSRRPAAVGAGLQNMGNTCYVNASLQCLTYTPPLANYMLSREHSQTCHRHKGCMLCTMQAHITRALHNPGHVIQPSQALAAGFHRGKQEDAHEFLMFTVDAMKKACLPGHKQVDHHSKDTTLIHQIFGGYWRSQIKCLHCHGISDTFDPYLDIALDIQAAQSVQQALEQLAKPEELNGENAYHCGVCLQRAPASKTLTLHTSAKVLILVLKRFSDVTGNKIAKNVQYPECLDMQPYMSQPNTGPLVYVLYAVLVHAGWSCHNGHYFSYVKAQEGQWYKMDDAEVTASSITSVLSQQAYVLFYIQKSEWERHSESVSRGREPRALGAEDTDRRATQGELKRDHPCLQAPELDEHLVERATQESTLDHWKFLQEQNKTKPEFNVRKVEGTLPPDVLVIHQSKYKCGMKNHHPEQQSSLLNLSSSTPTHQESMNTGTLASLRGRARRSKGKNKHSKRALLVCQ
"
misc_feature 235..1119
/gene="USP17L5"
/note="A subfamily of Peptidase C19. Peptidase C19
contains ubiquitinyl hydrolases. They are intracellular
peptidases that remove ubiquitin molecules from
polyubiquinated peptides by cleavage of isopeptide bonds.
They hydrolyze bonds involving the carboxyl...; Region:
Peptidase_C19E; cd02661"
/db_xref="CDD:73067"
misc_feature 238..1116
/gene="USP17L5"
/note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH;
pfam00443"
/db_xref="CDD:201230"
misc_feature order(250..252,265..267,1000..1002,1051..1053)
/gene="USP17L5"
/note="active site"
/db_xref="CDD:73067"
misc_feature 1123..1362
/gene="USP17L5"
/note="Hyaluronan / mRNA binding family; Region:
HABP4_PAI-RBP1; pfam04774"
/db_xref="CDD:191086"
exon 1..1593
/gene="USP17L5"
/inference="alignment:Splign:1.39.8"
STS 1..1593
/gene="USP17L5"
/db_xref="UniSTS:484239"
STS 106..230
/gene="USP17L5"
/standard_name="G42601"
/db_xref="UniSTS:94504"
STS 241..512
/gene="USP17L5"
/standard_name="SHGC-145429"
/db_xref="UniSTS:183854"
STS 631..776
/gene="USP17L5"
/standard_name="G01806"
/db_xref="UniSTS:24811"
variation 722
/gene="USP17L5"
/replace="c"
/replace="t"
/db_xref="dbSNP:200218067"
STS 756..970
/gene="USP17L5"
/standard_name="G34441"
/db_xref="UniSTS:65683"
variation 813
/gene="USP17L5"
/replace="c"
/replace="t"
/db_xref="dbSNP:201364345"
variation 929
/gene="USP17L5"
/replace="a"
/replace="c"
/db_xref="dbSNP:200014566"
variation 945
/gene="USP17L5"
/replace="c"
/replace="t"
/db_xref="dbSNP:368939226"
variation 1004
/gene="USP17L5"
/replace="a"
/replace="g"
/db_xref="dbSNP:200671271"
variation 1069
/gene="USP17L5"
/replace="g"
/replace="t"
/db_xref="dbSNP:201843097"
variation 1091
/gene="USP17L5"
/replace="c"
/replace="g"
/db_xref="dbSNP:199855117"
variation 1234
/gene="USP17L5"
/replace="c"
/replace="t"
/db_xref="dbSNP:201042543"
variation 1235
/gene="USP17L5"
/replace="a"
/replace="c"
/db_xref="dbSNP:202002345"
variation 1290
/gene="USP17L5"
/replace="c"
/replace="g"
/db_xref="dbSNP:200006135"
STS 1346..1506
/gene="USP17L5"
/standard_name="G01912"
/db_xref="UniSTS:16665"
variation 1443
/gene="USP17L5"
/replace="a"
/replace="g"
/db_xref="dbSNP:201206388"
variation 1460
/gene="USP17L5"
/replace="a"
/replace="t"
/db_xref="dbSNP:201988425"
variation 1474
/gene="USP17L5"
/replace="a"
/replace="t"
/db_xref="dbSNP:200261319"
ORIGIN
atggaggacgactcactctacttgagaggtgagtggcagttcaaccacttttcaaaactcacatcttctcggcccgatgcagcttttgctgaaatccagcggacttctctccctgagaagtcaccactctcatgtgagacccgtgtcgacctctgtgatgatttggctcctgtggcaagacagcttgctcccagggagaagcttcctctgagtagcaggagacctgctgcggtgggggctgggctccagaatatgggaaatacctgctacgtgaacgcttccttgcagtgcctgacatacacaccgccccttgccaactacatgctgtcccgggagcactctcaaacgtgtcatcgtcacaagggctgcatgctctgtactatgcaagctcacatcacacgggccctccacaatcctggccacgtcatccagccctcacaggcattggctgctggcttccatagaggcaagcaggaagatgcccatgaatttctcatgttcactgtggatgccatgaaaaaggcatgccttcccgggcacaagcaggtagatcatcactctaaggacaccaccctcatccaccaaatatttggaggctactggagatctcaaatcaagtgtctccactgccacggcatttcagacacttttgacccttacctggacatcgccctggatatccaggcagctcagagtgtccagcaagctttggaacagttggcgaagcccgaagaactcaatggagagaatgcctatcattgtggtgtttgtctccagagggcgccggcctccaagacgttaactttacacacctctgccaaggtcctcatccttgtattgaagagattctccgatgtcacaggcaacaagattgccaagaatgtgcaatatcctgagtgccttgacatgcagccatacatgtctcagccgaacacaggacctctcgtctatgtcctctatgctgtgctggtccacgctgggtggagttgtcacaacggacattacttctcttatgtcaaagctcaagaaggccagtggtataaaatggatgatgccgaggtcaccgcctctagcatcacttctgtcctgagtcaacaggcctacgtcctcttttacatccagaagagtgaatgggaaagacacagtgagagtgtgtcaagaggcagggaaccaagagcccttggcgcagaagacaccgacaggcgagcaacgcaaggagagctcaagagagaccacccctgcctccaggcccccgagttggacgagcacttggtggaaagagccactcaggaaagcaccttagaccactggaaattccttcaagagcaaaacaaaacgaagcctgagttcaacgtcagaaaagtcgaaggtaccctgcctcccgacgtacttgtgattcatcaatcaaaatacaagtgtgggatgaagaaccatcatcctgaacagcaaagctccctgctaaacctctcttcgtcgaccccgacacatcaggagtccatgaacactggcacactcgcttccctgcgagggagggccaggagatccaaagggaagaacaaacacagcaagagggctctgcttgtgtgccagtga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:728386 -> Molecular function: GO:0004221 [ubiquitin thiolesterase activity] evidence: IEA
GeneID:728386 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: IEA
GeneID:728386 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: IEA
GeneID:728386 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:728386 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:728386 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001229258 -> EC 3.4.19.12
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.