2024-03-29 09:09:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001204870 4459 bp mRNA linear PRI 24-JUN-2013 DEFINITION Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 4, mRNA. ACCESSION NM_001204870 VERSION NM_001204870.1 GI:325910844 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4459) AUTHORS Liu,J.F., Hou,S.M., Tsai,C.H., Huang,C.Y., Hsu,C.J. and Tang,C.H. TITLE CCN4 induces vascular cell adhesion molecule-1 expression in human synovial fibroblasts and promotes monocyte adhesion JOURNAL Biochim. Biophys. Acta 1833 (5), 966-975 (2013) PUBMED 23313051 REMARK GeneRIF: The CCN4-induced VCAM-1 expression promoted monocyte adhesion to human OASFs. REFERENCE 2 (bases 1 to 4459) AUTHORS Saxena,R., Saleheen,D., Been,L.F., Garavito,M.L., Braun,T., Bjonnes,A., Young,R., Ho,W.K., Rasheed,A., Frossard,P., Sim,X., Hassanali,N., Radha,V., Chidambaram,M., Liju,S., Rees,S.D., Ng,D.P., Wong,T.Y., Yamauchi,T., Hara,K., Tanaka,Y., Hirose,H., McCarthy,M.I., Morris,A.P., Basit,A., Barnett,A.H., Katulanda,P., Matthews,D., Mohan,V., Wander,G.S., Singh,J.R., Mehra,N.K., Ralhan,S., Kamboh,M.I., Mulvihill,J.J., Maegawa,H., Tobe,K., Maeda,S., Cho,Y.S., Tai,E.S., Kelly,M.A., Chambers,J.C., Kooner,J.S., Kadowaki,T., Deloukas,P., Rader,D.J., Danesh,J. and Sanghera,D.K. CONSRTM DIAGRAM; MuTHER; AGEN TITLE Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India JOURNAL Diabetes 62 (5), 1746-1755 (2013) PUBMED 23300278 REFERENCE 3 (bases 1 to 4459) AUTHORS Zemans,R.L., McClendon,J., Aschner,Y., Briones,N., Young,S.K., Lau,L.F., Kahn,M. and Downey,G.P. TITLE Role of beta-catenin-regulated CCN matricellular proteins in epithelial repair after inflammatory lung injury JOURNAL Am. J. Physiol. Lung Cell Mol. Physiol. 304 (6), L415-L427 (2013) PUBMED 23316072 REMARK GeneRIF: Beta-catenin-dependent expression of WISP1 and Cyr61 is critical for epithelial repair. REFERENCE 4 (bases 1 to 4459) AUTHORS Hennemeier,I., Humpf,H.U., Gekle,M. and Schwerdt,G. TITLE The food contaminant and nephrotoxin ochratoxin A enhances Wnt1 inducible signaling protein 1 and tumor necrosis factor-alpha expression in human primary proximal tubule cells JOURNAL Mol Nutr Food Res 56 (9), 1375-1384 (2012) PUBMED 22778029 REMARK GeneRIF: Prolonged exposure of kidney cells to ochratoxin A, expectable in human kidney due to a normal diet, leads to a marked ERK1/2-dependent upregulation of WISP1 gene expression, which, accompanied by increased ERK1/2- dependent TNF-alpha expression. REFERENCE 5 (bases 1 to 4459) AUTHORS Shao,H., Cai,L., Grichnik,J.M., Livingstone,A.S., Velazquez,O.C. and Liu,Z.J. TITLE Activation of Notch1 signaling in stromal fibroblasts inhibits melanoma growth by upregulating WISP-1 JOURNAL Oncogene 30 (42), 4316-4326 (2011) PUBMED 21516124 REMARK GeneRIF: This study shows that constitutive activation of the Notch1 pathway confers fibroblasts with a suppressive phenotype to melanoma growth, partially through WISP-1. REFERENCE 6 (bases 1 to 4459) AUTHORS Xie,D., Nakachi,K., Wang,H., Elashoff,R. and Koeffler,H.P. TITLE Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features JOURNAL Cancer Res. 61 (24), 8917-8923 (2001) PUBMED 11751417 REMARK GeneRIF: Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features. REFERENCE 7 (bases 1 to 4459) AUTHORS Desnoyers,L., Arnott,D. and Pennica,D. TITLE WISP-1 binds to decorin and biglycan JOURNAL J. Biol. Chem. 276 (50), 47599-47607 (2001) PUBMED 11598131 REFERENCE 8 (bases 1 to 4459) AUTHORS Tanaka,S., Sugimachi,K., Saeki,H., Kinoshita,J., Ohga,T., Shimada,M., Maehara,Y. and Sugimachi,K. TITLE A novel variant of WISP1 lacking a Von Willebrand type C module overexpressed in scirrhous gastric carcinoma JOURNAL Oncogene 20 (39), 5525-5532 (2001) PUBMED 11571650 REFERENCE 9 (bases 1 to 4459) AUTHORS Xu,L., Corcoran,R.B., Welsh,J.W., Pennica,D. and Levine,A.J. TITLE WISP-1 is a Wnt-1- and beta-catenin-responsive oncogene JOURNAL Genes Dev. 14 (5), 585-595 (2000) PUBMED 10716946 REFERENCE 10 (bases 1 to 4459) AUTHORS Pennica,D., Swanson,T.A., Welsh,J.W., Roy,M.A., Lawrence,D.A., Lee,J., Brush,J., Taneyhill,L.A., Deuel,B., Lew,M., Watanabe,C., Cohen,R.L., Melhem,M.F., Finley,G.G., Quirke,P., Goddard,A.D., Hillan,K.J., Gurney,A.L., Botstein,D. and Levine,A.J. TITLE WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors JOURNAL Proc. Natl. Acad. Sci. U.S.A. 95 (25), 14717-14722 (1998) PUBMED 9843955 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BX476382.1, AY196486.1, AF192304.6 and AI347990.1. Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]. Transcript Variant: This variant (4) lacks three internal exons in the coding region, as compared to variant 1. The resulting isoform (4) has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY196486.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-30 BX476382.1 1-30 31-291 AY196486.1 8-268 292-4179 AF192304.6 65650-69537 4180-4459 AI347990.1 1-280 c FEATURES Location/Qualifiers source 1..4459 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q24.22" gene 1..4459 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /note="WNT1 inducible signaling pathway protein 1" /db_xref="GeneID:8840" /db_xref="HGNC:12769" /db_xref="MIM:603398" exon 1..175 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="alignment:Splign:1.39.8" variation 22 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:35244636" STS 50..1627 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /db_xref="UniSTS:486382" variation 55 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:116716037" STS 57..525 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /db_xref="UniSTS:481399" variation 58 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:113859079" variation 60 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:201515187" variation 76 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370168550" variation 77 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:373840690" STS 78..496 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /db_xref="UniSTS:482064" misc_feature 95..97 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /note="upstream in-frame stop codon" CDS 107..475 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /note="isoform 4 precursor is encoded by transcript variant 4; Wnt-1 inducible signaling pathway protein 1; WNT1 induced secreted protein 1; CCN family member 4" /codon_start=1 /product="WNT1-inducible-signaling pathway protein 1 isoform 4 precursor" /protein_id="NP_001191799.1" /db_xref="GI:325910845" /db_xref="CCDS:CCDS56556.1" /db_xref="GeneID:8840" /db_xref="HGNC:12769" /db_xref="MIM:603398" /translation="
MRWFLPWTLAAVTAAAASTVLATAGKKCLAVYQPEASMNFTLAGCISTRSYQPKYCGVCMDNRCCIPYKSKTIDVSFQCPDGLGFSRQVLWINACFCNLSCRNPNDIFADLESYPDFSEIAN
" sig_peptide 107..172 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" mat_peptide 173..472 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /product="WNT1-inducible-signaling pathway protein 1 isoform 4" misc_feature 209..457 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /note="Glycoprotein hormone beta chain homologues; Region: GHB_like; cl00070" /db_xref="CDD:200610" variation 128 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145302227" variation 130 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:147864416" variation 134 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:141541463" variation 135 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:147047617" variation 140 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145240649" variation 144 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:149172980" variation 155 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:375956639" variation 174 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370536589" variation 175 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374241755" exon 176..4455 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="alignment:Splign:1.39.8" variation 219 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370616029" variation 226 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:35938742" variation 234 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:374293123" variation 235 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:34279368" variation 264 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:368398252" variation 268 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:150347257" variation 292 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:3739261" variation 307 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:369316693" variation 341 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200845163" variation 366 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:371947572" variation 376 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:34665171" variation 427 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:146812236" variation 469 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:140629356" variation 477 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:192420341" variation 497 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200836970" variation 502 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374163879" variation 620 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:138013484" variation 730 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:57390041" variation 844 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="a" /db_xref="dbSNP:142394577" variation 926 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:113549310" variation 951 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:184580529" variation 1068 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:190313906" variation 1116 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:142461254" variation 1219 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929969" variation 1445 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:12164193" variation 1454 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145960909" variation 1460 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:73362554" variation 1529 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:182003497" variation 1608 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:4265166" variation 1659 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929970" variation 1728 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374010309" variation 1733 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:4577938" variation 1824 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="t" /db_xref="dbSNP:377032724" variation 1938 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:146162433" variation 1993 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:185849289" variation 2289 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:188945068" variation 2298 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:181057409" variation 2301 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:148796937" variation 2522 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:117072299" variation 2555 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977549" variation 2858 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:73362557" variation 2860 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:76779268" variation 2894 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:2929971" variation 2901 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:373530385" variation 2925 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:142427022" variation 2977 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929972" variation 3030 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:2929973" variation 3054 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:151300566" variation 3202 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:16904856" variation 3233..3234 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="c" /db_xref="dbSNP:36017627" variation 3289 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:370468302" variation 3331 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977550" variation 3446 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:9649971" variation 3448 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:186406622" variation 3478 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:16904857" variation 3567 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:191533905" variation 3601 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200715437" variation 3629 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:145461011" variation 3770 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:16904858" variation 3878 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:114925013" variation 3888 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:16904859" variation 3944 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="t" /db_xref="dbSNP:73711826" variation 3946..3947 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="g" /db_xref="dbSNP:35647766" variation 3951 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:16904860" variation 3964..3967 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="ctga" /db_xref="dbSNP:372155216" variation 3966..3969 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="gact" /db_xref="dbSNP:367926394" variation 3990 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:182511484" variation 4007 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:186242527" variation 4053 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:74818902" variation 4072 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977551" STS 4137..4303 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /standard_name="RH102883" /db_xref="UniSTS:97217" STS 4151..4362 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /standard_name="RH76344" /db_xref="UniSTS:92556" variation 4184 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:147688784" variation 4196 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:191950359" variation 4361 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:77866098" polyA_signal 4433..4438 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" polyA_site 4455 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" ORIGIN
atatctggtgctcctgatgggccggccagtctgggcccagctcccccgagaggtggtcggatcctctgggctgctcggtcgatgcctgtgccactgacgtccaggcatgaggtggttcctgccctggacgctggcagcagtgacagcagcagccgccagcaccgtcctggccacggcagggaagaagtgtctggctgtgtaccagccagaggcatccatgaacttcacacttgcgggctgcatcagcacacgctcctatcaacccaagtactgtggagtttgcatggacaataggtgctgcatcccctacaagtctaagactatcgacgtgtccttccagtgtcctgatgggcttggcttctcccgccaggtcctatggattaatgcctgcttctgtaacctgagctgtaggaatcccaatgacatctttgctgacttggaatcctaccctgacttctcagaaattgccaactaggcaggcacaaatcttgggtcttggggactaacccaatgcctgtgaagcagtcagcccttatggccaataacttttcaccaatgagccttagttaccctgatctggacccttggcctccatttctgtctctaaccattcaaatgacgcctgatggtgctgctcaggcccatgctatgagttttctccttgatatcattcagcatctactctaaagaaaaatgcctgtctctagctgttctggactacacccaagcctgatccagcctttccaagtcactagaagtcctgctggatcttgcctaaatcccaagaaatggaatcaggtagacttttaatatcactaatttcttctttagatgccaaaccacaagactctttgggtccattcagatgaatagatggaatttggaacaatagaataatctattatttggagcctgccaagaggtactgtaatgggtaattctgacgtcagcgcaccaaaactatcctgattccaaatatgtatgcacctcaaggtcatcaaacatttgccaagtgagttgaatagttgcttaattttgatttttaatggaaagttgtatccattaacctgggcattgttgaggttaagtttctcttcacccctacactgtgaagggtacagattaggtttgtcccagtcagaaataaaatttgataaacattcctgttgatgggaaaagcccccagttaatactccagagacagggaaaggtcagcccgtttcagaaggaccaattgactctcacactgaatcagctgctgactggcagggctttgggcagttggccaggctcttccttgaatcttctcccttgtcctgcttggggttcataggaattggtaaggcctctggactggcctgtctggcccctgagagtggtgccctggaacactcctctactcttacagagccttgagagacccagctgcagaccatgccagacccactgaaatgaccaagacaggttcaggtaggggtgtgggtcaaaccaagaagtgggtgcccttggtagcagcctggggtgacctctagagctggaggctgtgggactccaggggcccccgtgttcaggacacatctattgcagagactcatttcacagcctttcgttctgctgaccaaatggccagttttctggtaggaagatggaggtttaccggttgtttagaaacagaaatagacttaataaaggtttaaagctgaagaggttgaagctaaaaggaaaaggttgttgttaatgaatatcaggctattatttattgtattaggaaaatataatatttactgttagaattcttttatttagggccttttctgtgccagacattgctctcagtgctttgcatgtattagctcactgaatcttcacgacaatgttgagaagttcccattattatttctgttcttacaaatgtgaaacggaagctcatagaggtgagaaaactcaaccagagtcacccagttggtgactgggaaagttaggattcagatcgaaattggactgtctttataacccatattttccccctgtttttagagcttccaaatgtgtcagaataggaaaacattgcaataaatggcttgattttttaatgtcatttttccctcttatagtctttctagctccttttcaaaagacgagaatatctgattttctgataatttaggtgcttaagcatccaaaatacatgggacacacaaaaatccaggaatcccctgtagcttattccctctttcccatcggaaccagctctcatcacacatttaaaagatgattctgtttacccaatgctgcatattgaatgttgtgtagttattcacagggaattctgtgcagtgtgcagagagattcctaaacgggaaaaggactgggaatacatcctccttactgtgacctccccaaaacctagtccagtgcaaggtatacagtggtgctcattaaatacttgatgaatacaggaagctgtgcatgtgttcctacttttattcgaagctctcttcttccaaagctacatgaaaatagaattttaacagtcaaaattttatattaagtgccttagcaaaagagacatttaatatttcaaagaaatgcatatgtatgtatacatatatttgtgtatgcgtatgcaagaattcttgtataaagagaattcactccatgaatgatctcttctgtaagtcagtgtgaatcatgttagattttctgagagtgaaaacacctgccatctacaaattacaaggctggataacagctcactccatttgaaattcagtggaaacccaagagctaggttcttactgaatttgcatctcaatttgggaaactgaacttagctttcaaagatcataggaagtctggttggagaaactagggattattctggcaatgggtgcaggaaggtggtcagaataacccagtcgccattggttttgagaaacggaactatcttatgcagagcccggagggcaagtctcagacccatgggttgaagccatggagaaggaaatttggatccaatgtaatgaagcgctttctaagtcagaatttccctgcaatggtgtggcctgattcaataaaaattaagaataataaatataatggaaaaaaatctccactgattgagtgtttacttggtgccaagcactatgctaagttgttcattattttatttaattgttacagcaattttgagtatgcatctttcactattttataagtggaaaagagaagtgcccccaaaaagttagagctcaaacagcagcttattctaccagcccctgctcttgcggaggcctctggaaaagacctgaatgacacctattggagaattacatctacaaggggcttcaaacagaccaaatagatcatcacctctgtggtcccttgttaactatatgttctgagacaaaggaaagctaccctaagggttagttaacctttgctgaggaaatttacattcatacttagagtgaattactcaggtgtgcttaggtgtgcaaaagggaaggagacctgaattcaccaagttaaatcttgctaaaccttatcataagcattttttgagcgcttagcatacaccaagccttgtggaaggtgctttcctgccatatctcatttaatcctcacagcaaacctatagaatatggcattatcatctgagtctcacagaagtttagtcgtgtactcaaggtcttaccagctagtgaacagcagaccaagactggaaacccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctgtcccccaaatcaaaaggcatgacctttataagaggcgctttactgacaatagctgcaattttaactttgaaaatgattcagaattatcaaagatagtagattcgaatgacatgattgtctataatctcgctagccttgtactgtgtgtgcatagcaattacagggaagtaatctagctcctgactattatgttgaactatgtcgctgctttttacaaacttgtcttgatccaaagcagtcacaatgataaccctgcatatctgggaatcataagtcaactatgtatccctgtgtgtgtatatatatgtatgtatgtatctattttcaaactgtgatttaatatttaaatattcctactgccatttttgtgactgaaaaactacacatgaggaaacgtcttagaattttccaatagaggaaaaataacacttgggcaatctgtcatgtttcacaacagttctcatttttctcatgatttgtgtagcgtggaatgtgtttgctcaatgtgaagggttttcattgctcaatttctctgtgtaagtcttttccttaaggtaataaaccatcagcaaagtcacatactggagttggtggcttttcttgtacaggcagttgttatgagacaatgatggagcattgagcatgttcaataaatgtgcagatggtggaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:8840 -> Molecular function: GO:0005520 [insulin-like growth factor binding] evidence: IEA GeneID:8840 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEA GeneID:8840 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA GeneID:8840 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:8840 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:8840 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA GeneID:8840 -> Cellular component: GO:0005615 [extracellular space] evidence: NAS GeneID:8840 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.