GGRNA Home | Help | Advanced search

2020-10-26 19:36:14, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001207033            6019 bp    mRNA    linear   PRI 12-MAY-2013
DEFINITION  Homo sapiens ring finger protein 40, E3 ubiquitin protein ligase
            (RNF40), transcript variant 2, mRNA.
ACCESSION   NM_001207033
VERSION     NM_001207033.1  GI:333440439
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6019)
  AUTHORS   Chernikova,S.B., Razorenova,O.V., Higgins,J.P., Sishc,B.J.,
            Nicolau,M., Dorth,J.A., Chernikova,D.A., Kwok,S., Brooks,J.D.,
            Bailey,S.M., Game,J.C. and Brown,J.M.
  TITLE     Deficiency in mammalian histone H2B ubiquitin ligase Bre1
            (Rnf20/Rnf40) leads to replication stress and chromosomal
            instability
  JOURNAL   Cancer Res. 72 (8), 2111-2119 (2012)
   PUBMED   22354749
  REMARK    GeneRIF: We show that Bre1 (human BRE1A/B (RNF20/40) and mouse
            Bre1a/b (Rnf20/40)) acts as an important suppressor of chromosomal
            instability
REFERENCE   2  (bases 1 to 6019)
  AUTHORS   Jaaskelainen,T., Makkonen,H., Visakorpi,T., Kim,J., Roeder,R.G. and
            Palvimo,J.J.
  TITLE     Histone H2B ubiquitin ligases RNF20 and RNF40 in androgen signaling
            and prostate cancer cell growth
  JOURNAL   Mol. Cell. Endocrinol. 350 (1), 87-98 (2012)
   PUBMED   22155569
  REMARK    GeneRIF: our results suggest that RNF20 and RNF40, either via
            ubiquitylation of H2B or other targets, are coupled to the
            proliferation of prostate cancer cells.
REFERENCE   3  (bases 1 to 6019)
  AUTHORS   Kari,V., Shchebet,A., Neumann,H. and Johnsen,S.A.
  TITLE     The H2B ubiquitin ligase RNF40 cooperates with SUPT16H to induce
            dynamic changes in chromatin structure during DNA double-strand
            break repair
  JOURNAL   Cell Cycle 10 (20), 3495-3504 (2011)
   PUBMED   22031019
  REMARK    GeneRIF: RNF40 cooperates with SUPT16H to induce dynamic changes in
            chromatin structure during DNA double-strand break repair.
REFERENCE   4  (bases 1 to 6019)
  AUTHORS   Shiloh,Y., Shema,E., Moyal,L. and Oren,M.
  TITLE     RNF20-RNF40: A ubiquitin-driven link between gene expression and
            the DNA damage response
  JOURNAL   FEBS Lett. 585 (18), 2795-2802 (2011)
   PUBMED   21827756
  REMARK    GeneRIF: Studies indicate that H2B monoubiquitylation is driven
            primarily by an E3 ubiquitin ligase composed of the two RING finger
            proteins RNF20 and RNF40.
            Review article
REFERENCE   5  (bases 1 to 6019)
  AUTHORS   Chernikova,S.B., Dorth,J.A., Razorenova,O.V., Game,J.C. and
            Brown,J.M.
  TITLE     Deficiency in Bre1 impairs homologous recombination repair and cell
            cycle checkpoint response to radiation damage in mammalian cells
  JOURNAL   Radiat. Res. 174 (5), 558-565 (2010)
   PUBMED   20738173
  REMARK    GeneRIF: the observed defects in the radiation response of
            Bre1a/b-deficient cells
REFERENCE   6  (bases 1 to 6019)
  AUTHORS   Kim,J., Guermah,M., McGinty,R.K., Lee,J.S., Tang,Z., Milne,T.A.,
            Shilatifard,A., Muir,T.W. and Roeder,R.G.
  TITLE     RAD6-Mediated transcription-coupled H2B ubiquitylation directly
            stimulates H3K4 methylation in human cells
  JOURNAL   Cell 137 (3), 459-471 (2009)
   PUBMED   19410543
REFERENCE   7  (bases 1 to 6019)
  AUTHORS   Zhu,B., Zheng,Y., Pham,A.D., Mandal,S.S., Erdjument-Bromage,H.,
            Tempst,P. and Reinberg,D.
  TITLE     Monoubiquitination of human histone H2B: the factors involved and
            their roles in HOX gene regulation
  JOURNAL   Mol. Cell 20 (4), 601-611 (2005)
   PUBMED   16307923
  REMARK    GeneRIF: Formation of trimeric complex UbcH6 and RNF20/40 with PAF
            stimulates histone 2B monoubiquitination activity in vitro
REFERENCE   8  (bases 1 to 6019)
  AUTHORS   Chin,L.S., Vavalle,J.P. and Li,L.
  TITLE     Staring, a novel E3 ubiquitin-protein ligase that targets syntaxin
            1 for degradation
  JOURNAL   J. Biol. Chem. 277 (38), 35071-35079 (2002)
   PUBMED   12121982
  REMARK    GeneRIF: Functional Analysis of the rat counterpart
REFERENCE   9  (bases 1 to 6019)
  AUTHORS   Wen,H. and Ao,S.
  TITLE     RBP95, a novel leucine zipper protein, binds to the retinoblastoma
            protein
  JOURNAL   Biochem. Biophys. Res. Commun. 275 (1), 141-148 (2000)
   PUBMED   10944455
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC106886.3, AB014561.1,
            AK291666.1 and AI373490.1.
            
            Summary: The protein encoded by this gene contains a RING finger, a
            motif known to be involved in protein-protein and protein-DNA
            interactions. This protein was reported to interact with the tumor
            suppressor protein RB1. Studies of the rat counterpart suggested
            that this protein may function as an E3 ubiquitin-protein ligase,
            and facilitate the ubiquitination and degradation of syntaxin 1,
            which is an essential component of the neurotransmitter release
            machinery. Multiple alternatively spliced transcript variants
            encoding different isoforms have been found for this gene.
            [provided by RefSeq, May 2011].
            
            Transcript Variant: This variant (2) has an alternate splice site
            in the coding region, compared to variant 1. The resulting isoform
            (2) lacks an internal aa, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK291666.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025091 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-728               AC106886.3         140545-141272
            729-1918            AB014561.1         1-1190
            1919-4021           AK291666.1         1209-3311
            4022-5609           AC106886.3         153246-154833
            5610-6019           AI373490.1         1-410               c
FEATURES             Location/Qualifiers
     source          1..6019
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16p11.2-p11.1"
     gene            1..6019
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="ring finger protein 40, E3 ubiquitin protein
                     ligase"
                     /db_xref="GeneID:9810"
                     /db_xref="HGNC:16867"
                     /db_xref="MIM:607700"
     exon            1..749
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       56
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201918052"
     variation       102
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181301950"
     variation       216
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142652932"
     variation       243
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368063124"
     variation       293
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114846242"
     variation       380
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:62057185"
     variation       519
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374039649"
     variation       666..667
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:141812412"
     variation       667..668
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:199859165"
     variation       671..672
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:376493317"
     variation       672..673
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:111298574"
     variation       673
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3812999"
     misc_feature    731..733
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="upstream in-frame stop codon"
     variation       743
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185778178"
     exon            750..952
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       766
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112478319"
     variation       776
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1550477"
     variation       785
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373061072"
     variation       792
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141744543"
     CDS             821..3823
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /EC_number="6.3.2.-"
                     /note="isoform 2 is encoded by transcript variant 2; BRE1
                     E3 ubiquitin ligase homolog B; 95 kDa retinoblastoma
                     protein binding protein; Rb-associated protein; E3
                     ubiquitin-protein ligase BRE1B; BRE1-B; 95 kDa
                     retinoblastoma-associated protein"
                     /codon_start=1
                     /product="E3 ubiquitin-protein ligase BRE1B isoform 2"
                     /protein_id="NP_001193962.1"
                     /db_xref="GI:333440440"
                     /db_xref="GeneID:9810"
                     /db_xref="HGNC:16867"
                     /db_xref="MIM:607700"
                     /translation="
MSGPGNKRAAGDGGSGPPEKKLSREEKTTTTLIEPIRLGGISSTEEMDLKVLQFKNKKLAERLEQRQACEDELRERIEKLEKRQATDDATLLIVNRYWAQLDETVEALLRCHESQGELSSAPEAPGTQEGPTCDGTPLPEPGTSELRDPLLMQLRPPLSEPALAFVVALGASSSEEVELELQGRMEFSKAAVSRVVEASDRLQRRVEELCQRVYSRGDSEPLSEAAQAHTRELGRENRRLQDLATQLQEKHHRISLEYSELQDKVTSAETKVLEMETTVEDLQWDIEKLRKREQKLNKHLAEALEQLNSGYYVSGSSSGFQGGQITLSMQKFEMLNAELEENQELANSRMAELEKLQAELQGAVRTNERLKVALRSLPEEVVRETGEYRMLQAQFSLLYNESLQVKTQLDEARGLLLATKNSHLRHIEHMESDELGLQKKLRTEVIQLEDTLAQVRKEYEMLRIEFEQNLAANEQAGPINREMRHLISSLQNHNHQLKGDAQRYKRKLREVQAEIGKLRAQASGSAHSTPNLGHPEDSGVSAPAPGKEEGGPGPVSTPDNRKEMAPVPGTTTTTTSVKKEELVPSEEDFQGITPGAQGPSSRGREPEARPKRELREREGPSLGPPPVASALSRADREKAKVEETKRKESELLKGLRAELKKAQESQKEMKLLLDMYKSAPKEQRDKVQLMAAERKAKAEVDELRSRIRELEERDRRESKKIADEDALRRIRQAEEQIEHLQRKLGATKQEEEALLSEMDVTGQAFEDMQEQNGRLLQQLREKDDANFKLMSERIKANQIHKLLREEKDELGEQVLGLKSQVDAQLLTVQKLEEKERALQGSLGGVEKELTLRSQALELNKRKAVEAAQLAEDLKVQLEHVQTRLREIQPCLAESRAAREKESFNLKRAQDISRLRRKLEKQRKVEVYADADEILQEEIKEYKARLTCPCCNTRKKDAVLTKCFHVFCFECVRGRYEARQRKCPKCNAAFGAHDFHRIYIS
"
     misc_feature    3650..3781
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="Zinc finger, C3HC4 type (RING finger); Region:
                     zf-C3HC4_2; pfam13923"
                     /db_xref="CDD:206094"
     misc_feature    3656..3787
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="RING-finger (Really Interesting New Gene) domain, a
                     specialized type of Zn-finger of 40 to 60 residues that
                     binds two atoms of zinc; defined by the 'cross-brace'
                     motif C-X2-C-X(9-39)-C-X(1-3)-
                     H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
                     in...; Region: RING; cd00162"
                     /db_xref="CDD:29102"
     misc_feature    order(3659..3661,3665..3667,3704..3706,3710..3712,
                     3719..3721,3728..3730,3764..3766,3773..3775)
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:29102"
     variation       866
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369284201"
     variation       895
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147367477"
     variation       907
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140084956"
     variation       925
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376522975"
     exon            953..1120
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       995
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370365187"
     variation       1039
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200779294"
     variation       1041
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201672722"
     variation       1106
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200908487"
     variation       1111
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373736477"
     exon            1121..1262
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1131
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143962429"
     variation       1141
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369988056"
     variation       1146
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150696859"
     variation       1182
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734395"
     variation       1186
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139969532"
     variation       1211
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149784534"
     variation       1249
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201302145"
     exon            1263..1469
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1276
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145704561"
     variation       1285
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141178194"
     variation       1300
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368256665"
     variation       1309
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368184098"
     variation       1370
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372421097"
     variation       1400
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370831334"
     variation       1401
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144298537"
     variation       1421
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370199075"
     variation       1431
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370463722"
     variation       1434
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200779544"
     variation       1436
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146569480"
     variation       1447
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140350331"
     variation       1455
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150302561"
     variation       1462
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142610348"
     exon            1470..1591
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1494
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373834012"
     variation       1501
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151018120"
     variation       1512
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186930335"
     variation       1525
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190164026"
     variation       1577
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146029900"
     variation       1578
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140880093"
     exon            1592..1738
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1601
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150097902"
     variation       1621
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138667885"
     variation       1624
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141073737"
     variation       1678
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146962748"
     variation       1689
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137974994"
     exon            1739..1813
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1784
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372843648"
     exon            1814..1933
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1821
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377699074"
     variation       1833
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368108030"
     variation       1848
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371218349"
     variation       1860..1861
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:368733858"
     variation       1861
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199925281"
     variation       1864
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374715678"
     variation       1866
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200311831"
     variation       1894
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368724386"
     variation       1903
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372294624"
     variation       1909
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376829087"
     variation       1913
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369472935"
     exon            1934..2113
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       1940
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148387316"
     variation       1944
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200109677"
     variation       1974
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201085414"
     variation       1975
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368897397"
     variation       1983
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202224486"
     variation       1985
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201147023"
     variation       1991
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141581063"
     variation       2002
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150892446"
     variation       2053
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139539933"
     variation       2057
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371891868"
     variation       2072
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377042428"
     variation       2101
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369667427"
     exon            2114..2249
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2115
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201408415"
     variation       2119
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148540364"
     variation       2138
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376887402"
     variation       2145
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146102570"
     variation       2172
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370050962"
     variation       2173
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200241748"
     variation       2181
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373531132"
     variation       2208
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11556801"
     exon            2250..2371
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2344
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140066306"
     variation       2370
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375382763"
     exon            2372..2799
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2376
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371336064"
     variation       2379
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375339639"
     variation       2437
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369888244"
     variation       2446
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149944221"
     variation       2450
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144994266"
     variation       2451
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145317847"
     variation       2455
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201945156"
     variation       2468
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142220777"
     variation       2495
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147842419"
     variation       2528
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373535706"
     variation       2570
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181567820"
     variation       2571
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376394465"
     variation       2593
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12448366"
     variation       2598
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138041260"
     variation       2624
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370636384"
     variation       2639
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372397361"
     variation       2663
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140772506"
     variation       2664
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7195142"
     variation       2676
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377015847"
     variation       2702
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200704225"
     variation       2707
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368718461"
     variation       2708
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371990879"
     variation       2710
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376313170"
     variation       2719
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11556800"
     variation       2727
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372740746"
     variation       2756
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375038841"
     variation       2758
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199751420"
     variation       2772
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369150602"
     variation       2787
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148854241"
     exon            2800..2917
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2821
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200021839"
     variation       2857
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138894221"
     variation       2901
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199511804"
     variation       2910
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373318017"
     exon            2918..3067
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       2930
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149396723"
     variation       2937
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368428563"
     variation       2943
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369928310"
     variation       2999
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200484566"
     variation       3011
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146398674"
     variation       3028
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201471588"
     exon            3068..3280
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3070
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369635997"
     variation       3148
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368729037"
     variation       3162
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76896762"
     variation       3199
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377035892"
     variation       3253
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369744162"
     variation       3254
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11556799"
     variation       3277
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201232201"
     exon            3281..3406
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3281
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34418731"
     variation       3289
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138471194"
     variation       3313
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4889506"
     variation       3343
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372670313"
     variation       3346
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142343572"
     variation       3370
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201957029"
     variation       3386
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368542250"
     exon            3407..3547
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3465
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140097440"
     exon            3548..3646
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3601
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61754473"
     variation       3610
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373316806"
     variation       3611
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201668303"
     exon            3647..6016
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /inference="alignment:Splign:1.39.8"
     variation       3648
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370853213"
     variation       3658
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199808715"
     variation       3662
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373895036"
     variation       3712
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375969920"
     variation       3731
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370299929"
     variation       3769..3770
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35083725"
     variation       3778
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373727066"
     variation       3781
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79828087"
     variation       3831
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367793448"
     variation       3834
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048622"
     variation       3838
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201807199"
     variation       3839
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35676536"
     variation       3855
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72793383"
     variation       3871
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369342812"
     variation       4062
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112016949"
     variation       4111
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147181313"
     variation       4203
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370917350"
     variation       4212
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11642862"
     variation       4528
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189434372"
     variation       4573
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:138074304"
     STS             4603..4724
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /standard_name="RH103172"
                     /db_xref="UniSTS:97505"
     variation       4768..4769
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace=""
                     /replace="ggggggg"
                     /db_xref="dbSNP:146030134"
     variation       4770
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201124775"
     variation       4774
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139144017"
     variation       4847
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143079612"
     variation       4852
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371727012"
     variation       4915
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181540872"
     variation       4933
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368844573"
     variation       5055
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185087026"
     variation       5098
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376360885"
     variation       5103
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11640414"
     variation       5116
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374375536"
     variation       5185
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190427175"
     variation       5280
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373487580"
     variation       5295
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376441594"
     variation       5315
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3747486"
     variation       5665
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139244585"
     variation       5728
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201312074"
     variation       5828
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76853104"
     variation       5849
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372130434"
     variation       5945
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150074195"
     variation       5946
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114343697"
     polyA_signal    5994..5999
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
     variation       5997
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181903935"
     variation       6014
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144385617"
     polyA_site      6016
                     /gene="RNF40"
                     /gene_synonym="BRE1B; RBP95; STARING"
ORIGIN      
acactcgcacgcgtccgcgcggccgacccatgcactgagctgcgatccttccccgcttcccgccgcagctcggagagatgttcaagctccgactgcaccctcattcccaaaaagtggctggtcttgcggttgagcatctcgccgctcttccgtgccgcgaggcgccccgggctcccgccgcctaggttccaggacagccagcgctcggtcggcggctaccaaggccgggcccgttcgcctcgctccggccaatctacgcgcggagaggcgcggcggggcgaatccgtgggggcgtctccctccgtctcaacggcgacggttgccaagggggcttgtgagggaaggaaggcggaaagcgcaggctcacgccagtgggagcgaagagaacgcgcagatacgtgagaagttgcgagtgcccacctgggcgccctctcttccaggttgctaatacgagggccggtgctgtcctccaggctgggaagtgggagcgcggtgtcagttactatgggaactgcctcttggccaatcaccgagagaaagaggaggtgtttgggaagaagccagaggacccgagtggcgggaccaagcgtaaccaatagaagcagaagataaagaagtttcctcacatccggggctgcctttggcgcctgcgccctgcgcaccgttggggggggggcagtggcgtccagtgacgcccagtgacgtccggtgaaatccaagatggcggcgctaggctgaccctcctgctggtgacggaagtaccgcctcctcccgtctgacgcccctcaggggaccctgcatcgctccagccgccgcggccatgtctgggccaggcaacaaacgcgccgccggcgacgggggctcagggcccccggaaaagaagctgagtcgtgaggagaagaccaccacgactcttatcgagcccattcgtcttggaggcatctcttccacggaggagatggacctgaaggtactacagttcaagaacaagaaactggcagagcggctggaacaacggcaggcttgtgaagatgaactccgagaacgaattgagaagttggagaagcggcaggccacagatgatgccacactcctcatcgtcaatcgctactgggcccagctggatgaaactgtggaagcccttctccgatgccatgagagccagggggagctgtcttcagcgcctgaggcacctgggacccaggaggggccaacatgtgatgggactcctctcccagagccggggacatcagagctgagagaccccttgctgatgcagctgcggccccctctcagtgagccggccttggcttttgtggtggcactgggtgccagcagcagtgaggaggtggagctggagctgcaaggccgaatggagttctccaaggcagctgtgtctcgtgtggtagaggcctcagaccgcctacagcgccgggtggaggaactctgtcagcgagtgtacagccgaggggacagtgagcccctcagtgaggcggctcaggcacacacccgagagctgggccgtgagaaccggcgactgcaggacttggccactcagctgcaggagaaacaccaccgcatctcattggagtactccgagctccaggataaagtgacatcggcagagaccaaggtgctggagatggagacaacagtggaggacttgcagtgggacatcgagaagctgcggaagcgagagcaaaagctcaataagcacctggcagaggccttagagcagcttaactctggctactatgtatctgggagctcctcaggcttccaggggggccagatcacactcagcatgcagaagtttgagatgctgaatgcagagttagaggaaaaccaggaactggccaacagccgtatggcagagctggagaaactgcaggccgaacttcagggggctgtgcggaccaatgagcgcctcaaggtggccctgcggagccttcctgaggaggtagtgcgggagacgggggagtaccgcatgctgcaggcccaattctcactgctctacaacgagtctctgcaagtgaagacccagctagacgaggctcggggcctgctgctggccacaaagaactcccacctgcgacacatcgagcacatggagagcgacgagctggggctgcagaagaagctacgcacagaggtcattcagctggaggacacgctggcccaggtacgcaaggagtatgagatgctgcgcatcgagtttgagcagaatctggcggccaacgagcaggcggggcccatcaaccgtgagatgcgccacctgattagtagtcttcaaaaccacaaccaccagctaaaaggggacgcccagcgatacaagcggaagcttcgagaagtacaagctgagattggcaagctccgggcccaggccagtggctctgcccactccacccccaacctgggccacccagaggattctggcgtcagtgccccagccccagggaaagaggagggtgggccaggccctgtcagtacccccgacaacagaaaggagatggctccagtgcctggcaccaccactactaccacttcagtgaagaaggaggagctggtcccctctgaagaggacttccagggtataacccctggggcccagggcccttcctcccggggccgagaacctgaggccaggcccaagcgggagcttcgggaacgggaaggtcccagcctaggacctccacctgtagcctccgctctctcaagggctgatcgggagaaggccaaggtggaagaaaccaagcggaaggaatcagaactcctcaagggtctccgagcagagctcaagaaggcccaggagagccagaaggagatgaaactgctgctggatatgtacaagtcagcgcccaaggagcagcgggataaggtgcagctcatggcagcggaacgcaaggctaaggccgaggttgatgagctgcggagccgcatccgggaattggaggagagggatcgaagggagagcaagaagatcgcggatgaggatgccctgcggcgcattcggcaggcagaggagcagatagaacacctgcagcgcaagctgggtgccaccaagcaggaggaggaggctctgctctcagagatggatgtgacaggtcaggcttttgaggacatgcaggaacagaacgggcggctgctacagcagttgcgggaaaaggatgatgccaactttaagctaatgtcagagcggatcaaggccaaccagattcacaagctgctgcgggaggagaaggatgagttgggcgagcaggtccttggcctcaagtcccaggtggatgcccagctgctgactgtgcagaagctggaggagaaggagcgagccttgcagggcagcctcgggggtgtggagaaggagctgacgctgcgcagccaagccctggagctcaacaagcggaaggctgtagaagccgcccagctggccgaggacctgaaggtgcagctggagcacgtgcagactcggctgcgggagatccagccctgcctggcagagagccgggctgctcgtgagaaagagagcttcaacctcaagagggctcaggacatctcacggctgcggcgcaagctggaaaagcagaggaaggtggaggtctacgcagatgccgacgaaatcctccaggaggagatcaaggagtacaaggcgcggttgacctgcccctgctgtaacacccgcaagaaggatgcagtccttaccaagtgcttccacgttttctgcttcgagtgcgtgcggggccgctatgaggcccgccagaggaagtgccccaagtgcaacgcggcctttggtgcccacgacttccatcgtatctacatcagctgaacctgaaactcaggggactctggaacaccatggaccctgggggctgtgcccccatctcctccccaccccaggtctagtggccccaccctccattccggaccccatgggcccagcccctgcccatctagttggtttggggaccctggtgcatgctagtgggcatgggatcagccaagcttcgttccatcttttcctaaaggtcagagctgcagcctagggggcactgccctacagaaaaggtctgcctgagaggcctgaggagcccagagcacttgactgagcttcccggaaactggccctaacctgtctgtctccgtggatgcatcctaaccctaaggaaaattccccaggctgtgatctaccctagagaaggctcgctccctgcctactggctcacaaatgaggaccagtgagccatgtccttgttccttgtttgagactgggctgcaggccccaggaagactttccttcacccaccatccccctaacctcggcagggcttctgtcctgtggagttccctggacaccttggtctggctcttgtgccaagggctgaaggaggtaccctcttggcagatgggggcatcacttgcttcctttgggaagctctaaggttgctgcagtcaccttcctcatcttgcaggtgctgaaccaacatcatcagtttctattctaatcaggccccttcccaatctccatttctctgccaagcccatttacccccacctcatgcatcccaaggctctactgggtccctggacctaaccctgctttcatcctggtggccttaactacagtggaggtggaacttcccaggaggggaagggacagaccagccccagccgctgggccaacttccaatcattccagctagaagagcttccccctgacaccctgtgactgagcctgtgtcctgtctgcctgcccagccatgctccatcggctgtgagggcagtgcccggagaggccagagggttggagctgcagggacccgtttggacccacagcctctgttctagagatgcttgtataggctgttaattgtgatgaataaacgttcaaccctcggcctgcagccagagtagccaggccgcgcaccccaaatgtagtcccccgattttagctgcagcagctgagcagcactttgctggcttggtgtgagcctgggagggctcagacttaacggccggcagggatcccggactgggcctgaaggggagagcgtggtggtcgtcgcggagccgcctgtcctgctcccaccgaccccggtctgaccacgtccttggctgtcatggccgggggatgccgggactcctcgggctgcatcctgggaagtgtagttcctggtccgcacatggttaggaggttctcggagagagagctagtttcccggttgcgctggccaaaggccggcctgaactggatcctgcggaccgcttctcagcggcttcacccccacaccactcgaatgcacagatcgggacacctcagctgggtgacttccctcgttgcaatcggcctcgggagcggtgcggcgtgtaccgagcggcgcccctgggctcagcgcgctgcaggcgccccgggcggatccttcaccgaggcaggactggggctggcgccagagccggtgcggagcggtgttggttcaggcgctggcgacagtgctatggccacggcaggggccgcgtgcgtctcagcggtggcgccttcggaccctattggcgcccgggacttaagcggggccgccgctgctggaccaggacgaactggagaaggagacgcgggccgccacggtgacctcgggcgtagggccggcggcggcgggcacgctggtggaagcgcgggccgcggcaggggaggacatcgggccgcagagaaagtgccgatggcctggggcagcggtgcgagggtgggaaaaacgcaggatattgcatcatagagacgcggccaccttcgcccctggagagcgccagtctcaggagcgccgcaccggtcacgggtggaggtcagccaggcctccgtaagcgcggtccccttccaggagtagccttcgcctgggctcttgagtagatgccaagtaattccgcatcgtctctctagatatctgcgctaaaggccacccggtctccttatcagaggggcaaaactctcctcgtgggtcttcatacctaataaaagtcggcatcaaaccacaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9810 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IDA
            GeneID:9810 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9810 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0017075 [syntaxin-1 binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI
            GeneID:9810 -> Molecular function: GO:0032403 [protein complex binding] evidence: IEA
            GeneID:9810 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:9810 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: ISS
            GeneID:9810 -> Biological process: GO:0010390 [histone monoubiquitination] evidence: IDA
            GeneID:9810 -> Biological process: GO:0033523 [histone H2B ubiquitination] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0000151 [ubiquitin ligase complex] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0033503 [HULC complex] evidence: IDA
            GeneID:9810 -> Cellular component: GO:0043005 [neuron projection] evidence: ISS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001193962 -> EC 6.3.2.-

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.