Home |
Help |
Advanced search
2024-04-19 10:46:43, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001202545 2901 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 6, mRNA. ACCESSION NM_001202545 XR_108855 XR_110720 XR_113043 XR_114073 VERSION NM_001202545.1 GI:321400113 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2901) AUTHORS Li,T., Wang,H., Sun,Y., Zhao,L., Gang,Y., Guo,X., Huang,R., Yang,Z., Pan,Y., Wu,K., Xu,L., Liu,Z. and Fan,D. TITLE Transcription factor CUTL1 is a negative regulator of drug resistance in gastric cancer JOURNAL J. Biol. Chem. 288 (6), 4135-4147 (2013) PUBMED 23255599 REMARK GeneRIF: overexpression of active CUTL1 significantly resulted in increased cancer tissue response to chemotherapy and therefore inhibited growth, whereas knockdown of CUTL1 conferred resistance to chemotherapy. REFERENCE 2 (bases 1 to 2901) AUTHORS McNerney,M.E., Brown,C.D., Wang,X., Bartom,E.T., Karmakar,S., Bandlamudi,C., Yu,S., Ko,J., Sandall,B.P., Stricker,T., Anastasi,J., Grossman,R.L., Cunningham,J.M., Le Beau,M.M. and White,K.P. TITLE CUX1 is a haploinsufficient tumor suppressor gene on chromosome 7 frequently inactivated in acute myeloid leukemia JOURNAL Blood 121 (6), 975-983 (2013) PUBMED 23212519 REMARK GeneRIF: Data indicate CUX1 as a conserved, haploinsufficient tumor suppressor frequently deleted in myeloid neoplasms. REFERENCE 3 (bases 1 to 2901) AUTHORS Liu,K.C., Lin,B.S., Zhao,M., Wang,K.Y. and Lan,X.P. TITLE Cutl1: a potential target for cancer therapy JOURNAL Cell. Signal. 25 (1), 349-354 (2013) PUBMED 23085261 REMARK GeneRIF: Cutl1 played transcriptional level mediated by signal transduction, translational level mediated by miR122, posttranslational level such as phosphorylation, de-phosphorylation, acetylation and proteolytic cleavage. Review article REFERENCE 4 (bases 1 to 2901) AUTHORS Sasayama,D., Hiraishi,A., Tatsumi,M., Kamijima,K., Ikeda,M., Umene-Nakano,W., Yoshimura,R., Nakamura,J., Iwata,N. and Kunugi,H. TITLE Possible association of CUX1 gene polymorphisms with antidepressant response in major depressive disorder JOURNAL Pharmacogenomics J. (2012) In press PUBMED 22584459 REMARK Publication Status: Available-Online prior to print REFERENCE 5 (bases 1 to 2901) AUTHORS Zhai,Z., Ha,N., Papagiannouli,F., Hamacher-Brady,A., Brady,N., Sorge,S., Bezdan,D. and Lohmann,I. TITLE Antagonistic regulation of apoptosis and differentiation by the Cut transcription factor represents a tumor-suppressing mechanism in Drosophila JOURNAL PLoS Genet. 8 (3), E1002582 (2012) PUBMED 22438831 REMARK GeneRIF: we find repression of apoptosis regulators by Cux1 in human cancer cells. REFERENCE 6 (bases 1 to 2901) AUTHORS Lievens,P.M., Tufarelli,C., Donady,J.J., Stagg,A. and Neufeld,E.J. TITLE CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro JOURNAL Gene 197 (1-2), 73-81 (1997) PUBMED 9332351 REFERENCE 7 (bases 1 to 2901) AUTHORS Chernousov,M.A., Stahl,R.C. and Carey,D.J. TITLE Schwann cells secrete a novel collagen-like adhesive protein that binds N-syndecan JOURNAL J. Biol. Chem. 271 (23), 13844-13853 (1996) PUBMED 8662884 REFERENCE 8 (bases 1 to 2901) AUTHORS Scherer,S.W., Neufeld,E.J., Lievens,P.M., Orkin,S.H., Kim,J. and Tsui,L.C. TITLE Regional localization of the CCAAT displacement protein gene (CUTL1) to 7q22 by analysis of somatic cell hybrids JOURNAL Genomics 15 (3), 695-696 (1993) PUBMED 8468066 REFERENCE 9 (bases 1 to 2901) AUTHORS Neufeld,E.J., Skalnik,D.G., Lievens,P.M. and Orkin,S.H. TITLE Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut JOURNAL Nat. Genet. 1 (1), 50-55 (1992) PUBMED 1301999 REFERENCE 10 (bases 1 to 2901) AUTHORS Ottolenghi,S., Mantovani,R., Nicolis,S., Ronchi,A. and Giglioni,B. TITLE DNA sequences regulating human globin gene transcription in nondeletional hereditary persistence of fetal hemoglobin JOURNAL Hemoglobin 13 (6), 523-541 (1989) PUBMED 2481658 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC410774.1, AK122726.1, L12579.1 and BC012323.1. On or before Aug 3, 2011 this sequence version replaced gi:310128672, gi:310120056, gi:310118377, gi:310115312. Summary: The protein encoded by this gene is a member of the homeodomain family of DNA binding proteins. It may regulate gene expression, morphogenesis, and differentiation and it may also play a role in the cell cycle progession. Several alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Feb 2011]. Transcript Variant: This variant (6) lacks an in-frame exon in the 5' region and has an alternate 3' sequence including the coding region, as compared to variant 1. The resulting isoform (f) lacks an internal segment and has a shorter and distinct C-terminus, as compared to isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK122726.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-117 DC410774.1 1-117 118-455 AK122726.1 1-338 456-1957 L12579.1 486-1987 1958-2901 BC012323.1 1983-2926 FEATURES Location/Qualifiers source 1..2901 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q22.1" gene 1..2901 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="cut-like homeobox 1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="MIM:116896" exon 1..190 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" misc_feature 74..76 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="upstream in-frame stop codon" variation 80 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:373949747" variation 97 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:368174106" variation 101 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:371287227" variation 110 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:373609751" CDS 128..2026 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="isoform f is encoded by transcript variant 6; golgi integral membrane protein 6; protein CASP; cut homolog; putative protein product of Nbla10317; homeobox protein cux-1; CCAAT displacement protein" /codon_start=1 /product="protein CASP isoform f" /protein_id="NP_001189474.1" /db_xref="GI:321400114" /db_xref="CCDS:CCDS56499.1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="MIM:116896" /translation="
MAANVGSMFQYWKRFDLQQLQRELDATATVLANRQDESEQSRKRLIEQSREFKKNTPEDLRKQVAPLLKSFQGEIDALSKRSKEAEAAFLNVYKRLIDVPEVTIKALKEKIREYEQTLKNQAETIALEKEQKLQNDFAEKERKLQETQMSTTSKLEEAEHKVQSLQTALEKTRTELFDLKTKYDEETTAKADEIEMIMTDLERANQRAEVAQREAETLREQLSSANHSLQLASQIQKAPDVEQAIEVLTRSSLEVELAAKEREIAQLVEDVQRLQASLTKLRENSASQISQLEQQLSAKNSTLKQLEEKLKGQADYEEVKKELNILKSMEFAPSEGAGTQDAAKPLEVLLLEKNRSLQSENAALRISNSDLSGRCAELQVRITEAVATATEQRELIARLEQDLSIIQSIQRPDAEGAAEHRLEKIPEPIKEATALFYGPAAPASGALPEGQVDSLLSIISSQRERFRARNQELEAENRLAQHTLQALQSELDSLRADNIKLFEKIKFLQSYPGRGSGSDDTELRYSSQYEERLDPFSSFSKRERQRKYLSLSPWDKATLSMGRLVLSNKMARTIGFFYTLFLHCLVFLVLYKLAWSESMERDCATFCAKKFADHLHKFHENDNGAAAGDLWQ
"
misc_feature 1250..1930
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/note="CASP C terminal; Region: CASP_C; pfam08172"
/db_xref="CDD:203868"
variation 152
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200925347"
exon 191..301
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 193
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:140709702"
variation 208
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:376836450"
variation 223
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150487622"
variation 258
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:200309302"
variation 265
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:145317607"
variation 294
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:149191757"
exon 302..349
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 321
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:143267032"
variation 322
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374397164"
exon 350..428
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 408
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367586602"
variation 422
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:148322402"
exon 429..552
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 436
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:143157780"
variation 451
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201650660"
variation 493
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:375357960"
variation 494
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:138328289"
variation 499
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:11540900"
variation 506
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199800281"
exon 553..629
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 563
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142863665"
variation 565
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:201993734"
variation 610
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:199535463"
variation 620
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:150799140"
exon 630..696
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 635
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:75508780"
variation 645
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:187519642"
variation 662
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139126094"
variation 676
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:149507748"
exon 697..745
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 723
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372003626"
exon 746..850
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 757
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:377269248"
variation 793
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:370842930"
variation 795
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:189334175"
variation 799
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:180828525"
STS 800..902
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="D12S1228E"
/db_xref="UniSTS:151475"
variation 804
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:139855321"
variation 847
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:143307709"
exon 851..1039
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 860
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:200126349"
variation 884
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:372334618"
variation 901
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:139114802"
variation 911
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:376319241"
variation 938
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142950109"
variation 957
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:369666651"
variation 963
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:367848953"
variation 982
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151118398"
variation 1019
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201709857"
variation 1033
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374020928"
exon 1040..1098
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
exon 1099..1147
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1125
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141118279"
variation 1126
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:11540899"
exon 1148..1244
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1153
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:147937477"
variation 1195
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:369005585"
variation 1215
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:374021528"
variation 1216
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367577378"
variation 1220
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:371301313"
exon 1245..1372
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1254
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:62001055"
variation 1255
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:813000"
variation 1269
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:372464298"
variation 1289
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:114381819"
variation 1293
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:139906438"
variation 1297
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:149786604"
variation 1310
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:371828253"
variation 1315
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200271633"
variation 1319
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:145765083"
variation 1320
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:375278390"
variation 1369
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:370845468"
exon 1373..1439
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1379
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:803064"
variation 1380
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:368235304"
variation 1388
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:144199298"
variation 1389
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:146554363"
variation 1419
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:199558313"
variation 1425
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:140386892"
exon 1440..1552
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1459
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199776060"
variation 1460
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150976222"
variation 1465
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:140831161"
variation 1474
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:371715592"
variation 1490
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:375776301"
variation 1527
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150151598"
variation 1542
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:2230102"
variation 1552
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199822336"
exon 1553..1669
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1562
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:138450169"
variation 1567
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:369806479"
variation 1583
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:142767232"
variation 1615
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:146927122"
variation 1622
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2230103"
variation 1625
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:118010189"
variation 1648
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:373393100"
variation 1667
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:144393643"
variation 1668
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:148760130"
exon 1670..1753
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1676
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:187131238"
variation 1689
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:370290068"
variation 1690
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:375513246"
variation 1697
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141515782"
variation 1698
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:202149844"
variation 1704
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:150890071"
variation 1714
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:111537304"
variation 1715
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:139293638"
variation 1720
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:144329021"
variation 1721
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:146049827"
variation 1751
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:371285615"
variation 1752
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:140034854"
exon 1754..1810
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1764
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293839"
variation 1798
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372229678"
exon 1811..1891
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1815
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:144124584"
variation 1841
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372479780"
STS 1842..1926
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="MARC_4357-4358:991938494:5"
/db_xref="UniSTS:231083"
variation 1842
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:145083539"
variation 1850
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201615556"
exon 1892..1956
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1901
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367747037"
variation 1906
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:149124693"
variation 1915
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200899513"
variation 1916
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142155041"
variation 1918
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151204833"
exon 1957..2894
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1960
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141196267"
variation 1961
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:376508181"
variation 1984
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:200345816"
variation 1985
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:377645698"
variation 1997
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:369144524"
variation 2011
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:112505360"
variation 2022..2023
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace=""
/replace="g"
/db_xref="dbSNP:146386435"
variation 2044
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199575958"
variation 2045
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:373876353"
variation 2051
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:909128"
variation 2055
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:201628239"
variation 2056
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:377408845"
variation 2062
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374386627"
variation 2082
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296069"
variation 2139
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151048012"
variation 2165
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:141097964"
variation 2199
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150278456"
variation 2237
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:2734615"
variation 2245
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:185803208"
variation 2258
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:75580662"
variation 2276
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:191591974"
variation 2304
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:41275221"
variation 2373
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:182997186"
variation 2432
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:113634317"
variation 2433
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:188776036"
variation 2461
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:147926104"
variation 2536
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:77369840"
STS 2630..2892
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="WI-21075"
/db_xref="UniSTS:50237"
variation 2631
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:192033664"
STS 2736..2893
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="RH44454"
/db_xref="UniSTS:53362"
variation 2743
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:8950"
variation 2752
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056363"
variation 2753
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141716299"
variation 2769
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:182766749"
variation 2775
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:75104200"
variation 2804
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:1056386"
variation 2830
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:9691899"
polyA_signal 2874..2879
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
variation 2892
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:73187873"
polyA_site 2894
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
ORIGIN
ctcggtggcggcggcggcggccggctccaggccgggttttggcgccgcccgcctgctgcctcctggcggctcctgaactccagccccctctctatcagccgctcactccgtctcaatatgtctcaagatggcggccaatgtgggatcgatgtttcaatattggaagcgctttgatttacagcagctgcagagagaactcgatgccaccgcaacggtattggcgaaccggcaggatgaaagtgagcagtccagaaagcggcttatcgaacagagccgggagttcaagaagaacactccagaggatttgcgcaagcaggtagcgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagcaaggaagctgaagcagctttcttgaatgtctacaaaagattgattgacgtcccagaggttacgataaaagcacttaaagagaaaatccgagaatatgaacagacactgaagaaccaagccgaaaccatagctcttgagaaggaacagaagttacagaatgactttgcagaaaaggagagaaagctgcaggagacacagatgtccaccacctcaaagctggaggaagctgagcataaggttcagagcctacaaacagccctggaaaaaactcgaacagaattatttgacctgaaaaccaaatacgatgaagaaactactgcaaaggccgacgagattgaaatgatcatgacggaccttgaaagggcaaaccagagggcagaggtggctcagagagaggcggagaccttaagggaacagctctcatcggccaatcactccctccagctggcctcacagatccagaaggcaccagacgtggagcaggccatagaggtgctgacccgctccagcctagaagttgagttggccgccaaggagcgggagatcgcacagctggtggaggacgtgcagagactccaggccagcctcaccaagctgcgggagaattcggccagccagatctcacagcttgagcagcagctgagcgccaaaaacagcacactcaaacaactggaagaaaaactcaaaggccaggctgactatgaagaggtgaagaaagagctgaacattctgaagtccatggagtttgcaccgtccgagggcgctgggacacaggatgcggccaagcccctggaggtgctgttgctggagaagaaccgctcgctgcagtccgagaacgccgcgctgcgcatctccaacagcgacctgagcggacgctgtgcagagctgcaagtccgtatcactgaggctgtggccacagccactgagcagagagagctgatcgcccgcctggagcaggacctgagcatcattcagtccatccagcggcccgatgccgagggtgccgctgagcaccgcctggagaagatcccagagcccatcaaagaggccactgccctattctacggacctgcagcaccagccagcggtgccctcccagagggccaggtggattcactgctttccatcatctccagccagagggagcgcttccgtgcccggaaccaggagcttgaggccgagaaccgcctggcccagcacaccctccaggccctgcagagtgagctggacagcctgcgcgccgacaacatcaagctctttgagaagatcaagttcctgcagagctaccctggccggggcagcggcagtgatgacacggagctgcggtactcgtcccagtacgaggagcgcctggaccccttctcctccttcagcaagcgggagcggcagaggaagtacctgagcttgagtccctgggacaaggccaccctcagcatggggcgtctggttctctccaacaagatggcgcgcaccatcggcttcttctacacactgttcctgcactgcctggtcttcctggtgctctacaagctggcatggagcgagagcatggagagggactgtgccaccttctgcgccaagaagttcgctgaccacctgcacaagttccacgagaatgacaacggggctgcggctggtgacttgtggcagtgataccccggggcctcccccgtgacagtgacggctgcgcctccaccccgactgctcagtgcatctaatcacttagactcccctgaagaatcccccatggaaactgcccttatccgctgtccagcagctgccagaggccccaggtcacctcgggtccccttgaaagaatgtctcggtcacatcaggcccgctaggtccagagagcgagcccccaatgcccggccaggctaagccgcagagaccctctcagcccccacctcaggttagggctctgcccgcagcctgacctctagccctggtggcagaggtccctcagctgcgaggctaattgggtgaccaccgattccagctgcggttaatccagcttgggcctgtctgcactgcgatcctcttgggctctcctaggatccccccatgccccgtaagaggtggaagacgcttccttccaggacagcaggctttgagtccagcacccccagcctgcctttgccaccagccccaccctgcagagtatatgaggcttgacagagtctgccccctcccccactgcaccccaagagagagagccccagccagcggaacagtttctattaccccctccctgcccccagacccatgtgatttctgctttcttctttagcaagatattctggtttctagataaggaagagtctctaatgagcccccgagccccagtctcttcagactcatggattggtctgaggggtctgaacgtctcctagccaatcagaactggctgtggaccaccctagcacggccacctctcagggccactggcaggccttcctgagttagatttgtagttgcatatttagctttgcacatttgaaataaaccacggttgcagccaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1523 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
GeneID:1523 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:1523 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IEA
GeneID:1523 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:1523 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:1523 -> Biological process: GO:0000301 [retrograde transport, vesicle recycling within Golgi] evidence: IEA
GeneID:1523 -> Biological process: GO:0001822 [kidney development] evidence: IEA
GeneID:1523 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:1523 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:1523 -> Biological process: GO:0006891 [intra-Golgi vesicle-mediated transport] evidence: IEA
GeneID:1523 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS
GeneID:1523 -> Biological process: GO:0030324 [lung development] evidence: IEA
GeneID:1523 -> Biological process: GO:0042491 [auditory receptor cell differentiation] evidence: IEA
GeneID:1523 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
GeneID:1523 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1523 -> Cellular component: GO:0030173 [integral to Golgi membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.