GGRNA Home | Help | Advanced search

2019-03-25 15:10:25, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001206652            6445 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1),
            transcript variant 3, mRNA.
ACCESSION   NM_001206652
VERSION     NM_001206652.1  GI:331284171
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6445)
  AUTHORS   Runkle,K.B., Meyerkord,C.L., Desai,N.V., Takahashi,Y. and Wang,H.G.
  TITLE     Bif-1 suppresses breast cancer cell migration by promoting EGFR
            endocytic degradation
  JOURNAL   Cancer Biol. Ther. 13 (10), 956-966 (2012)
   PUBMED   22785202
  REMARK    GeneRIF: these data suggest a novel function for Bif-1 as a
            suppressor of breast cancer cell migration by promoting EGFR
            degradation through the regulation of endosome maturation
REFERENCE   2  (bases 1 to 6445)
  AUTHORS   Coppola,D., Helm,J., Ghayouri,M., Malafa,M.P. and Wang,H.G.
  TITLE     Down-regulation of Bax-interacting factor 1 in human pancreatic
            ductal adenocarcinoma
  JOURNAL   Pancreas 40 (3), 433-437 (2011)
   PUBMED   21283040
  REMARK    GeneRIF: The expression of Bif-1 is downregulated in a subset of
            pancreatic ductal adenocarcinoma. This novel finding is in
            agreement with the tumor suppressor function of Bif-1.
REFERENCE   3  (bases 1 to 6445)
  AUTHORS   Takahashi,Y., Meyerkord,C.L., Hori,T., Runkle,K., Fox,T.E.,
            Kester,M., Loughran,T.P. and Wang,H.G.
  TITLE     Bif-1 regulates Atg9 trafficking by mediating the fission of Golgi
            membranes during autophagy
  JOURNAL   Autophagy 7 (1), 61-73 (2011)
   PUBMED   21068542
  REMARK    GeneRIF: These findings suggest that Bif-1 acts as a critical
            regulator of Atg9 puncta formation presumably by mediating Golgi
            fission for autophagosome biogenesis during starvation.
REFERENCE   4  (bases 1 to 6445)
  AUTHORS   Thoresen,S.B., Pedersen,N.M., Liestol,K. and Stenmark,H.
  TITLE     A phosphatidylinositol 3-kinase class III sub-complex containing
            VPS15, VPS34, Beclin 1, UVRAG and BIF-1 regulates cytokinesis and
            degradative endocytic traffic
  JOURNAL   Exp. Cell Res. 316 (20), 3368-3378 (2010)
   PUBMED   20643123
  REMARK    GeneRIF: SH3GLB1
REFERENCE   5  (bases 1 to 6445)
  AUTHORS   Karbowski,M., Jeong,S.Y. and Youle,R.J.
  TITLE     Endophilin B1 is required for the maintenance of mitochondrial
            morphology
  JOURNAL   J. Cell Biol. 166 (7), 1027-1039 (2004)
   PUBMED   15452144
  REMARK    GeneRIF: Double knockdown of endophilin B1 and Drp1 leads to a
            mitochondrial phenotype identical to that of the Drp1 single
            knockdown, a result consistent with Drp1 acting upstream of
            endophilin B1 in the maintenance of morphological dynamics of
            mitochondria.
REFERENCE   6  (bases 1 to 6445)
  AUTHORS   Lee,S.Y., Wenk,M.R., Kim,Y., Nairn,A.C. and De Camilli,P.
  TITLE     Regulation of synaptojanin 1 by cyclin-dependent kinase 5 at
            synapses
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (2), 546-551 (2004)
   PUBMED   14704270
REFERENCE   7  (bases 1 to 6445)
  AUTHORS   Modregger,J., Schmidt,A.A., Ritter,B., Huttner,W.B. and Plomann,M.
  TITLE     Characterization of Endophilin B1b, a brain-specific
            membrane-associated lysophosphatidic acid acyl transferase with
            properties distinct from endophilin A1
  JOURNAL   J. Biol. Chem. 278 (6), 4160-4167 (2003)
   PUBMED   12456676
REFERENCE   8  (bases 1 to 6445)
  AUTHORS   Cuddeback,S.M., Yamaguchi,H., Komatsu,K., Miyashita,T., Yamada,M.,
            Wu,C., Singh,S. and Wang,H.G.
  TITLE     Molecular cloning and characterization of Bif-1. A novel Src
            homology 3 domain-containing protein that associates with Bax
  JOURNAL   J. Biol. Chem. 276 (23), 20559-20565 (2001)
   PUBMED   11259440
REFERENCE   9  (bases 1 to 6445)
  AUTHORS   Pierrat,B., Simonen,M., Cueto,M., Mestan,J., Ferrigno,P. and
            Heim,J.
  TITLE     SH3GLB, a new endophilin-related protein family featuring an SH3
            domain
  JOURNAL   Genomics 71 (2), 222-234 (2001)
   PUBMED   11161816
REFERENCE   10 (bases 1 to 6445)
  AUTHORS   Howard,L., Nelson,K.K., Maciewicz,R.A. and Blobel,C.P.
  TITLE     Interaction of the metalloprotease disintegrins MDC9 and MDC15 with
            two SH3 domain-containing proteins, endophilin I and SH3PX1
  JOURNAL   J. Biol. Chem. 274 (44), 31693-31699 (1999)
   PUBMED   10531379
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB038227.1, AF263293.1,
            AF350371.1, AL049597.29 and AI936794.1.
            This sequence is a reference standard in the RefSeqGene project.
            
            Summary: This gene encodes a SRC homology 3 domain-containing
            protein. The encoded protein interacts with the proapoptotic member
            of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be
            involved in regulating apoptotic signaling pathways. This protein
            may also be involved in maintaining mitochondrial morphology.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Sep 2011].
            
            Transcript Variant: This variant (3) has two additional in-frame
            exons in the CDS, compared to variant 1. The resulting isoform (3)
            has an additional segment, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF263293.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-325               DB038227.1         1-325
            326-1286            AF263293.1         1-961
            1287-1842           AF350371.1         975-1530
            1843-5935           AL049597.29        60580-64672         c
            5936-6445           AI936794.1         1-510               c
FEATURES             Location/Qualifiers
     source          1..6445
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p22"
     gene            1..6445
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="SH3-domain GRB2-like endophilin B1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="MIM:609287"
     exon            1..402
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       59
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370826328"
     variation       122
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375428554"
     variation       165
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58494650"
     variation       241
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:263438"
     misc_feature    250..252
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="upstream in-frame stop codon"
     variation       259
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11544892"
     variation       262
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369632914"
     variation       312
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373829970"
     CDS             331..1491
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="isoform 3 is encoded by transcript variant 3;
                     Bax-interacting factor 1; SH3-containing protein SH3GLB1;
                     SH3 domain-containing GRB2-like protein B1; protein
                     phosphatase 1, regulatory subunit 70"
                     /codon_start=1
                     /product="endophilin-B1 isoform 3"
                     /protein_id="NP_001193581.1"
                     /db_xref="GI:331284172"
                     /db_xref="CCDS:CCDS55612.1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="MIM:609287"
                     /translation="
MNIMDFNVKKLAADAGTFLSRAVQFTEEKLGQAEKTELDAHLENLLSKAECTKIWTEKIMKQTEVLLQPNPNARIEEFVYEKLDRKAPSRINNPELLGQYMIDAGTEFGPGTAYGNALIKCGETQKRIGTADRELIQTSALNFLTPLRNFIEGDYKTIAKERKLLQNKRLDLDAAKTRLKKAKAAETRNSQLNSARLEGDNIMIWAEEVTKSEQELRITQSEFDRQAEITRLLLEGISSTHAHHLRCLNDFVEAQMTYYAQCYQYMLDLQKQLGSFPSNYLSNNNQTSVTPVPSVLPNAIGSSAMASTSGLVITSPSNLSDLKECSGSRKARVLYDYDAANSTELSLLADEVITVFSVVGMDSDWLMGERGNQKGKVPITYLELLN
"
     misc_feature    385..1155
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="BAR domain; Region: BAR; smart00721"
                     /db_xref="CDD:128960"
     misc_feature    400..1149
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="The Bin/Amphiphysin/Rvs (BAR) domain, a
                     dimerization module that binds membranes and detects
                     membrane curvature; Region: BAR; cl12013"
                     /db_xref="CDD:209413"
     misc_feature    order(472..474,481..486,496..498,502..507,514..519,
                     523..528,607..612,616..621,628..633,637..642,649..651,
                     691..693,700..705,1033..1035,1042..1047,1051..1053,
                     1063..1065,1072..1077,1081..1086,1093..1098,1105..1110,
                     1114..1119,1126..1131,1135..1140)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:153271"
     misc_feature    1306..1488
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="Src homology 3 domain of Endophilin-B1; Region:
                     SH3_Endophilin_B1; cd11945"
                     /db_xref="CDD:212878"
     misc_feature    order(1333..1335,1339..1341,1348..1350,1360..1362,
                     1420..1425,1462..1464,1468..1473)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212878"
     variation       341
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199927597"
     variation       354
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150324653"
     exon            403..544
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       420
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199985974"
     variation       465
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137962528"
     variation       470
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369632434"
     exon            545..673
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       545
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201622706"
     variation       602
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143094715"
     variation       605
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142378035"
     variation       626
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369336536"
     variation       629
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139332321"
     variation       647
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12035024"
     exon            674..807
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       675
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371476786"
     variation       700
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150243965"
     variation       739
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112687194"
     variation       802
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150004536"
     variation       805
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202154654"
     variation       806
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144540011"
     exon            808..900
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       821
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371893206"
     variation       823
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376780189"
     variation       848
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201518937"
     variation       852
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34037709"
     variation       891
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140791791"
     exon            901..939
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       916
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201765629"
     exon            940..963
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     exon            964..1053
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       972
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200907097"
     variation       1004
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370892729"
     variation       1049
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375726643"
     exon            1054..1154
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       1086
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367856961"
     exon            1155..1383
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       1164
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568763"
     variation       1173
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368697600"
     variation       1174
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898007"
     variation       1197
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371821126"
     variation       1209
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199954740"
     variation       1334
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138533867"
     variation       1356
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143210569"
     variation       1364
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113079556"
     exon            1384..6440
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     STS             1387..1518
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D1S3283"
                     /db_xref="UniSTS:73729"
     variation       1452
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369315549"
     variation       1496
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200149176"
     variation       1499
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371139653"
     variation       1526
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7805"
     variation       1556
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182277538"
     variation       1604
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186477456"
     variation       1610
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372453155"
     variation       1618
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192547923"
     variation       1633
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115786910"
     variation       1651
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118078895"
     variation       1807
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055807"
     polyA_signal    1823..1828
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      1845
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     variation       2077..2078
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369144718"
     variation       2198
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146178664"
     variation       2231
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:263476"
     variation       2297..2298
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:148528174"
     variation       2307
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370236588"
     variation       2328
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74635891"
     variation       2329
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184671274"
     variation       2334
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115686750"
     variation       2366
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80179040"
     variation       2384
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190177169"
     variation       2390
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139775213"
     variation       2399
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193068181"
     variation       2430
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17129455"
     variation       2455
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:372495516"
     variation       2466
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116809966"
     variation       2523
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370921223"
     variation       2587
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71660692"
     variation       2713
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74097437"
     variation       2722
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114006993"
     variation       2774
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148772273"
     variation       2839
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189926701"
     variation       2863
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181084322"
     variation       2946
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142377175"
     variation       2948
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6693019"
     variation       3097..3099
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="ttc"
                     /db_xref="dbSNP:374106896"
     variation       3128
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185347963"
     variation       3150
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151286456"
     variation       3307
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375815130"
     variation       3322
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287733"
     variation       3338
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140493017"
     variation       3407
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188250289"
     variation       3463
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182063957"
     variation       3505
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187273072"
     variation       3516
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191719770"
     variation       3774..3775
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34167887"
     variation       3800
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147045004"
     variation       3869
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183730198"
     variation       3902..3903
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:36110352"
     variation       3992
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:41287735"
     variation       4189
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147661424"
     variation       4262
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186643470"
     variation       4342
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190126132"
     variation       4345..4346
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201785649"
     variation       4396
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372613370"
     variation       4501
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182401439"
     variation       4513
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10489890"
     variation       4589
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369595750"
     variation       4604
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74851582"
     variation       4673
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112702619"
     variation       4687
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72961649"
     variation       4714
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186807942"
     variation       4821
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287737"
     STS             4917..5044
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D15S1477"
                     /db_xref="UniSTS:474482"
     variation       5027
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189701711"
     variation       5095
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142324982"
     variation       5186
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113438342"
     variation       5190
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147012806"
     variation       5226
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184011272"
     variation       5507
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376906"
     variation       5551
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188996159"
     variation       5555
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113225472"
     variation       5572
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10446"
     STS             5597..5707
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="SHGC-75080"
                     /db_xref="UniSTS:44451"
     variation       5652
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138062316"
     variation       5717
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74632026"
     variation       5755
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11293484"
     variation       5755
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75427542"
     variation       5756
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79757555"
     variation       5757
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112330637"
     variation       5757
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201436487"
     variation       5897
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74097438"
     variation       5950
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149522642"
     variation       5985
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201221938"
     variation       6050
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7523137"
     variation       6134
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11544893"
     variation       6188
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193042715"
     variation       6250
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371895650"
     variation       6292
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143128170"
     variation       6294
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185293609"
     variation       6324..6328
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tatat"
                     /db_xref="dbSNP:71789713"
     variation       6375..6379
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="atttt"
                     /db_xref="dbSNP:141790894"
     variation       6401
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35844916"
     variation       6417..6418
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:373436380"
     polyA_signal    6420..6425
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      6440
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
ORIGIN      
gcgcttgtttttcccttgggacccgggtccacacggcggggtcgcccgtccatctccggctcgcccgcggggcccatcgtcgacgttagcggccgttctccgagccgactgacccatccttggcgctgccgccgcgcgcttgttctcctccctcgccccgccttcatcctccccgttcacggaaacgacagctgcggctgcggggctggcgccgcctccctccacctaccacgtctgccctcgccgctctagccctgcgccccagcccggccgcggcacctccgcctcgccgccgctaggtcggccggctccgcccggctgccgcctaggatgaatatcatggacttcaacgtgaagaagctggcggccgacgcaggcaccttcctcagtcgcgccgtgcagttcacagaagaaaagcttggccaggctgagaagacagaattggatgctcacttagagaacctccttagcaaagctgaatgtaccaaaatatggacagaaaaaataatgaaacaaactgaagtgttattgcagccaaatccaaatgccaggatagaagaatttgtttatgagaaactggatagaaaagctccaagtcgtataaacaacccagaacttttgggacaatatatgattgatgcagggactgagtttggcccaggaacagcttatggtaatgcccttattaaatgtggagaaacccaaaaaagaattggaacagcagacagagaactgattcaaacgtcagccttaaattttcttactcctttaagaaactttatagaaggagattacaaaacaattgctaaagaaaggaaactattgcaaaataagagactggatttggatgctgcaaaaacgagactaaaaaaggcaaaagctgcagaaactagaaattcacaactaaactcagctcgccttgaaggagataacattatgatttgggcagaggaggtgacaaaatctgaacaggaattaagaataactcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaatcagcagtacacatgcccatcaccttcgctgtctgaatgactttgtagaagcccagatgacttactatgcacagtgttaccagtatatgttggacctccagaaacaactgggaagttttccatccaattatcttagtaacaacaatcagacttctgtgacacctgtaccatcagttttaccaaatgcgattggttcttctgccatggcttcaacaagtggcctagtaatcacctctccttccaacctcagtgaccttaaggagtgtagtggcagcagaaaggccagggttctctatgattatgatgcagcaaacagtactgaattatcacttctggcagatgaggtgatcactgtgttcagtgttgttggaatggattcagactggctaatgggggaaaggggaaaccagaagggcaaggtgccaattacctacttagaactgctcaattaagtaggtggactatggaaaggttgcccatcatgactttgtatttatatacaattaactctaaataaagcaggttaagtatcttccatgttaatgtgttaagagactgaaaataccagccatcagaaactggcctttctgccaataaagttgcatggtaaatatttcattacagaatttatgttagagctttcatgccaagaatgttttcttacaaaattctctttttattgaggtttcactaataagcagcttctacttttgagcctcaacttaaagcagaactgttttctactggatttttcattaacagcaagctttttcttttatgtaaaataaatctattgtgaattgatatcagcgactcatttattaggtataaataatagccaaagaataaaattaaaatttattttaaactttcggtcttaaaaagagctgtaggatataaacctcttttgtgaaaagtagaattttctgaatgctttcatagacaaaaacgcatttaaactatgtttacctggttttccaacagaaatcaaatgattttaatattatgttttgatgggttattttcagagttgtttggttttttaaacactactgaatggtttcttttaaatttaagaacaactagttcttgaaaagcaataccgtatttctctgataaatttgtagttaaggttctagaaaatctaggacaaatttacttcattaaacataaagtttttaagattattcagttggcacaatttaatgcataattgggattggatccatttactgtactgtggtacagtaaagagaatgtgttcttattgaacagcagatttgtatacaaatacggaataatgcaactacattataaattgtatacgaacaaaataaattgggtcactctgagcttactattaaaacattgaaaatttattaatgaacacaggctatcttgatgaggatctctgcttatgaaacacatactaatgaaattattagtgacacattggaagctagaaaattgctgttggggccattgctataaatcattgtttccatgttaagacttctgttctaattcattcattcaacaaacatttgttgagggccagatactgtgctggtcaactggggatactgtcctgaacaatatgcacacagttcttgcccctgcagagcttaaagaccattaaaggatacagaaaattaagcaattatcctatagtaggattcgtggtgtgatggggaaaatacaaggtactgtatttgggagtcatgtaactccagttttgggagtgagagagggtctggggaagaactgttccagataaaaagatgtgtaaccaagatagcatagcacattctgacaactaaagcaatttactctaacttaagcatgaagtacaaaagtatagttcatttattgagggaatgttaagctattaaaatgatactttttggtacttttaaaaaaatgaatacttaaacaccgttttaaaattttgtgttaagagctcctaataagaacttggtaaacatgttgacaatttaactcacagtctaaactttaaaagtagtagttacccttttatttctgtgccatgagacaaattcttctgcagttttatagttgtacaagatgttttgactcactctcaattgccatattcttaaagaaaccctgaaaagctgctcaagctggtcagttttctgtaaaaccaagtaaatgaaattttctctcccctcagaaaggaagttctacagcctagagtaccatctattgtgttttataagtccagatttaggctttgaaagatcataccaaaacttcagatcgacttaaacagcaactatgaattaggtttatgggaaatgtagtaatacaggggaaagaatatcggtaatggagtgaaatggtcctgggttcaaatccagtcttcctcacatattgtgctctttaagcttcaaatgagatgtataactgccttttccttaccagtaaaatgaggacaataattatgacaccatagggtggttgtgaggattagcaaatgttatcttgtatttcaggtgcctttcagggaaaggcttggcacatagtaaacacatcctgtaaatatcagtttccccttgttagcccctgtagcatcctgacctaccaagtctataggccttgcatatcactgtgcaccagagatacctcttttacatctgggctctgttttctctctatcaatcctatcctccaccctctttaaatcagaccccaggtttaaccttcccacagtcagtataaatcatttttcagaactttcagctttccatcaagtgaaagttgattttagttacccagtaatgtacagaaaccttcaataatgttaagcttcaaaggcttctggtacgtttgtctaccacagaaccaccacaatatatatgcttgttcttaggtttattgctttttattttaatggggtttggttgtttgggttttattttggttttggcttattttaaagtcaagtttagtttttactcaggtaaaggcctgaagtttcttgggcgtggaagaaaaagcttgggaagcctattaattcatggtgcagttcagaattgtttaaataagctctgtgccactgagcttaatctgaaagtatagtgacatgtgaaggatgcacatatgaatgaaaaactaaaataattgtaggctcttctataaatgaaaaaaaaagtgattggattgtgtctacctttttcctcaaagtaatctaacctaaacggtcatggtgttaaaactttttatggtgctaatcagaaaaattgatgttgcaagaaatgaggtctcaaaaatgggaatgtgcctcctcactctgcgtcacatgggaaataaatcctgaggccaggatcaccagtggggtagagtcatcttcatagtctcctgttatcctccccctgaacaaagaacaaagtgagactgggaagctagtgttggggaaacatttctgggataaactgtggagtggagaagacaatggagggcaaggcaaaaacccacagacttgtttacccatagaggccccactcacctccatgctgacagaattccagaaaaattccttccctatctcccaaacacctgaaattctgaaatattgccctactatttagcactttaagcttcagtgaggtgctgtaatggagagatagcttcatagtttagcctatagccaactttgcctcaagacctccagataagatgaagtggcttttacctcatgtgagtctcaaacgctggagagagagttccacaaccacccctgccctttctcccatattacgctcattagaaagtctactcagggctgggtgccgtggctcatgcctgtaatcccagcactttggaggctgaggcgggtggatcatctgaggtcaggagttcgagaccagcctggccaacatggggaaaccctgtctctactgaaaatataaaaattagccgggcatggtggcgtgcacctgtaattccagctactcgggaggctgaggcaggagaatcacttgaaccccagaggcagaggctacagtgagccaagattgcaccactgcactccaacctgggtgatagaataagactcttgtctcaaggaaagaaaaaatgtctactcagtagagcagtgattggcaaagtgtgagaccccagaccggcaatattggcatctcctggagacttgtttaaaatgctgattactattttcaagaactttctaccttcatttttacttattttttgttttcaagggctcatggaatcagtcttccatgtgacagctttttaaatattttaagacaaaaactgagtcttctaatcttaattgtgttctagcagtagtcattgtaattatagttatttttataatttatttgtttagtgtatatctgtcactctagaatgtaggctccctgagataaaaactataattcttttgatggcagttacattcccaactcttagcacaagatctaggacatagtatgaactcaataaatttttgttgaatgaaagaaaaatgcaaatttataagccttttcagagacctactgaatcaaactctgagagtggagcccagcaatctgttgtaaaagctgtttgagtaatactgttgcactctaagcttgagaaccactgcaatagaactaagagaacattcatttcaccttcaggcctattctctgacatcacttgaaaaatcctctctgccttctgtaacccttaaccaacaacagtgccctgtccatgtaggggaaacttctgggctgtattacaagtgggtaggaaggtataaggatatcatagtgggaagtattgcttagaatgccagtacttgtttgctgtggaaggtttctaggaatggattgcttagtctaaagtaagcactaccaccatccacgttttcactcaacacagtgccttttaattggtgactaacatcaaaacaccttgacaaaccgttaaaacagtatcagaaaccatgtgtacatccctgtgcctcttagattgctaagttctgctctcattcttacttcaaaggacactttttaaagaattgttaatgcttttttataatacaagtcatagccctgttggcaaaaagaaaaaagattcagtgagaaagaaaaatcactgataattccatcatccagggagaaccactgttatttaagtatatggccttccagacttttctgtgcatttatagatatttttaatgggatcaaagtgtacatactgttttgtaactttttttcactcaacaataccatgactgtcttgctgtgtcaagtatatttctacatctcttaatggctgcatgatattccatcatatgtgccacattttattaaactactgttcaatttttaggtttccaactttcattaataaagtgctttaaagaacaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51100 -> Molecular function: GO:0005504 [fatty acid binding] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042171 [lysophosphatidic acid acyltransferase activity] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:51100 -> Biological process: GO:0006654 [phosphatidic acid biosynthetic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:0051084 ['de novo' posttranslational protein folding] evidence: IEA
            GeneID:51100 -> Biological process: GO:0051259 [protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:1900740 [positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:51100 -> Cellular component: GO:0005741 [mitochondrial outer membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0043234 [protein complex] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.