GGRNA Home | Help | Advanced search

2019-03-23 04:05:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001206653            6240 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1),
            transcript variant 4, mRNA.
ACCESSION   NM_001206653
VERSION     NM_001206653.1  GI:331284173
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6240)
  AUTHORS   Runkle,K.B., Meyerkord,C.L., Desai,N.V., Takahashi,Y. and Wang,H.G.
  TITLE     Bif-1 suppresses breast cancer cell migration by promoting EGFR
            endocytic degradation
  JOURNAL   Cancer Biol. Ther. 13 (10), 956-966 (2012)
   PUBMED   22785202
  REMARK    GeneRIF: these data suggest a novel function for Bif-1 as a
            suppressor of breast cancer cell migration by promoting EGFR
            degradation through the regulation of endosome maturation
REFERENCE   2  (bases 1 to 6240)
  AUTHORS   Coppola,D., Helm,J., Ghayouri,M., Malafa,M.P. and Wang,H.G.
  TITLE     Down-regulation of Bax-interacting factor 1 in human pancreatic
            ductal adenocarcinoma
  JOURNAL   Pancreas 40 (3), 433-437 (2011)
   PUBMED   21283040
  REMARK    GeneRIF: The expression of Bif-1 is downregulated in a subset of
            pancreatic ductal adenocarcinoma. This novel finding is in
            agreement with the tumor suppressor function of Bif-1.
REFERENCE   3  (bases 1 to 6240)
  AUTHORS   Takahashi,Y., Meyerkord,C.L., Hori,T., Runkle,K., Fox,T.E.,
            Kester,M., Loughran,T.P. and Wang,H.G.
  TITLE     Bif-1 regulates Atg9 trafficking by mediating the fission of Golgi
            membranes during autophagy
  JOURNAL   Autophagy 7 (1), 61-73 (2011)
   PUBMED   21068542
  REMARK    GeneRIF: These findings suggest that Bif-1 acts as a critical
            regulator of Atg9 puncta formation presumably by mediating Golgi
            fission for autophagosome biogenesis during starvation.
REFERENCE   4  (bases 1 to 6240)
  AUTHORS   Thoresen,S.B., Pedersen,N.M., Liestol,K. and Stenmark,H.
  TITLE     A phosphatidylinositol 3-kinase class III sub-complex containing
            VPS15, VPS34, Beclin 1, UVRAG and BIF-1 regulates cytokinesis and
            degradative endocytic traffic
  JOURNAL   Exp. Cell Res. 316 (20), 3368-3378 (2010)
   PUBMED   20643123
  REMARK    GeneRIF: SH3GLB1
REFERENCE   5  (bases 1 to 6240)
  AUTHORS   Karbowski,M., Jeong,S.Y. and Youle,R.J.
  TITLE     Endophilin B1 is required for the maintenance of mitochondrial
            morphology
  JOURNAL   J. Cell Biol. 166 (7), 1027-1039 (2004)
   PUBMED   15452144
  REMARK    GeneRIF: Double knockdown of endophilin B1 and Drp1 leads to a
            mitochondrial phenotype identical to that of the Drp1 single
            knockdown, a result consistent with Drp1 acting upstream of
            endophilin B1 in the maintenance of morphological dynamics of
            mitochondria.
REFERENCE   6  (bases 1 to 6240)
  AUTHORS   Lee,S.Y., Wenk,M.R., Kim,Y., Nairn,A.C. and De Camilli,P.
  TITLE     Regulation of synaptojanin 1 by cyclin-dependent kinase 5 at
            synapses
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (2), 546-551 (2004)
   PUBMED   14704270
REFERENCE   7  (bases 1 to 6240)
  AUTHORS   Modregger,J., Schmidt,A.A., Ritter,B., Huttner,W.B. and Plomann,M.
  TITLE     Characterization of Endophilin B1b, a brain-specific
            membrane-associated lysophosphatidic acid acyl transferase with
            properties distinct from endophilin A1
  JOURNAL   J. Biol. Chem. 278 (6), 4160-4167 (2003)
   PUBMED   12456676
REFERENCE   8  (bases 1 to 6240)
  AUTHORS   Cuddeback,S.M., Yamaguchi,H., Komatsu,K., Miyashita,T., Yamada,M.,
            Wu,C., Singh,S. and Wang,H.G.
  TITLE     Molecular cloning and characterization of Bif-1. A novel Src
            homology 3 domain-containing protein that associates with Bax
  JOURNAL   J. Biol. Chem. 276 (23), 20559-20565 (2001)
   PUBMED   11259440
REFERENCE   9  (bases 1 to 6240)
  AUTHORS   Pierrat,B., Simonen,M., Cueto,M., Mestan,J., Ferrigno,P. and
            Heim,J.
  TITLE     SH3GLB, a new endophilin-related protein family featuring an SH3
            domain
  JOURNAL   Genomics 71 (2), 222-234 (2001)
   PUBMED   11161816
REFERENCE   10 (bases 1 to 6240)
  AUTHORS   Howard,L., Nelson,K.K., Maciewicz,R.A. and Blobel,C.P.
  TITLE     Interaction of the metalloprotease disintegrins MDC9 and MDC15 with
            two SH3 domain-containing proteins, endophilin I and SH3PX1
  JOURNAL   J. Biol. Chem. 274 (44), 31693-31699 (1999)
   PUBMED   10531379
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB038227.1, AK303710.1,
            AL049597.29 and AI936794.1.
            
            Summary: This gene encodes a SRC homology 3 domain-containing
            protein. The encoded protein interacts with the proapoptotic member
            of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be
            involved in regulating apoptotic signaling pathways. This protein
            may also be involved in maintaining mitochondrial morphology.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Sep 2011].
            
            Transcript Variant: This variant (4) lacks an exon in the 5'
            region, resulting in a downstream AUG start codon, compared to
            variant 1. The resulting isoform (4) has a shorter N-terminus,
            compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK303710.1, AL531689.3 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-47                DB038227.1         1-47
            48-1439             AK303710.1         1-1392
            1440-5730           AL049597.29        60580-64870         c
            5731-6240           AI936794.1         1-510               c
FEATURES             Location/Qualifiers
     source          1..6240
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p22"
     gene            1..6240
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="SH3-domain GRB2-like endophilin B1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="MIM:609287"
     exon            1..402
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       59
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370826328"
     variation       122
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375428554"
     variation       165
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58494650"
     variation       241
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:263438"
     variation       259
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11544892"
     variation       262
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369632914"
     variation       312
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373829970"
     misc_feature    327..329
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="upstream in-frame stop codon"
     variation       341
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199927597"
     variation       354
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150324653"
     exon            403..531
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       403
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201622706"
     variation       460
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143094715"
     variation       463
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142378035"
     variation       484
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369336536"
     variation       487
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139332321"
     CDS             489..1286
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="isoform 4 is encoded by transcript variant 4;
                     Bax-interacting factor 1; SH3-containing protein SH3GLB1;
                     SH3 domain-containing GRB2-like protein B1; protein
                     phosphatase 1, regulatory subunit 70"
                     /codon_start=1
                     /product="endophilin-B1 isoform 4"
                     /protein_id="NP_001193582.1"
                     /db_xref="GI:331284174"
                     /db_xref="CCDS:CCDS55613.1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="MIM:609287"
                     /translation="
MIDAGTEFGPGTAYGNALIKCGETQKRIGTADRELIQTSALNFLTPLRNFIEGDYKTIAKERKLLQNKRLDLDAAKTRLKKAKAAETRNSSEQELRITQSEFDRQAEITRLLLEGISSTHAHHLRCLNDFVEAQMTYYAQCYQYMLDLQKQLGSFPSNYLSNNNQTSVTPVPSVLPNAIGSSAMASTSGLVITSPSNLSDLKECSGSRKARVLYDYDAANSTELSLLADEVITVFSVVGMDSDWLMGERGNQKGKVPITYLELLN
"
     misc_feature    <489..944
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="The Bin/Amphiphysin/Rvs (BAR) domain, a
                     dimerization module that binds membranes and detects
                     membrane curvature; Region: BAR; cl12013"
                     /db_xref="CDD:209413"
     misc_feature    order(489..491,495..500,507..509,549..551,558..563,
                     828..830,837..842,846..848,858..860,867..872,876..881,
                     888..893,900..905,909..914,921..926,930..935)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:153271"
     misc_feature    <492..950
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="BAR domain; Region: BAR; smart00721"
                     /db_xref="CDD:128960"
     misc_feature    1101..1283
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="Src homology 3 domain of Endophilin-B1; Region:
                     SH3_Endophilin_B1; cd11945"
                     /db_xref="CDD:212878"
     misc_feature    order(1128..1130,1134..1136,1143..1145,1155..1157,
                     1215..1220,1257..1259,1263..1268)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212878"
     variation       505
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12035024"
     exon            532..665
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       533
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371476786"
     variation       558
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150243965"
     variation       597
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112687194"
     variation       660
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150004536"
     variation       663
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202154654"
     variation       664
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144540011"
     exon            666..758
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       679
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371893206"
     variation       681
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376780189"
     variation       706
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201518937"
     variation       710
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34037709"
     variation       749
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140791791"
     exon            759..848
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200907097"
     variation       799
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370892729"
     variation       844
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375726643"
     exon            849..949
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       881
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367856961"
     exon            950..1178
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       959
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568763"
     variation       968
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368697600"
     variation       969
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898007"
     variation       992
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371821126"
     variation       1004
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199954740"
     variation       1129
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138533867"
     variation       1151
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143210569"
     variation       1159
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113079556"
     exon            1179..6235
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     STS             1182..1313
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D1S3283"
                     /db_xref="UniSTS:73729"
     variation       1247
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369315549"
     variation       1291
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200149176"
     variation       1294
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371139653"
     variation       1321
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7805"
     variation       1351
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182277538"
     variation       1399
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186477456"
     variation       1405
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372453155"
     variation       1413
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192547923"
     variation       1428
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115786910"
     variation       1446
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118078895"
     variation       1602
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055807"
     polyA_signal    1618..1623
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      1640
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     variation       1872..1873
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369144718"
     variation       1993
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146178664"
     variation       2026
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:263476"
     variation       2092..2093
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:148528174"
     variation       2102
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370236588"
     variation       2123
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74635891"
     variation       2124
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184671274"
     variation       2129
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115686750"
     variation       2161
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80179040"
     variation       2179
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190177169"
     variation       2185
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139775213"
     variation       2194
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193068181"
     variation       2225
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17129455"
     variation       2250
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:372495516"
     variation       2261
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116809966"
     variation       2318
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370921223"
     variation       2382
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71660692"
     variation       2508
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74097437"
     variation       2517
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114006993"
     variation       2569
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148772273"
     variation       2634
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189926701"
     variation       2658
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181084322"
     variation       2741
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142377175"
     variation       2743
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6693019"
     variation       2892..2894
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="ttc"
                     /db_xref="dbSNP:374106896"
     variation       2923
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185347963"
     variation       2945
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151286456"
     variation       3102
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375815130"
     variation       3117
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287733"
     variation       3133
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140493017"
     variation       3202
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188250289"
     variation       3258
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182063957"
     variation       3300
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187273072"
     variation       3311
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191719770"
     variation       3569..3570
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34167887"
     variation       3595
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147045004"
     variation       3664
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183730198"
     variation       3697..3698
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:36110352"
     variation       3787
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:41287735"
     variation       3984
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147661424"
     variation       4057
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186643470"
     variation       4137
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190126132"
     variation       4140..4141
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201785649"
     variation       4191
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372613370"
     variation       4296
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182401439"
     variation       4308
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10489890"
     variation       4384
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369595750"
     variation       4399
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74851582"
     variation       4468
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112702619"
     variation       4482
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72961649"
     variation       4509
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186807942"
     variation       4616
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287737"
     STS             4712..4839
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D15S1477"
                     /db_xref="UniSTS:474482"
     variation       4822
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189701711"
     variation       4890
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142324982"
     variation       4981
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113438342"
     variation       4985
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147012806"
     variation       5021
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184011272"
     variation       5302
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376906"
     variation       5346
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188996159"
     variation       5350
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113225472"
     variation       5367
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10446"
     STS             5392..5502
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="SHGC-75080"
                     /db_xref="UniSTS:44451"
     variation       5447
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138062316"
     variation       5512
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74632026"
     variation       5550
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11293484"
     variation       5550
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75427542"
     variation       5551
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79757555"
     variation       5552
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112330637"
     variation       5552
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201436487"
     variation       5692
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74097438"
     variation       5745
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149522642"
     variation       5780
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201221938"
     variation       5845
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7523137"
     variation       5929
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11544893"
     variation       5983
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193042715"
     variation       6045
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371895650"
     variation       6087
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143128170"
     variation       6089
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185293609"
     variation       6119..6123
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tatat"
                     /db_xref="dbSNP:71789713"
     variation       6170..6174
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="atttt"
                     /db_xref="dbSNP:141790894"
     variation       6196
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35844916"
     variation       6212..6213
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:373436380"
     polyA_signal    6215..6220
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      6235
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
ORIGIN      
gcgcttgtttttcccttgggacccgggtccacacggcggggtcgcccgtccatctccggctcgcccgcggggcccatcgtcgacgttagcggccgttctccgagccgactgacccatccttggcgctgccgccgcgcgcttgttctcctccctcgccccgccttcatcctccccgttcacggaaacgacagctgcggctgcggggctggcgccgcctccctccacctaccacgtctgccctcgccgctctagccctgcgccccagcccggccgcggcacctccgcctcgccgccgctaggtcggccggctccgcccggctgccgcctaggatgaatatcatggacttcaacgtgaagaagctggcggccgacgcaggcaccttcctcagtcgcgccgtgcagatgccaggatagaagaatttgtttatgagaaactggatagaaaagctccaagtcgtataaacaacccagaacttttgggacaatatatgattgatgcagggactgagtttggcccaggaacagcttatggtaatgcccttattaaatgtggagaaacccaaaaaagaattggaacagcagacagagaactgattcaaacgtcagccttaaattttcttactcctttaagaaactttatagaaggagattacaaaacaattgctaaagaaaggaaactattgcaaaataagagactggatttggatgctgcaaaaacgagactaaaaaaggcaaaagctgcagaaactagaaattcatctgaacaggaattaagaataactcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaatcagcagtacacatgcccatcaccttcgctgtctgaatgactttgtagaagcccagatgacttactatgcacagtgttaccagtatatgttggacctccagaaacaactgggaagttttccatccaattatcttagtaacaacaatcagacttctgtgacacctgtaccatcagttttaccaaatgcgattggttcttctgccatggcttcaacaagtggcctagtaatcacctctccttccaacctcagtgaccttaaggagtgtagtggcagcagaaaggccagggttctctatgattatgatgcagcaaacagtactgaattatcacttctggcagatgaggtgatcactgtgttcagtgttgttggaatggattcagactggctaatgggggaaaggggaaaccagaagggcaaggtgccaattacctacttagaactgctcaattaagtaggtggactatggaaaggttgcccatcatgactttgtatttatatacaattaactctaaataaagcaggttaagtatcttccatgttaatgtgttaagagactgaaaataccagccatcagaaactggcctttctgccaataaagttgcatggtaaatatttcattacagaatttatgttagagctttcatgccaagaatgttttcttacaaaattctctttttattgaggtttcactaataagcagcttctacttttgagcctcaacttaaagcagaactgttttctactggatttttcattaacagcaagctttttcttttatgtaaaataaatctattgtgaattgatatcagcgactcatttattaggtataaataatagccaaagaataaaattaaaatttattttaaactttcggtcttaaaaagagctgtaggatataaacctcttttgtgaaaagtagaattttctgaatgctttcatagacaaaaacgcatttaaactatgtttacctggttttccaacagaaatcaaatgattttaatattatgttttgatgggttattttcagagttgtttggttttttaaacactactgaatggtttcttttaaatttaagaacaactagttcttgaaaagcaataccgtatttctctgataaatttgtagttaaggttctagaaaatctaggacaaatttacttcattaaacataaagtttttaagattattcagttggcacaatttaatgcataattgggattggatccatttactgtactgtggtacagtaaagagaatgtgttcttattgaacagcagatttgtatacaaatacggaataatgcaactacattataaattgtatacgaacaaaataaattgggtcactctgagcttactattaaaacattgaaaatttattaatgaacacaggctatcttgatgaggatctctgcttatgaaacacatactaatgaaattattagtgacacattggaagctagaaaattgctgttggggccattgctataaatcattgtttccatgttaagacttctgttctaattcattcattcaacaaacatttgttgagggccagatactgtgctggtcaactggggatactgtcctgaacaatatgcacacagttcttgcccctgcagagcttaaagaccattaaaggatacagaaaattaagcaattatcctatagtaggattcgtggtgtgatggggaaaatacaaggtactgtatttgggagtcatgtaactccagttttgggagtgagagagggtctggggaagaactgttccagataaaaagatgtgtaaccaagatagcatagcacattctgacaactaaagcaatttactctaacttaagcatgaagtacaaaagtatagttcatttattgagggaatgttaagctattaaaatgatactttttggtacttttaaaaaaatgaatacttaaacaccgttttaaaattttgtgttaagagctcctaataagaacttggtaaacatgttgacaatttaactcacagtctaaactttaaaagtagtagttacccttttatttctgtgccatgagacaaattcttctgcagttttatagttgtacaagatgttttgactcactctcaattgccatattcttaaagaaaccctgaaaagctgctcaagctggtcagttttctgtaaaaccaagtaaatgaaattttctctcccctcagaaaggaagttctacagcctagagtaccatctattgtgttttataagtccagatttaggctttgaaagatcataccaaaacttcagatcgacttaaacagcaactatgaattaggtttatgggaaatgtagtaatacaggggaaagaatatcggtaatggagtgaaatggtcctgggttcaaatccagtcttcctcacatattgtgctctttaagcttcaaatgagatgtataactgccttttccttaccagtaaaatgaggacaataattatgacaccatagggtggttgtgaggattagcaaatgttatcttgtatttcaggtgcctttcagggaaaggcttggcacatagtaaacacatcctgtaaatatcagtttccccttgttagcccctgtagcatcctgacctaccaagtctataggccttgcatatcactgtgcaccagagatacctcttttacatctgggctctgttttctctctatcaatcctatcctccaccctctttaaatcagaccccaggtttaaccttcccacagtcagtataaatcatttttcagaactttcagctttccatcaagtgaaagttgattttagttacccagtaatgtacagaaaccttcaataatgttaagcttcaaaggcttctggtacgtttgtctaccacagaaccaccacaatatatatgcttgttcttaggtttattgctttttattttaatggggtttggttgtttgggttttattttggttttggcttattttaaagtcaagtttagtttttactcaggtaaaggcctgaagtttcttgggcgtggaagaaaaagcttgggaagcctattaattcatggtgcagttcagaattgtttaaataagctctgtgccactgagcttaatctgaaagtatagtgacatgtgaaggatgcacatatgaatgaaaaactaaaataattgtaggctcttctataaatgaaaaaaaaagtgattggattgtgtctacctttttcctcaaagtaatctaacctaaacggtcatggtgttaaaactttttatggtgctaatcagaaaaattgatgttgcaagaaatgaggtctcaaaaatgggaatgtgcctcctcactctgcgtcacatgggaaataaatcctgaggccaggatcaccagtggggtagagtcatcttcatagtctcctgttatcctccccctgaacaaagaacaaagtgagactgggaagctagtgttggggaaacatttctgggataaactgtggagtggagaagacaatggagggcaaggcaaaaacccacagacttgtttacccatagaggccccactcacctccatgctgacagaattccagaaaaattccttccctatctcccaaacacctgaaattctgaaatattgccctactatttagcactttaagcttcagtgaggtgctgtaatggagagatagcttcatagtttagcctatagccaactttgcctcaagacctccagataagatgaagtggcttttacctcatgtgagtctcaaacgctggagagagagttccacaaccacccctgccctttctcccatattacgctcattagaaagtctactcagggctgggtgccgtggctcatgcctgtaatcccagcactttggaggctgaggcgggtggatcatctgaggtcaggagttcgagaccagcctggccaacatggggaaaccctgtctctactgaaaatataaaaattagccgggcatggtggcgtgcacctgtaattccagctactcgggaggctgaggcaggagaatcacttgaaccccagaggcagaggctacagtgagccaagattgcaccactgcactccaacctgggtgatagaataagactcttgtctcaaggaaagaaaaaatgtctactcagtagagcagtgattggcaaagtgtgagaccccagaccggcaatattggcatctcctggagacttgtttaaaatgctgattactattttcaagaactttctaccttcatttttacttattttttgttttcaagggctcatggaatcagtcttccatgtgacagctttttaaatattttaagacaaaaactgagtcttctaatcttaattgtgttctagcagtagtcattgtaattatagttatttttataatttatttgtttagtgtatatctgtcactctagaatgtaggctccctgagataaaaactataattcttttgatggcagttacattcccaactcttagcacaagatctaggacatagtatgaactcaataaatttttgttgaatgaaagaaaaatgcaaatttataagccttttcagagacctactgaatcaaactctgagagtggagcccagcaatctgttgtaaaagctgtttgagtaatactgttgcactctaagcttgagaaccactgcaatagaactaagagaacattcatttcaccttcaggcctattctctgacatcacttgaaaaatcctctctgccttctgtaacccttaaccaacaacagtgccctgtccatgtaggggaaacttctgggctgtattacaagtgggtaggaaggtataaggatatcatagtgggaagtattgcttagaatgccagtacttgtttgctgtggaaggtttctaggaatggattgcttagtctaaagtaagcactaccaccatccacgttttcactcaacacagtgccttttaattggtgactaacatcaaaacaccttgacaaaccgttaaaacagtatcagaaaccatgtgtacatccctgtgcctcttagattgctaagttctgctctcattcttacttcaaaggacactttttaaagaattgttaatgcttttttataatacaagtcatagccctgttggcaaaaagaaaaaagattcagtgagaaagaaaaatcactgataattccatcatccagggagaaccactgttatttaagtatatggccttccagacttttctgtgcatttatagatatttttaatgggatcaaagtgtacatactgttttgtaactttttttcactcaacaataccatgactgtcttgctgtgtcaagtatatttctacatctcttaatggctgcatgatattccatcatatgtgccacattttattaaactactgttcaatttttaggtttccaactttcattaataaagtgctttaaagaacaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51100 -> Molecular function: GO:0005504 [fatty acid binding] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042171 [lysophosphatidic acid acyltransferase activity] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:51100 -> Biological process: GO:0006654 [phosphatidic acid biosynthetic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:0051084 ['de novo' posttranslational protein folding] evidence: IEA
            GeneID:51100 -> Biological process: GO:0051259 [protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:1900740 [positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:51100 -> Cellular component: GO:0005741 [mitochondrial outer membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0043234 [protein complex] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.