2024-05-02 06:49:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001225 1319 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant alpha, mRNA. ACCESSION NM_001225 VERSION NM_001225.3 GI:73622123 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1319) AUTHORS Nickles,D., Falschlehner,C., Metzig,M. and Boutros,M. TITLE A genome-wide RNA interference screen identifies caspase 4 as a factor required for tumor necrosis factor alpha signaling JOURNAL Mol. Cell. Biol. 32 (17), 3372-3381 (2012) PUBMED 22733992 REMARK GeneRIF: These experiments identify caspase 4 as a novel regulator of TNF-alpha-induced NF-kappaB signaling that is required for the activation of I-kappaB kinase. REFERENCE 2 (bases 1 to 1319) AUTHORS Sollberger,G., Strittmatter,G.E., Kistowska,M., French,L.E. and Beer,H.D. TITLE Caspase-4 is required for activation of inflammasomes JOURNAL J. Immunol. 188 (4), 1992-2000 (2012) PUBMED 22246630 REMARK GeneRIF: Caspase-4 expression is essential for efficient nucleotide-binding domain leucine-rich repeat containing, Pyrin domain containing-3 and for absent in melanoma 2 inflammasome-dependent proIL-1beta activation in macrophages REFERENCE 3 (bases 1 to 1319) AUTHORS Wu,L.F., Ye,Y.Q., Huang,G.Y., Li,H.B., Li,G.P., Pu,Z.J., Wei,B.L. and Feng,J.L. TITLE Involvement of endoplasmic reticulum stress in adenosine-induced human hepatoma HepG2 cell apoptosis JOURNAL Oncol. Rep. 26 (1), 73-79 (2011) PUBMED 21479362 REMARK GeneRIF: GRP78, CHOP, caspase 4, and caspase 3 may be involved in adenosine-induced HepG2 cell apoptosis REFERENCE 4 (bases 1 to 1319) AUTHORS Scapoli,L., Girardi,A., Rubini,C., Martinelli,M., Spinelli,G., Palmieri,A., Lo Muzio,L. and Carinci,F. TITLE LOH at PDCD4, CTNNB1, and CASP4 loci contributes to stage progression of oral cancer JOURNAL Int J Immunopathol Pharmacol 24 (2 SUPPL), 89-93 (2011) PUBMED 21781452 REMARK GeneRIF: Loss of heterozygosity contributes to tumor progression of oral squamous cell carcinoma, and a specific role for PDCD4, CTNNB1, and CASP4 was found. REFERENCE 5 (bases 1 to 1319) AUTHORS Valentin-Acevedo,A., Sinquett,F.L. and Covey,L.R. TITLE c-Rel deficiency increases caspase-4 expression and leads to ER stress and necrosis in EBV-transformed cells JOURNAL PLoS ONE 6 (10), E25467 (2011) PUBMED 21984918 REMARK GeneRIF: Levels of c-Rel directly modulated expression of caspase-4 as well as other endoplasmic reticulum stress genes. REFERENCE 6 (bases 1 to 1319) AUTHORS Srinivasula,S.M., Ahmad,M., Fernandes-Alnemri,T., Litwack,G. and Alnemri,E.S. TITLE Molecular ordering of the Fas-apoptotic pathway: the Fas/APO-1 protease Mch5 is a CrmA-inhibitable protease that activates multiple Ced-3/ICE-like cysteine proteases JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (25), 14486-14491 (1996) PUBMED 8962078 REFERENCE 7 (bases 1 to 1319) AUTHORS Munday,N.A., Vaillancourt,J.P., Ali,A., Casano,F.J., Miller,D.K., Molineaux,S.M., Yamin,T.T., Yu,V.L. and Nicholson,D.W. TITLE Molecular cloning and pro-apoptotic activity of ICErelII and ICErelIII, members of the ICE/CED-3 family of cysteine proteases JOURNAL J. Biol. Chem. 270 (26), 15870-15876 (1995) PUBMED 7797592 REFERENCE 8 (bases 1 to 1319) AUTHORS Kamens,J., Paskind,M., Hugunin,M., Talanian,R.V., Allen,H., Banach,D., Bump,N., Hackett,M., Johnston,C.G., Li,P. et al. TITLE Identification and characterization of ICH-2, a novel member of the interleukin-1 beta-converting enzyme family of cysteine proteases JOURNAL J. Biol. Chem. 270 (25), 15250-15256 (1995) PUBMED 7797510 REFERENCE 9 (bases 1 to 1319) AUTHORS Faucheu,C., Diu,A., Chan,A.W., Blanchet,A.M., Miossec,C., Herve,F., Collard-Dutilleul,V., Gu,Y., Aldape,R.A., Lippke,J.A. et al. TITLE A novel human protease similar to the interleukin-1 beta converting enzyme induces apoptosis in transfected cells JOURNAL EMBO J. 14 (9), 1914-1922 (1995) PUBMED 7743998 REFERENCE 10 (bases 1 to 1319) AUTHORS Howard,A.D., Kostura,M.J., Thornberry,N., Ding,G.J., Limjuco,G., Weidner,J., Salley,J.P., Hogquist,K.A., Chaplin,D.D., Mumford,R.A. et al. TITLE IL-1-converting enzyme requires aspartic acid residues for processing of the IL-1 beta precursor at two distinct sites and does not cleave 31-kDa IL-1 alpha JOURNAL J. Immunol. 147 (9), 2964-2969 (1991) PUBMED 1919001 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN261701.1, Z48810.1 and AI128358.1. On Aug 19, 2005 this sequence version replaced gi:15451908. Summary: This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (alpha) encodes the longest isoform (alpha). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK057094.1, Z48810.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-32 CN261701.1 30-61 33-927 Z48810.1 1-895 928-1319 AI128358.1 1-392 c FEATURES Location/Qualifiers source 1..1319 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11q22.2-q22.3" gene 1..1319 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="caspase 4, apoptosis-related cysteine peptidase" /db_xref="GeneID:837" /db_xref="HGNC:1505" /db_xref="HPRD:04047" /db_xref="MIM:602664" exon 1..80 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" misc_feature 29..31 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="upstream in-frame stop codon" CDS 74..1207 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /EC_number="3.4.22.57" /note="isoform alpha precursor is encoded by transcript variant alpha; apoptotic cysteine protease Mih1/TX; caspase 4, apoptosis-related cysteine protease; caspase-4; CASP-4; ICE(rel)-II; protease TX; protease ICH-2" /codon_start=1 /product="caspase-4 isoform alpha precursor" /protein_id="NP_001216.1" /db_xref="GI:4502577" /db_xref="CCDS:CCDS8327.1" /db_xref="GeneID:837" /db_xref="HGNC:1505" /db_xref="HPRD:04047" /db_xref="MIM:602664" /translation="
MAEGNHRKKPLKVLESLGKDFLTGVLDNLVEQNVLNWKEEEKKKYYDAKTEDKVRVMADSMQEKQRMAGQMLLQTFFNIDQISPNKKAHPNMEAGPPESGESTDALKLCPHEEFLRLCKERAEEIYPIKERNNRTRLALIICNTEFDHLPPRNGADFDITGMKELLEGLDYSVDVEENLTARDMESALRAFATRPEHKSSDSTFLVLMSHGILEGICGTVHDEKKPDVLLYDTIFQIFNNRNCLSLKDKPKVIIVQACRGANRGELWVRDSPASLEVASSQSSENLEEDAVYKTHVEKDFIAFCSSTPHNVSWRDSTMGSIFITQLITCFQKYSWCCHLEEVFRKVQQSFETPRAKAQMPTIERLSMTRYFYLFPGN
" misc_feature 86..316 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="Caspase activation and recruitment domain found in Caspase-1 and related proteins; Region: CARD_CASP1-like; cd08325" /db_xref="CDD:176739" mat_peptide 314..883 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /product="caspase-4 isoform alpha large subunit" misc_feature 320..322 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P49662.1); phosphorylation site" misc_feature 446..1195 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="Caspase, interleukin-1 beta converting enzyme (ICE) homologues; Cysteine-dependent aspartate-directed proteases that mediate programmed cell death (apoptosis). Caspases are synthesized as inactive zymogens and activated by proteolysis of the peptide...; Region: CASc; cd00032" /db_xref="CDD:28914" misc_feature order(527..529,704..706,839..841,860..862,1004..1021, 1031..1036) /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="substrate pocket [chemical binding]; other site" /db_xref="CDD:28914" misc_feature order(701..703,845..847) /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="active site" /db_xref="CDD:28914" misc_feature order(863..865,959..964,983..985,992..994,1001..1003, 1070..1072,1094..1096,1112..1114,1142..1144,1157..1159, 1163..1165,1169..1171,1178..1183) /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:28914" misc_feature order(866..868,956..958) /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /note="proteolytic cleavage site; other site" /db_xref="CDD:28914" mat_peptide 941..1204 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /product="caspase-4 isoform alpha small subunit" exon 81..335 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" variation 81 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:56116531" variation 117 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:11539160" variation 151 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:55767261" variation 160 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:1801319" variation 161 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:55725009" variation 212 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:56226603" variation 229 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="c" /replace="g" /db_xref="dbSNP:2298768" exon 336..445 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" exon 446..619 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" exon 620..854 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" variation 691 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="c" /db_xref="dbSNP:56326166" exon 855..998 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" variation 925 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="g" /replace="t" /db_xref="dbSNP:55901059" variation 931 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:9507" exon 999..1108 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" variation 1104 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="a" /replace="g" /db_xref="dbSNP:56008239" exon 1109..1212 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" exon 1213..1319 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /inference="alignment:Splign:1.39.8" polyA_signal 1299..1304 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" variation 1317 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" /replace="c" /replace="t" /db_xref="dbSNP:56380626" polyA_site 1319 /gene="CASP4" /gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX" ORIGIN
atacatagtttactttcatttttgactctgaggctctttccaacgctgtaaaaaaggacagaggctgttccctatggcagaaggcaaccacagaaaaaagccacttaaggtgttggaatccctgggcaaagatttcctcactggtgttttggataacttggtggaacaaaatgtactgaactggaaggaagaggaaaaaaagaaatattacgatgctaaaactgaagacaaagttcgggtcatggcagactctatgcaagagaagcaacgtatggcaggacaaatgcttcttcaaaccttttttaacatagaccaaatatcccccaataaaaaagctcatccgaatatggaggctggaccacctgagtcaggagaatctacagatgccctcaagctttgtcctcatgaagaattcctgagactatgtaaagaaagagctgaagagatctatccaataaaggagagaaacaaccgcacacgcctggctctcatcatatgcaatacagagtttgaccatctgcctccgaggaatggagctgactttgacatcacagggatgaaggagctacttgagggtctggactatagtgtagatgtagaagagaatctgacagccagggatatggagtcagcgctgagggcatttgctaccagaccagagcacaagtcctctgacagcacattcttggtactcatgtctcatggcatcctggagggaatctgcggaactgtgcatgatgagaaaaaaccagatgtgctgctttatgacaccatcttccagatattcaacaaccgcaactgcctcagtctgaaggacaaacccaaggtcatcattgtccaggcctgcagaggtgcaaaccgtggggaactgtgggtcagagactctccagcatccttggaagtggcctcttcacagtcatctgagaacctagaggaagatgctgtttacaagacccacgtggagaaggacttcattgctttctgctcttcaacgccacacaacgtgtcctggagagacagcacaatgggctctatcttcatcacacaactcatcacatgcttccagaaatattcttggtgctgccacctagaggaagtatttcggaaggtacagcaatcatttgaaactccaagggccaaagctcaaatgcccaccatagaacgactgtccatgacaagatatttctacctctttcctggcaattgaaaatggaagccacaagcagcccagccctccttaatcaacttcaaggagcaccttcattagtacagcttgcatatttaacattttgtatttcaataaaagtgaagacaaacga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:837 -> Molecular function: GO:0004197 [cysteine-type endopeptidase activity] evidence: IEA GeneID:837 -> Biological process: GO:0006508 [proteolysis] evidence: IEA GeneID:837 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:837 -> Biological process: GO:0006917 [induction of apoptosis] evidence: TAS GeneID:837 -> Cellular component: GO:0005622 [intracellular] evidence: IEA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_001216 -> EC 3.4.22.57
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.