GGRNA Home | Help | Advanced search

2019-03-23 03:27:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001199859            4335 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 2, mRNA.
ACCESSION   NM_001199859
VERSION     NM_001199859.1  GI:315434239
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4335)
  AUTHORS   Yamakawa,D., Kidoya,H., Sakimoto,S., Jia,W., Naito,H. and
            Takakura,N.
  TITLE     Ligand-independent Tie2 dimers mediate kinase activity stimulated
            by high dose angiopoietin-1
  JOURNAL   J. Biol. Chem. 288 (18), 12469-12477 (2013)
   PUBMED   23504320
  REMARK    GeneRIF: ligand-independent dimerization of Tie2 is essential for a
            strong response upon stimulation with high dose Ang1.
REFERENCE   2  (bases 1 to 4335)
  AUTHORS   Yu,X., Seegar,T.C., Dalton,A.C., Tzvetkova-Robev,D., Goldgur,Y.,
            Rajashankar,K.R., Nikolov,D.B. and Barton,W.A.
  TITLE     Structural basis for angiopoietin-1-mediated signaling initiation
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (18), 7205-7210 (2013)
   PUBMED   23592718
  REMARK    GeneRIF: the crystal structures of Ang1 both unbound and in complex
            with the Tie2 ectodomain, are presented.
REFERENCE   3  (bases 1 to 4335)
  AUTHORS   Boscolo,E., Mulliken,J.B. and Bischoff,J.
  TITLE     Pericytes from infantile hemangioma display proangiogenic
            properties and dysregulated angiopoietin-1
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 33 (3), 501-509 (2013)
   PUBMED   23288163
  REMARK    GeneRIF: Preicytes isolated from infantile hemangioma exhibited
            proangiogenic properties and produced low levels of angiopoietin 1.
REFERENCE   4  (bases 1 to 4335)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   5  (bases 1 to 4335)
  AUTHORS   Choi,J.S., Kwak,K.A., Park,M.J., Kim,Y.H., Gil,H.W., Song,H.Y. and
            Hong,S.Y.
  TITLE     Ratio of angiopoietin-2 to angiopoietin-1 predicts mortality in
            acute lung injury induced by paraquat
  JOURNAL   Med. Sci. Monit. 19, 28-33 (2013)
   PUBMED   23302768
  REMARK    GeneRIF: The Ang-2: Ang-1 ratio was significantly higher in the
            early death group (2.41 +/- 2.54) than in the survivors (0.90 +/-
            0.49) and the late death group (1.33 +/- 0.64).
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4335)
  AUTHORS   Ristimaki,A., Narko,K., Enholm,B., Joukov,V. and Alitalo,K.
  TITLE     Proinflammatory cytokines regulate expression of the lymphatic
            endothelial mitogen vascular endothelial growth factor-C
  JOURNAL   J. Biol. Chem. 273 (14), 8413-8418 (1998)
   PUBMED   9525952
REFERENCE   7  (bases 1 to 4335)
  AUTHORS   Maisonpierre,P.C., Suri,C., Jones,P.F., Bartunkova,S.,
            Wiegand,S.J., Radziejewski,C., Compton,D., McClain,J.,
            Aldrich,T.H., Papadopoulos,N., Daly,T.J., Davis,S., Sato,T.N. and
            Yancopoulos,G.D.
  TITLE     Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo
            angiogenesis
  JOURNAL   Science 277 (5322), 55-60 (1997)
   PUBMED   9204896
REFERENCE   8  (bases 1 to 4335)
  AUTHORS   Suri,C., Jones,P.F., Patan,S., Bartunkova,S., Maisonpierre,P.C.,
            Davis,S., Sato,T.N. and Yancopoulos,G.D.
  TITLE     Requisite role of angiopoietin-1, a ligand for the TIE2 receptor,
            during embryonic angiogenesis
  JOURNAL   Cell 87 (7), 1171-1180 (1996)
   PUBMED   8980224
REFERENCE   9  (bases 1 to 4335)
  AUTHORS   Davis,S., Aldrich,T.H., Jones,P.F., Acheson,A., Compton,D.L.,
            Jain,V., Ryan,T.E., Bruno,J., Radziejewski,C., Maisonpierre,P.C.
            and Yancopoulos,G.D.
  TITLE     Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by
            secretion-trap expression cloning
  JOURNAL   Cell 87 (7), 1161-1169 (1996)
   PUBMED   8980223
REFERENCE   10 (bases 1 to 4335)
  AUTHORS   Ruegg,C. and Pytela,R.
  TITLE     Sequence of a human transcript expressed in T-lymphocytes and
            encoding a fibrinogen-like protein
  JOURNAL   Gene 160 (2), 257-262 (1995)
   PUBMED   7642106
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BX648814.1, AY124380.1,
            BC152411.1 and CX867178.1.
            
            Summary: Angiopoietins are proteins with important roles in
            vascular development and angiogenesis. All angiopoietins bind with
            similar affinity to an endothelial cell-specific tyrosine-protein
            kinase receptor. The protein encoded by this gene is a secreted
            glycoprotein that activates the receptor by inducing its tyrosine
            phosphorylation. It plays a critical role in mediating reciprocal
            interactions between the endothelium and surrounding matrix and
            mesenchyme and inhibits endothelial permeability. The protein also
            contributes to blood vessel maturation and stability, and may be
            involved in early development of the heart. Alternative splicing
            results in multiple transcript variants encoding distinct
            isoforms.[provided by RefSeq, Dec 2010].
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            splice site in the coding region, compared to variant 1, which
            results in an isoform (2) that is one amino acid shorter than
            isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB084454.1, AY124380.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-468               BX648814.1         31-498
            469-1962            AY124380.1         1-1494
            1963-4326           BC152411.1         1849-4212
            4327-4335           CX867178.1         26-34               c
FEATURES             Location/Qualifiers
     source          1..4335
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q23.1"
     gene            1..4335
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="angiopoietin 1"
                     /db_xref="GeneID:284"
                     /db_xref="HGNC:484"
                     /db_xref="MIM:601667"
     exon            1..765
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    388..390
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="upstream in-frame stop codon"
     CDS             469..1962
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; ANG-1"
                     /codon_start=1
                     /product="angiopoietin-1 isoform 2 precursor"
                     /protein_id="NP_001186788.1"
                     /db_xref="GI:315434240"
                     /db_xref="CCDS:CCDS56551.1"
                     /db_xref="GeneID:284"
                     /db_xref="HGNC:484"
                     /db_xref="MIM:601667"
                     /translation="
MTVFLSFAFLAAILTHIGCSNQRRSPENSGRRYNRIQHGQCAYTFILPEHDGNCRESTTDQYNTNALQRDAPHVEPDFSSQKLQHLEHVMENYTQWLQKLENYIVENMKSEMAQIQQNAVQNHTATMLEIGTSLLSQTAEQTRKLTDVETQVLNQTSRLEIQLLENSLSTYKLEKQLLQQTNEILKIHEKNSLLEHKILEMEGKHKEELDTLKEEKENLQGLVTRQTYIIQELEKQLNRATTNNSVLQKQQLELMDTVHNLVNLCTKEVLLKGGKREEEKPFRDCADVYQAGFNKSGIYTIYINNMPEPKKVFCNMDVNGGGWTVIQHREDGSLDFQRGWKEYKMGFGNPSGEYWLGNEFIFAITSQRQYMLRIELMDWEGNRAYSQYDRFHIGNEKQNYRLYLKGHTGTAGKQSSLILHGADFSTKDADNDNCMCKCALMLTGGWWFDACGPSNLNGMFYTAGQNHGKLNGIKWHYFKGPSYSLRSTTMMIRPLDF
"
     sig_peptide     469..528
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    1306..1953
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="Fibrinogen-related domains (FReDs); C terminal
                     globular domain of fibrinogen. Fibrinogen is involved in
                     blood clotting, being activated by thrombin to assemble
                     into fibrin clots. The N-termini of 2 times 3 chains come
                     together to form a globular...; Region: FReD; cd00087"
                     /db_xref="CDD:28971"
     misc_feature    1669..1671
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="gamma-gamma dimer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28971"
     misc_feature    order(1756..1758,1762..1764,1768..1770)
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28971"
     misc_feature    order(1780..1782,1789..1794,1819..1824)
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /note="polymerization pocket; other site"
                     /db_xref="CDD:28971"
     STS             751..1328
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="Agpt"
                     /db_xref="UniSTS:166624"
     exon            766..921
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            922..1043
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1044..1273
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1274..1401
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     STS             1284..1741
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="Angpt1"
                     /db_xref="UniSTS:471085"
     exon            1402..1503
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1504..1670
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1671..1801
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     exon            1802..4335
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /inference="alignment:Splign:1.39.8"
     variation       2266..2311
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45624134"
     variation       2911
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1954727"
     variation       3184
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41322349"
     variation       3331..3376
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:45532734"
     STS             3546..3682
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="RH25244"
                     /db_xref="UniSTS:16614"
     variation       3561
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41343148"
     variation       3618..3663
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45545232"
     variation       3663
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41364248"
     variation       3671
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41421548"
     variation       3783
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41415945"
     STS             3857..4098
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /standard_name="RH17369"
                     /db_xref="UniSTS:81911"
     variation       4161..4205
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace=""
                     /replace="cattt"
                     /db_xref="dbSNP:45614542"
     variation       4197..4237
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45517437"
     variation       4202..4203
                     /gene="ANGPT1"
                     /gene_synonym="AGP1; AGPT; ANG1"
                     /replace=""
                     /replace="tttca"
                     /db_xref="dbSNP:41516446"
ORIGIN      
ggggcacactcatgcattcctgtcaagtcatcttgtgaaaggctgcctgcttccagcttggcttggatgtgcaaccttaataaaactcactgaggtctgggagaaaatagcagatctgcagcagatagggtagaggaaagggtctagaatatgtacacgcagctgactcaggcaggctccatgctgaacggtcacacagagaggaaacaataaatctcagctactatgcaataaatatctcaagttttaacgaagaaaaacatcattgcagtgaaataaaaaattttaaaattttagaacaaagctaacaaatggctagttttctatgattcttcttcaaacgctttctttgagggggaaagagtcaaacaaacaagcagttttacctgaaataaagaactagttttagaggtcagaagaaaggagcaagttttgcgagaggcacggaaggagtgtgctggcagtacaatgacagttttcctttcctttgctttcctcgctgccattctgactcacatagggtgcagcaatcagcgccgaagtccagaaaacagtgggagaagatataaccggattcaacatgggcaatgtgcctacactttcattcttccagaacacgatggcaactgtcgtgagagtacgacagaccagtacaacacaaacgctctgcagagagatgctccacacgtggaaccggatttctcttcccagaaacttcaacatctggaacatgtgatggaaaattatactcagtggctgcaaaaacttgagaattacattgtggaaaacatgaagtcggagatggcccagatacagcagaatgcagttcagaaccacacggctaccatgctggagataggaaccagcctcctctctcagactgcagagcagaccagaaagctgacagatgttgagacccaggtactaaatcaaacttctcgacttgagatacagctgctggagaattcattatccacctacaagctagagaagcaacttcttcaacagacaaatgaaatcttgaagatccatgaaaaaaacagtttattagaacataaaatcttagaaatggaaggaaaacacaaggaagagttggacaccttaaaggaagagaaagagaaccttcaaggcttggttactcgtcaaacatatataatccaggagctggaaaagcaattaaacagagctaccaccaacaacagtgtccttcagaagcagcaactggagctgatggacacagtccacaaccttgtcaatctttgcactaaagaagttttactaaagggaggaaaaagagaggaagagaaaccatttagagactgtgcagatgtatatcaagctggttttaataaaagtggaatctacactatttatattaataatatgccagaacccaaaaaggtgttttgcaatatggatgtcaatgggggaggttggactgtaatacaacatcgtgaagatggaagtctagatttccaaagaggctggaaggaatataaaatgggttttggaaatccctccggtgaatattggctggggaatgagtttatttttgccattaccagtcagaggcagtacatgctaagaattgagttaatggactgggaagggaaccgagcctattcacagtatgacagattccacataggaaatgaaaagcaaaactataggttgtatttaaaaggtcacactgggacagcaggaaaacagagcagcctgatcttacacggtgctgatttcagcactaaagatgctgataatgacaactgtatgtgcaaatgtgccctcatgttaacaggaggatggtggtttgatgcttgtggcccctccaatctaaatggaatgttctatactgcgggacaaaaccatggaaaactgaatgggataaagtggcactacttcaaagggcccagttactccttacgttccacaactatgatgattcgacctttagatttttgaaagcgcaatgtcagaagcgattatgaaagcaacaaagaaatccggagaagctgccaggtgagaaactgtttgaaaacttcagaagcaaacaatattgtctcccttccagcaataagtggtagttatgtgaagtcaccaaggttcttgaccgtgaatctggagccgtttgagttcacaagagtctctacttggggtgacagtgctcacgtggctcgactatagaaaactccactgactgtcgggctttaaaaagggaagaaactgctgagcttgctgtgcttcaaactactactggaccttattttggaactatggtagccagatgataaatatggttaatttcatgtaaaacagaaaaaaagagtgaaaaagagaatatacatgaagaatagaaacaagcctgccataatcctttggaaaagatgtattataccagtgaaaaggtgttatatctatgcaaacctactaacaaattatactgttgcacaattttgataaaaatttagaacagcattgtcctctgagttggttaaatgttaatggatttcagaagcctaattccagtatcatacttactagttgatttctgcttacccatcttcaaatgaaaattccatttttgtaagccataatgaactgtagtacatggacaataagtgtgtggtagaaacaaactccattactctgatttttgatacagttttcagaaaaagaaatgaacataatcaagtaaggatgtatgtggtgaaaacttaccacccccatactatggttttcatttactctaaaaactgattgaatgatatataaatatatttatagcctgagtaaagttaaaagaatgtaaaatatatcatcaagttcttaaaataatatacatgcatttaatatttcctttgatattatacaggaaagcaatattttggagtatgttaagttgaagtaaaagcaagtactctggagcagttcattttacagtatctacttgcatgtgtatacatacatgtaacttcattattttaaaaatatttttagaactccaatactcaccctgttatgtcttgctaatttaaattttgctaattaactgaaacatgcttaccagattcacactgttccagtgtctataaaagaaacactttgaagtctataaaaaataaaataattataaatatcattgtacatagcatgtttatatctgcaaaaaacctaatagctaattaatctggaatatgcaacattgtccttaattgatgcaaataacacaaatgctcaaagaaatctactatatcccttaatgaaatacatcattcttcatatatttctccttcagtccattcccttaggcaatttttaatttttaaaaattattatcaggggagaaaaattggcaaaactattatatgtaagggaaatatatacaaaaagaaaattaatcatagtcacctgactaagaaattctgactgctagttgccataaataactcaatggaaatattcctatgggataatgtattttaagtgaatttttggggtgcttgaagttactgcattattttatcaagaagtcttctctgcctgtaagtgtccaaggttatgacagtaaacagtttttattaaaacatgagtcactatgggatgagaaaattgaaataaagctactgggcctcctctcataaaagagacagttgttggcaaggtagcaataccagtttcaaacttggtgacttgatccactatgccttaatggtttcctccatttgagaaaataaagctattcacattgttaagaaaaatactttttaaagtttaccatcaagtcttttttatatttatgtgtctgtattctacccctttttgccttacaagtgatatttgcaggtattataccatttttctattcttggtggcttcttcatagcaggtaagcctctccttctaaaaacttctcaactgttttcatttaagggaaagaaaatgagtattttgtccttttgtgttcctacagacactttcttaaaccagtttttggataaagaatactatttccaaactcatattacaaaaacaaaataaaataataaaaaaagaaagcatgatatttactgttttgttgtctgggtttgagaaatgaaatattgtttccaattatttataataaatcagtataaaatgttttatgattgttatgtgtattatgtaatacgtacatgtttatggcaatttaacatgtgtattcttttaattgtttcagaataggataattaggtattcgaattttgtctttaaaattcatgtggtttctatgcaaagttcttcatatcatcacaacattatttgatttaaataaaattgaaagtaatatttgtgcaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:284 -> Molecular function: GO:0030971 [receptor tyrosine kinase binding] evidence: IPI
            GeneID:284 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:284 -> Biological process: GO:0001936 [regulation of endothelial cell proliferation] evidence: IDA
            GeneID:284 -> Biological process: GO:0002040 [sprouting angiogenesis] evidence: IDA
            GeneID:284 -> Biological process: GO:0002092 [positive regulation of receptor internalization] evidence: IDA
            GeneID:284 -> Biological process: GO:0007162 [negative regulation of cell adhesion] evidence: IDA
            GeneID:284 -> Biological process: GO:0007171 [activation of transmembrane receptor protein tyrosine kinase activity] evidence: IDA
            GeneID:284 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:284 -> Biological process: GO:0010595 [positive regulation of endothelial cell migration] evidence: IDA
            GeneID:284 -> Biological process: GO:0014068 [positive regulation of phosphatidylinositol 3-kinase cascade] evidence: IEA
            GeneID:284 -> Biological process: GO:0014842 [regulation of satellite cell proliferation] evidence: IDA
            GeneID:284 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA
            GeneID:284 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:284 -> Biological process: GO:0030210 [heparin biosynthetic process] evidence: IDA
            GeneID:284 -> Biological process: GO:0031398 [positive regulation of protein ubiquitination] evidence: IDA
            GeneID:284 -> Biological process: GO:0031589 [cell-substrate adhesion] evidence: IEA
            GeneID:284 -> Biological process: GO:0033138 [positive regulation of peptidyl-serine phosphorylation] evidence: IEA
            GeneID:284 -> Biological process: GO:0034394 [protein localization to cell surface] evidence: IDA
            GeneID:284 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IDA
            GeneID:284 -> Biological process: GO:0043116 [negative regulation of vascular permeability] evidence: IDA
            GeneID:284 -> Biological process: GO:0043536 [positive regulation of blood vessel endothelial cell migration] evidence: IDA
            GeneID:284 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IEA
            GeneID:284 -> Biological process: GO:0048014 [Tie signaling pathway] evidence: IDA
            GeneID:284 -> Biological process: GO:0050731 [positive regulation of peptidyl-tyrosine phosphorylation] evidence: IDA
            GeneID:284 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
            GeneID:284 -> Biological process: GO:0050918 [positive chemotaxis] evidence: IDA
            GeneID:284 -> Biological process: GO:0051897 [positive regulation of protein kinase B signaling cascade] evidence: IDA
            GeneID:284 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: IDA
            GeneID:284 -> Biological process: GO:0072012 [glomerulus vasculature development] evidence: ISS
            GeneID:284 -> Biological process: GO:2000352 [negative regulation of endothelial cell apoptotic process] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:284 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:284 -> Cellular component: GO:0005902 [microvillus] evidence: IDA
            GeneID:284 -> Cellular component: GO:0045121 [membrane raft] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.