GGRNA Home | Help | Advanced search

2020-10-26 19:37:38, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001207034            5722 bp    mRNA    linear   PRI 12-MAY-2013
DEFINITION  Homo sapiens ring finger protein 40, E3 ubiquitin protein ligase
            (RNF40), transcript variant 3, mRNA.
ACCESSION   NM_001207034
VERSION     NM_001207034.1  GI:333440441
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5722)
  AUTHORS   Chernikova,S.B., Razorenova,O.V., Higgins,J.P., Sishc,B.J.,
            Nicolau,M., Dorth,J.A., Chernikova,D.A., Kwok,S., Brooks,J.D.,
            Bailey,S.M., Game,J.C. and Brown,J.M.
  TITLE     Deficiency in mammalian histone H2B ubiquitin ligase Bre1
            (Rnf20/Rnf40) leads to replication stress and chromosomal
            instability
  JOURNAL   Cancer Res. 72 (8), 2111-2119 (2012)
   PUBMED   22354749
  REMARK    GeneRIF: We show that Bre1 (human BRE1A/B (RNF20/40) and mouse
            Bre1a/b (Rnf20/40)) acts as an important suppressor of chromosomal
            instability
REFERENCE   2  (bases 1 to 5722)
  AUTHORS   Jaaskelainen,T., Makkonen,H., Visakorpi,T., Kim,J., Roeder,R.G. and
            Palvimo,J.J.
  TITLE     Histone H2B ubiquitin ligases RNF20 and RNF40 in androgen signaling
            and prostate cancer cell growth
  JOURNAL   Mol. Cell. Endocrinol. 350 (1), 87-98 (2012)
   PUBMED   22155569
  REMARK    GeneRIF: our results suggest that RNF20 and RNF40, either via
            ubiquitylation of H2B or other targets, are coupled to the
            proliferation of prostate cancer cells.
REFERENCE   3  (bases 1 to 5722)
  AUTHORS   Kari,V., Shchebet,A., Neumann,H. and Johnsen,S.A.
  TITLE     The H2B ubiquitin ligase RNF40 cooperates with SUPT16H to induce
            dynamic changes in chromatin structure during DNA double-strand
            break repair
  JOURNAL   Cell Cycle 10 (20), 3495-3504 (2011)
   PUBMED   22031019
  REMARK    GeneRIF: RNF40 cooperates with SUPT16H to induce dynamic changes in
            chromatin structure during DNA double-strand break repair.
REFERENCE   4  (bases 1 to 5722)
  AUTHORS   Shiloh,Y., Shema,E., Moyal,L. and Oren,M.
  TITLE     RNF20-RNF40: A ubiquitin-driven link between gene expression and
            the DNA damage response
  JOURNAL   FEBS Lett. 585 (18), 2795-2802 (2011)
   PUBMED   21827756
  REMARK    GeneRIF: Studies indicate that H2B monoubiquitylation is driven
            primarily by an E3 ubiquitin ligase composed of the two RING finger
            proteins RNF20 and RNF40.
            Review article
REFERENCE   5  (bases 1 to 5722)
  AUTHORS   Chernikova,S.B., Dorth,J.A., Razorenova,O.V., Game,J.C. and
            Brown,J.M.
  TITLE     Deficiency in Bre1 impairs homologous recombination repair and cell
            cycle checkpoint response to radiation damage in mammalian cells
  JOURNAL   Radiat. Res. 174 (5), 558-565 (2010)
   PUBMED   20738173
  REMARK    GeneRIF: the observed defects in the radiation response of
            Bre1a/b-deficient cells
REFERENCE   6  (bases 1 to 5722)
  AUTHORS   Kim,J., Guermah,M., McGinty,R.K., Lee,J.S., Tang,Z., Milne,T.A.,
            Shilatifard,A., Muir,T.W. and Roeder,R.G.
  TITLE     RAD6-Mediated transcription-coupled H2B ubiquitylation directly
            stimulates H3K4 methylation in human cells
  JOURNAL   Cell 137 (3), 459-471 (2009)
   PUBMED   19410543
REFERENCE   7  (bases 1 to 5722)
  AUTHORS   Zhu,B., Zheng,Y., Pham,A.D., Mandal,S.S., Erdjument-Bromage,H.,
            Tempst,P. and Reinberg,D.
  TITLE     Monoubiquitination of human histone H2B: the factors involved and
            their roles in HOX gene regulation
  JOURNAL   Mol. Cell 20 (4), 601-611 (2005)
   PUBMED   16307923
  REMARK    GeneRIF: Formation of trimeric complex UbcH6 and RNF20/40 with PAF
            stimulates histone 2B monoubiquitination activity in vitro
REFERENCE   8  (bases 1 to 5722)
  AUTHORS   Chin,L.S., Vavalle,J.P. and Li,L.
  TITLE     Staring, a novel E3 ubiquitin-protein ligase that targets syntaxin
            1 for degradation
  JOURNAL   J. Biol. Chem. 277 (38), 35071-35079 (2002)
   PUBMED   12121982
  REMARK    GeneRIF: Functional Analysis of the rat counterpart
REFERENCE   9  (bases 1 to 5722)
  AUTHORS   Wen,H. and Ao,S.
  TITLE     RBP95, a novel leucine zipper protein, binds to the retinoblastoma
            protein
  JOURNAL   Biochem. Biophys. Res. Commun. 275 (1), 141-148 (2000)
   PUBMED   10944455
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC106886.3, AK291666.1,
            AK027406.1, BC018647.2 and AI373490.1.
            
            Summary: The protein encoded by this gene contains a RING finger, a
            motif known to be involved in protein-protein and protein-DNA
            interactions. This protein was reported to interact with the tumor
            suppressor protein RB1. Studies of the rat counterpart suggested
            that this protein may function as an E3 ubiquitin-protein ligase,
            and facilitate the ubiquitination and degradation of syntaxin 1,
            which is an essential component of the neurotransmitter release
            machinery. Multiple alternatively spliced transcript variants
            encoding different isoforms have been found for this gene.
            [provided by RefSeq, May 2011].
            
            Transcript Variant: This variant (3) lacks in-frame two consecutive
            exons in the coding region, compared to variant 1. The resulting
            isoform (3) lacks an internal segment, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK027406.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-711               AC106886.3         140545-141255
            712-1334            AK291666.1         2-624
            1335-2659           AK027406.1         625-1949
            2660-4630           BC018647.2         2227-4197
            4631-5312           AC106886.3         154152-154833
            5313-5722           AI373490.1         1-410               c
FEATURES             Location/Qualifiers
     source          1..5722
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16p11.2-p11.1"
     gene            1..5722
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="ring finger protein 40, E3 ubiquitin protein
                     ligase"
                     /db_xref="GeneID:9810"
                     /db_xref="HGNC:16867"
                     /db_xref="MIM:607700"
     exon            1..749
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       56
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201918052"
     variation       102
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181301950"
     variation       216
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142652932"
     variation       243
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368063124"
     variation       293
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114846242"
     variation       380
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:62057185"
     variation       519
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374039649"
     variation       666..667
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:141812412"
     variation       667..668
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:199859165"
     variation       671..672
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:376493317"
     variation       672..673
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:111298574"
     variation       673
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3812999"
     misc_feature    731..733
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="upstream in-frame stop codon"
     variation       743
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185778178"
     exon            750..952
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       766
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112478319"
     variation       776
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1550477"
     variation       785
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373061072"
     variation       792
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141744543"
     CDS             821..3526
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /EC_number="6.3.2.-"
                     /note="isoform 3 is encoded by transcript variant 3; BRE1
                     E3 ubiquitin ligase homolog B; 95 kDa retinoblastoma
                     protein binding protein; Rb-associated protein; E3
                     ubiquitin-protein ligase BRE1B; BRE1-B; 95 kDa
                     retinoblastoma-associated protein"
                     /codon_start=1
                     /product="E3 ubiquitin-protein ligase BRE1B isoform 3"
                     /protein_id="NP_001193963.1"
                     /db_xref="GI:333440442"
                     /db_xref="CCDS:CCDS55994.1"
                     /db_xref="GeneID:9810"
                     /db_xref="HGNC:16867"
                     /db_xref="MIM:607700"
                     /translation="
MSGPGNKRAAGDGGSGPPEKKLSREEKTTTTLIEPIRLGGISSTEEMDLKVLQFKNKKLAERLEQRQACEDELRERIEKLEKRQATDDATLLIVNRYWAQLDETVEALLRCHESQGELSSAPEAPGTQEGPTCDGTPLPEPGTSELRDPLLMQLRPPLSEPALAFVVALGASSSEEVELELQGRMEFSKAAVSRVVEASDRLQRRVEELCQRVYSRGDSEPLSEAAQAHTRELGRENRRLQDLATQLQEKHHRISLEYSELQDKVTSAETKVLEMETTVEDLQWDIEKLRKREQKLNKHLAEALEQLNSGYYVSGSSSGFQGGQITLSMQKSDELGLQKKLRTEVIQLEDTLAQVRKEYEMLRIEFEQNLAANEQAGPINREMRHLISSLQNHNHQLKGDAQRYKRKLREVQAEIGKLRAQASGSAHSTPNLGHPEDSGVSAPAPGKEEGGPGPVSTPDNRKEMAPVPGTTTTTTSVKKEELVPSEEDFQGITPGAQGPSSRGREPEARPKRELREREGPSLGPPPVASALSRADREKAKVEETKRKESELLKGLRAELKKAQESQKEMKLLLDMYKSAPKEQRDKVQLMAAERKAKAEVDELRSRIRELEERDRRESKKIADEDALRRIRQAEEQIEHLQRKLGATKQEEEALLSEMDVTGQAFEDMQEQNGRLLQQLREKDDANFKLMSERIKANQIHKLLREEKDELGEQVLGLKSQVDAQLLTVQKLEEKERALQGSLGGVEKELTLRSQALELNKRKAVEAAQLAEDLKVQLEHVQTRLREIQPCLAESRAAREKESFNLKRAQEDISRLRRKLEKQRKVEVYADADEILQEEIKEYKARLTCPCCNTRKKDAVLTKCFHVFCFECVRGRYEARQRKCPKCNAAFGAHDFHRIYIS
"
     misc_feature    3353..3484
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="Zinc finger, C3HC4 type (RING finger); Region:
                     zf-C3HC4_2; pfam13923"
                     /db_xref="CDD:206094"
     misc_feature    3359..3490
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="RING-finger (Really Interesting New Gene) domain, a
                     specialized type of Zn-finger of 40 to 60 residues that
                     binds two atoms of zinc; defined by the 'cross-brace'
                     motif C-X2-C-X(9-39)-C-X(1-3)-
                     H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
                     in...; Region: RING; cd00162"
                     /db_xref="CDD:29102"
     misc_feature    order(3362..3364,3368..3370,3407..3409,3413..3415,
                     3422..3424,3431..3433,3467..3469,3476..3478)
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:29102"
     variation       866
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369284201"
     variation       895
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147367477"
     variation       907
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140084956"
     variation       925
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376522975"
     exon            953..1120
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       995
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370365187"
     variation       1039
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200779294"
     variation       1041
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201672722"
     variation       1106
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200908487"
     variation       1111
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373736477"
     exon            1121..1262
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1131
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143962429"
     variation       1141
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369988056"
     variation       1146
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150696859"
     variation       1182
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734395"
     variation       1186
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139969532"
     variation       1211
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149784534"
     variation       1249
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201302145"
     exon            1263..1469
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1276
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145704561"
     variation       1285
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141178194"
     variation       1300
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368256665"
     variation       1309
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368184098"
     variation       1370
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372421097"
     variation       1400
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370831334"
     variation       1401
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144298537"
     variation       1421
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370199075"
     variation       1431
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370463722"
     variation       1434
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200779544"
     variation       1436
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146569480"
     variation       1447
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140350331"
     variation       1455
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150302561"
     variation       1462
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142610348"
     exon            1470..1591
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1494
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373834012"
     variation       1501
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151018120"
     variation       1512
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186930335"
     variation       1525
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190164026"
     variation       1577
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146029900"
     variation       1578
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140880093"
     exon            1592..1738
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1601
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150097902"
     variation       1621
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138667885"
     variation       1624
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141073737"
     variation       1678
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146962748"
     variation       1689
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137974994"
     exon            1739..1813
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1784
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372843648"
     exon            1814..1949
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1815
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201408415"
     variation       1819
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148540364"
     variation       1838
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376887402"
     variation       1845
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146102570"
     variation       1872
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370050962"
     variation       1873
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200241748"
     variation       1881
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373531132"
     variation       1908
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11556801"
     exon            1950..2071
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2044
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140066306"
     variation       2070
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375382763"
     exon            2072..2499
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2076
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371336064"
     variation       2079
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375339639"
     variation       2137
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369888244"
     variation       2146
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149944221"
     variation       2150
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144994266"
     variation       2151
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145317847"
     variation       2155
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201945156"
     variation       2168
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142220777"
     variation       2195
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147842419"
     variation       2228
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373535706"
     variation       2270
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181567820"
     variation       2271
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376394465"
     variation       2293
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12448366"
     variation       2298
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138041260"
     variation       2324
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370636384"
     variation       2339
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372397361"
     variation       2363
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140772506"
     variation       2364
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7195142"
     variation       2376
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377015847"
     variation       2402
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200704225"
     variation       2407
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368718461"
     variation       2408
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371990879"
     variation       2410
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376313170"
     variation       2419
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11556800"
     variation       2427
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372740746"
     variation       2456
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375038841"
     variation       2458
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199751420"
     variation       2472
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369150602"
     variation       2487
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148854241"
     exon            2500..2617
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2521
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200021839"
     variation       2557
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138894221"
     variation       2601
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199511804"
     variation       2610
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373318017"
     exon            2618..2767
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2630
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149396723"
     variation       2637
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368428563"
     variation       2643
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369928310"
     variation       2699
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200484566"
     variation       2711
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146398674"
     variation       2728
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201471588"
     exon            2768..2980
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2770
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369635997"
     variation       2848
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368729037"
     variation       2862
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76896762"
     variation       2899
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377035892"
     variation       2953
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369744162"
     variation       2954
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11556799"
     variation       2977
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201232201"
     exon            2981..3106
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2981
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34418731"
     variation       2989
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138471194"
     variation       3013
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4889506"
     variation       3043
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372670313"
     variation       3046
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142343572"
     variation       3070
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201957029"
     variation       3086
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368542250"
     exon            3107..3247
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3165
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140097440"
     exon            3248..3349
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3304
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61754473"
     variation       3313
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373316806"
     variation       3314
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201668303"
     exon            3350..5719
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3351
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370853213"
     variation       3361
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199808715"
     variation       3365
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373895036"
     variation       3415
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375969920"
     variation       3434
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370299929"
     variation       3472..3473
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35083725"
     variation       3481
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373727066"
     variation       3484
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79828087"
     variation       3534
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367793448"
     variation       3537
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048622"
     variation       3541
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201807199"
     variation       3542
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35676536"
     variation       3558
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72793383"
     variation       3574
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369342812"
     variation       3765
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112016949"
     variation       3814
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147181313"
     variation       3906
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370917350"
     variation       3915
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11642862"
     variation       4231
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189434372"
     variation       4276
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:138074304"
     STS             4306..4427
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /standard_name="RH103172"
                     /db_xref="UniSTS:97505"
     variation       4471..4472
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="ggggggg"
                     /db_xref="dbSNP:146030134"
     variation       4473
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201124775"
     variation       4477
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139144017"
     variation       4550
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143079612"
     variation       4555
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371727012"
     variation       4618
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181540872"
     variation       4636
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368844573"
     variation       4758
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185087026"
     variation       4801
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376360885"
     variation       4806
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11640414"
     variation       4819
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374375536"
     variation       4888
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190427175"
     variation       4983
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373487580"
     variation       4998
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376441594"
     variation       5018
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3747486"
     variation       5368
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139244585"
     variation       5431
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201312074"
     variation       5531
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76853104"
     variation       5552
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372130434"
     variation       5648
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150074195"
     variation       5649
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114343697"
     polyA_signal    5697..5702
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
     variation       5700
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181903935"
     variation       5717
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144385617"
     polyA_site      5719
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
ORIGIN      
acactcgcacgcgtccgcgcggccgacccatgcactgagctgcgatccttccccgcttcccgccgcagctcggagagatgttcaagctccgactgcaccctcattcccaaaaagtggctggtcttgcggttgagcatctcgccgctcttccgtgccgcgaggcgccccgggctcccgccgcctaggttccaggacagccagcgctcggtcggcggctaccaaggccgggcccgttcgcctcgctccggccaatctacgcgcggagaggcgcggcggggcgaatccgtgggggcgtctccctccgtctcaacggcgacggttgccaagggggcttgtgagggaaggaaggcggaaagcgcaggctcacgccagtgggagcgaagagaacgcgcagatacgtgagaagttgcgagtgcccacctgggcgccctctcttccaggttgctaatacgagggccggtgctgtcctccaggctgggaagtgggagcgcggtgtcagttactatgggaactgcctcttggccaatcaccgagagaaagaggaggtgtttgggaagaagccagaggacccgagtggcgggaccaagcgtaaccaatagaagcagaagataaagaagtttcctcacatccggggctgcctttggcgcctgcgccctgcgcaccgttggggggggggcagtggcgtccagtgacgcccagtgacgtccggtgaaatccaagatggcggcgctaggctgaccctcctgctggtgacggaagtaccgcctcctcccgtctgacgcccctcaggggaccctgcatcgctccagccgccgcggccatgtctgggccaggcaacaaacgcgccgccggcgacgggggctcagggcccccggaaaagaagctgagtcgtgaggagaagaccaccacgactcttatcgagcccattcgtcttggaggcatctcttccacggaggagatggacctgaaggtactacagttcaagaacaagaaactggcagagcggctggaacaacggcaggcttgtgaagatgaactccgagaacgaattgagaagttggagaagcggcaggccacagatgatgccacactcctcatcgtcaatcgctactgggcccagctggatgaaactgtggaagcccttctccgatgccatgagagccagggggagctgtcttcagcgcctgaggcacctgggacccaggaggggccaacatgtgatgggactcctctcccagagccggggacatcagagctgagagaccccttgctgatgcagctgcggccccctctcagtgagccggccttggcttttgtggtggcactgggtgccagcagcagtgaggaggtggagctggagctgcaaggccgaatggagttctccaaggcagctgtgtctcgtgtggtagaggcctcagaccgcctacagcgccgggtggaggaactctgtcagcgagtgtacagccgaggggacagtgagcccctcagtgaggcggctcaggcacacacccgagagctgggccgtgagaaccggcgactgcaggacttggccactcagctgcaggagaaacaccaccgcatctcattggagtactccgagctccaggataaagtgacatcggcagagaccaaggtgctggagatggagacaacagtggaggacttgcagtgggacatcgagaagctgcggaagcgagagcaaaagctcaataagcacctggcagaggccttagagcagcttaactctggctactatgtatctgggagctcctcaggcttccaggggggccagatcacactcagcatgcagaagagcgacgagctggggctgcagaagaagctacgcacagaggtcattcagctggaggacacgctggcccaggtacgcaaggagtatgagatgctgcgcatcgagtttgagcagaatctggcggccaacgagcaggcggggcccatcaaccgtgagatgcgccacctgattagtagtcttcaaaaccacaaccaccagctaaaaggggacgcccagcgatacaagcggaagcttcgagaagtacaagctgagattggcaagctccgggcccaggccagtggctctgcccactccacccccaacctgggccacccagaggattctggcgtcagtgccccagccccagggaaagaggagggtgggccaggccctgtcagtacccccgacaacagaaaggagatggctccagtgcctggcaccaccactactaccacttcagtgaagaaggaggagctggtcccctctgaagaggacttccagggtataacccctggggcccagggcccttcctcccggggccgagaacctgaggccaggcccaagcgggagcttcgggaacgggaaggtcccagcctaggacctccacctgtagcctccgctctctcaagggctgatcgggagaaggccaaggtggaagaaaccaagcggaaggaatcagaactcctcaagggtctccgagcagagctcaagaaggcccaggagagccagaaggagatgaaactgctgctggatatgtacaagtcagcgcccaaggagcagcgggataaggtgcagctcatggcagcggaacgcaaggctaaggccgaggttgatgagctgcggagccgcatccgggaattggaggagagggatcgaagggagagcaagaagatcgcggatgaggatgccctgcggcgcattcggcaggcagaggagcagatagaacacctgcagcgcaagctgggtgccaccaagcaggaggaggaggctctgctctcagagatggatgtgacaggtcaggcttttgaggacatgcaggaacagaacgggcggctgctacagcagttgcgggaaaaggatgatgccaactttaagctaatgtcagagcggatcaaggccaaccagattcacaagctgctgcgggaggagaaggatgagttgggcgagcaggtccttggcctcaagtcccaggtggatgcccagctgctgactgtgcagaagctggaggagaaggagcgagccttgcagggcagcctcgggggtgtggagaaggagctgacgctgcgcagccaagccctggagctcaacaagcggaaggctgtagaagccgcccagctggccgaggacctgaaggtgcagctggagcacgtgcagactcggctgcgggagatccagccctgcctggcagagagccgggctgctcgtgagaaagagagcttcaacctcaagagggctcaggaggacatctcacggctgcggcgcaagctggaaaagcagaggaaggtggaggtctacgcagatgccgacgaaatcctccaggaggagatcaaggagtacaaggcgcggttgacctgcccctgctgtaacacccgcaagaaggatgcagtccttaccaagtgcttccacgttttctgcttcgagtgcgtgcggggccgctatgaggcccgccagaggaagtgccccaagtgcaacgcggcctttggtgcccacgacttccatcgtatctacatcagctgaacctgaaactcaggggactctggaacaccatggaccctgggggctgtgcccccatctcctccccaccccaggtctagtggccccaccctccattccggaccccatgggcccagcccctgcccatctagttggtttggggaccctggtgcatgctagtgggcatgggatcagccaagcttcgttccatcttttcctaaaggtcagagctgcagcctagggggcactgccctacagaaaaggtctgcctgagaggcctgaggagcccagagcacttgactgagcttcccggaaactggccctaacctgtctgtctccgtggatgcatcctaaccctaaggaaaattccccaggctgtgatctaccctagagaaggctcgctccctgcctactggctcacaaatgaggaccagtgagccatgtccttgttccttgtttgagactgggctgcaggccccaggaagactttccttcacccaccatccccctaacctcggcagggcttctgtcctgtggagttccctggacaccttggtctggctcttgtgccaagggctgaaggaggtaccctcttggcagatgggggcatcacttgcttcctttgggaagctctaaggttgctgcagtcaccttcctcatcttgcaggtgctgaaccaacatcatcagtttctattctaatcaggccccttcccaatctccatttctctgccaagcccatttacccccacctcatgcatcccaaggctctactgggtccctggacctaaccctgctttcatcctggtggccttaactacagtggaggtggaacttcccaggaggggaagggacagaccagccccagccgctgggccaacttccaatcattccagctagaagagcttccccctgacaccctgtgactgagcctgtgtcctgtctgcctgcccagccatgctccatcggctgtgagggcagtgcccggagaggccagagggttggagctgcagggacccgtttggacccacagcctctgttctagagatgcttgtataggctgttaattgtgatgaataaacgttcaaccctcggcctgcagccagagtagccaggccgcgcaccccaaatgtagtcccccgattttagctgcagcagctgagcagcactttgctggcttggtgtgagcctgggagggctcagacttaacggccggcagggatcccggactgggcctgaaggggagagcgtggtggtcgtcgcggagccgcctgtcctgctcccaccgaccccggtctgaccacgtccttggctgtcatggccgggggatgccgggactcctcgggctgcatcctgggaagtgtagttcctggtccgcacatggttaggaggttctcggagagagagctagtttcccggttgcgctggccaaaggccggcctgaactggatcctgcggaccgcttctcagcggcttcacccccacaccactcgaatgcacagatcgggacacctcagctgggtgacttccctcgttgcaatcggcctcgggagcggtgcggcgtgtaccgagcggcgcccctgggctcagcgcgctgcaggcgccccgggcggatccttcaccgaggcaggactggggctggcgccagagccggtgcggagcggtgttggttcaggcgctggcgacagtgctatggccacggcaggggccgcgtgcgtctcagcggtggcgccttcggaccctattggcgcccgggacttaagcggggccgccgctgctggaccaggacgaactggagaaggagacgcgggccgccacggtgacctcgggcgtagggccggcggcggcgggcacgctggtggaagcgcgggccgcggcaggggaggacatcgggccgcagagaaagtgccgatggcctggggcagcggtgcgagggtgggaaaaacgcaggatattgcatcatagagacgcggccaccttcgcccctggagagcgccagtctcaggagcgccgcaccggtcacgggtggaggtcagccaggcctccgtaagcgcggtccccttccaggagtagccttcgcctgggctcttgagtagatgccaagtaattccgcatcgtctctctagatatctgcgctaaaggccacccggtctccttatcagaggggcaaaactctcctcgtgggtcttcatacctaataaaagtcggcatcaaaccacaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9810 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IDA
            GeneID:9810 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9810 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0017075 [syntaxin-1 binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI
            GeneID:9810 -> Molecular function: GO:0032403 [protein complex binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:9810 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: ISS
            GeneID:9810 -> Biological process: GO:0010390 [histone monoubiquitination] evidence: IDA
            GeneID:9810 -> Biological process: GO:0033523 [histone H2B ubiquitination] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0000151 [ubiquitin ligase complex] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0033503 [HULC complex] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0043005 [neuron projection] evidence: ISS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001193963 -> EC 6.3.2.-

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.