Home |
Help |
Advanced search
2024-04-23 16:32:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001199649 4600 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens protein tyrosine kinase 2 (PTK2), transcript variant
3, mRNA.
ACCESSION NM_001199649
VERSION NM_001199649.1 GI:313851043
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4600)
AUTHORS Crompton,B.D., Carlton,A.L., Thorner,A.R., Christie,A.L., Du,J.,
Calicchio,M.L., Rivera,M.N., Fleming,M.D., Kohl,N.E., Kung,A.L. and
Stegmaier,K.
TITLE High-throughput tyrosine kinase activity profiling identifies FAK
as a candidate therapeutic target in Ewing sarcoma
JOURNAL Cancer Res. 73 (9), 2873-2883 (2013)
PUBMED 23536552
REMARK GeneRIF: small-molecule inhibition of FAK attenuates Ewing sarcoma
tumor growth in vivo
REFERENCE 2 (bases 1 to 4600)
AUTHORS Ritt,M., Guan,J.L. and Sivaramakrishnan,S.
TITLE Visualizing and manipulating focal adhesion kinase regulation in
live cells
JOURNAL J. Biol. Chem. 288 (13), 8875-8886 (2013)
PUBMED 23393139
REMARK GeneRIF: Tyr-397 phosphorylation, rather than kinase activity of
FAK, is the key determinant of cell migration
REFERENCE 3 (bases 1 to 4600)
AUTHORS Chen,D., Zhang,B., Kang,J., Ma,X., Lu,Y. and Gong,L.
TITLE Expression and clinical significance of FAK, ILK, and PTEN in
salivary adenoid cystic carcinoma
JOURNAL Acta Otolaryngol. 133 (2), 203-208 (2013)
PUBMED 23186335
REMARK GeneRIF: FAK expression was positively correlated with ILK
expression but negatively correlated with PTEN expression in SACC
tissues. FAK and ILK expression was positively associated with
advanced stage
REFERENCE 4 (bases 1 to 4600)
AUTHORS Serna-Marquez,N., Villegas-Comonfort,S., Galindo-Hernandez,O.,
Navarro-Tito,N., Millan,A. and Salazar,E.P.
TITLE Role of LOXs and COX-2 on FAK activation and cell migration induced
by linoleic acid in MDA-MB-231 breast cancer cells
JOURNAL Cell Oncol (Dordr) 36 (1), 65-77 (2013)
PUBMED 23179791
REMARK GeneRIF: Data indicate that focal adhesion kinase (FAK) activation
and cell migration require Src, Gi/Go, COX-2 and LOXs activities.
REFERENCE 5 (bases 1 to 4600)
AUTHORS Ross,S.H., Spanjaard,E., Post,A., Vliem,M.J., Kristyanto,H.,
Bos,J.L. and de Rooij,J.
TITLE Rap1 can bypass the FAK-Src-Paxillin cascade to induce cell
spreading and focal adhesion formation
JOURNAL PLoS ONE 7 (11), E50072 (2012)
PUBMED 23209645
REMARK GeneRIF: Rap1 can induce cell adhesion and stimulate an accelerated
rate of cell spreading through mechanisms that bypass the canonical
FAK-Src-Paxillin signalling cascade
REFERENCE 6 (bases 1 to 4600)
AUTHORS Polte,T.R. and Hanks,S.K.
TITLE Interaction between focal adhesion kinase and Crk-associated
tyrosine kinase substrate p130Cas
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (23), 10678-10682 (1995)
PUBMED 7479864
REFERENCE 7 (bases 1 to 4600)
AUTHORS Guinebault,C., Payrastre,B., Racaud-Sultan,C., Mazarguil,H.,
Breton,M., Mauco,G., Plantavid,M. and Chap,H.
TITLE Integrin-dependent translocation of phosphoinositide 3-kinase to
the cytoskeleton of thrombin-activated platelets involves specific
interactions of p85 alpha with actin filaments and focal adhesion
kinase
JOURNAL J. Cell Biol. 129 (3), 831-842 (1995)
PUBMED 7537275
REFERENCE 8 (bases 1 to 4600)
AUTHORS Calalb,M.B., Polte,T.R. and Hanks,S.K.
TITLE Tyrosine phosphorylation of focal adhesion kinase at sites in the
catalytic domain regulates kinase activity: a role for Src family
kinases
JOURNAL Mol. Cell. Biol. 15 (2), 954-963 (1995)
PUBMED 7529876
REFERENCE 9 (bases 1 to 4600)
AUTHORS Bergman,M., Joukov,V., Virtanen,I. and Alitalo,K.
TITLE Overexpressed Csk tyrosine kinase is localized in focal adhesions,
causes reorganization of alpha v beta 5 integrin, and interferes
with HeLa cell spreading
JOURNAL Mol. Cell. Biol. 15 (2), 711-722 (1995)
PUBMED 7529872
REFERENCE 10 (bases 1 to 4600)
AUTHORS Schaller,M.D., Hildebrand,J.D., Shannon,J.D., Fox,J.W., Vines,R.R.
and Parsons,J.T.
TITLE Autophosphorylation of the focal adhesion kinase, pp125FAK, directs
SH2-dependent binding of pp60src
JOURNAL Mol. Cell. Biol. 14 (3), 1680-1688 (1994)
PUBMED 7509446
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB478006.1, DA236314.1,
AK304356.1, DA994616.1, AL832961.1, AB209083.1 and BF434494.1.
This sequence is a reference standard in the RefSeqGene project.
Summary: This gene encodes a cytoplasmic protein tyrosine kinase
which is found concentrated in the focal adhesions that form
between cells growing in the presence of extracellular matrix
constituents. The encoded protein is a member of the FAK subfamily
of protein tyrosine kinases but lacks significant sequence
similarity to kinases from other subfamilies. Activation of this
gene may be an important early step in cell growth and
intracellular signal transduction pathways triggered in response to
certain neural peptides or to cell interactions with the
extracellular matrix. Several transcript variants encoding
different isoforms have been found for this gene, but the
full-length natures of only three of them have been determined.
[provided by RefSeq, Dec 2010].
Transcript Variant: This variant (3) differs in the 5' UTR and
coding sequence, and contains two additional in-frame segments near
the 3' end of the coding sequence, compared to variant 2. The
resulting isoform (c) is shorter at the N-terminus and contains two
additional segments in the C-terminus compared to isoform b.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK304356.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-28 DB478006.1 1-28
29-155 DA236314.1 1-127
156-860 AK304356.1 1-705
861-941 DA994616.1 464-544
942-4172 AK304356.1 787-4017
4173-4212 AL832961.1 4006-4045
4213-4569 AB209083.1 3893-4249
4570-4600 BF434494.1 1-31 c
FEATURES Location/Qualifiers
source 1..4600
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q24.3"
gene 1..4600
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="protein tyrosine kinase 2"
/db_xref="GeneID:5747"
/db_xref="HGNC:9611"
/db_xref="MIM:600758"
exon 1..189
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 190..278
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
misc_feature 266..268
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="upstream in-frame stop codon"
exon 279..505
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
CDS 311..3508
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/EC_number="2.7.10.2"
/note="isoform c is encoded by transcript variant 3; focal
adhesion kinase 1; FAK-related non-kinase polypeptide;
FADK 1; protein phosphatase 1, regulatory subunit 71;
focal adhesion kinase-related nonkinase; protein
phosphatase 1 regulatory subunit 71; PTK2 protein tyrosine
kinase 2"
/codon_start=1
/product="focal adhesion kinase 1 isoform c"
/protein_id="NP_001186578.1"
/db_xref="GI:313851044"
/db_xref="CCDS:CCDS56557.1"
/db_xref="GeneID:5747"
/db_xref="HGNC:9611"
/db_xref="MIM:600758"
/translation="
MAAAYLDPNLNHTPNSSTKTHLGTGMERSPGAMERVLKVFHYFESNSEPTTWASIIRHGDATDVRGIIQKIVDSHKVKHVACYGFRLSHLRSEEVHWLHVDMGVSSVREKYELAHPPEEWKYELRIRYLPKGFLNQFTEDKPTLNFFYQQVKSDYMLEIADQVDQEIALKLGCLEIRRSYWEMRGNALEKKSNYEVLEKDVGLKRFFPKSLLDSVKAKTLRKLIQQTFRQFANLNREESILKFFEILSPVYRFDKECFKCALGSSWIISVELAIGPEEGISYLTDKGCNPTHLADFTQVQTIQYSNSEDKDRKGMLQLKIAGAPEPLTVTAPSLTIAENMADLIDGYCRLVNGTSQSFIIRPQKEGERALPSIPKLANSEKQGMRTHAVSVSETDDYAEIIDEEDTYTMPSTRDYEIQRERIELGRCIGEGQFGDVHQGIYMSPENPALAVAIKTCKNCTSDSVREKFLQEALTMRQFDHPHIVKLIGVITENPVWIIMELCTLGELRSFLQVRKYSLDLASLILYAYQLSTALAYLESKRFVHRDIAARNVLVSSNDCVKLGDFGLSRYMEDSTYYKASKGKLPIKWMAPESINFRRFTSASDVWMFGVCMWEILMHGVKPFQGVKNNDVIGRIENGERLPMPPNCPPTLYSLMTKCWAYDPSRRPRFTELKAQLSTILEEEKAQQEERMRMESRRQATVSWDSGGSDEAPPKPSRPGYPSPRSSEGFYPSPQHMVQTNHYQVSGYPGSHGITAMAGSIYPGQASLLDQTDSWNHRPQEIAMWQPNVEDSTVLDLRGIGQVLPTHLMEERLIRQQQEMEEDQRWLEKEERFLKPDVRLSRGSIDREDGSLQGPIGNQHIYQPVGKPGKEEKNWAERNPAAPPKKPPRPGAPGHLGSLASLSSPADSYNEGVKPWRLQPQEISPPPTANLDRSNDKVYENVTGLVKAVIEMSSKIQPAPPEEYVPMVKEVGLALRTLLATVDETIPLLPASTHREIEMAQKLLNSDLGELINKMKLAQQYVMTSLQQEYKKQMLTAAHALAVDAKNLLDVIDQARLKMLGQTRPH
"
misc_feature 314..316
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylalanine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); acetylation site"
misc_feature 323..325
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 347..349
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 395..397
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q05397.2); phosphorylation site"
misc_feature 416..1084
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="Band 4.1 homologues; Region: B41; smart00295"
/db_xref="CDD:197635"
misc_feature 737..1054
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="FERM central domain; Region: FERM_M; pfam00373"
/db_xref="CDD:201187"
misc_feature 1499..1501
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 1529..1531
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 1553..2362
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="Catalytic domain of the Protein Tyrosine Kinase,
Focal Adhesion Kinase; Region: PTKc_FAK; cd05056"
/db_xref="CDD:133187"
misc_feature 1574..2338
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="Protein tyrosine kinase; Region: Pkinase_Tyr;
pfam07714"
/db_xref="CDD:203736"
misc_feature order(1592..1594,1598..1606,1616..1618,1664..1666,
1670..1672,1721..1723,1808..1810,1814..1816,1826..1828,
1946..1948,1958..1963,1967..1969,2000..2002,2051..2065,
2090..2092,2192..2194)
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="active site"
/db_xref="CDD:133187"
misc_feature order(1592..1594,1598..1606,1616..1618,1664..1666,
1670..1672,1721..1723,1808..1810,1814..1816,1826..1828)
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:133187"
misc_feature order(1946..1948,1958..1960,2051..2065,2090..2092,
2192..2194)
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:133187"
misc_feature 1997..2071
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="activation loop (A-loop); other site"
/db_xref="CDD:133187"
misc_feature 2018..2020
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 2036..2038
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by RET and SRC; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 2039..2041
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by RET and SRC; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 2048..2050
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q05397.2); phosphorylation site"
misc_feature 2474..2476
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q05397.2); phosphorylation site"
misc_feature 2504..2506
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CDK5; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 2891..2893
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 2999..3001
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q05397.2); phosphorylation site"
misc_feature 3077..3079
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q05397.2); phosphorylation site"
misc_feature 3083..3505
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q05397.2);
Region: Interaction with ARHGEF28 (By similarity)"
misc_feature 3089..3505
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/note="Focal adhesion targeting region; Region: Focal_AT;
pfam03623"
/db_xref="CDD:146323"
misc_feature 3089..3091
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
misc_feature 3122..3124
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q05397.2); phosphorylation site"
exon 506..672
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 673..760
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 761..840
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 841..903
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 904..958
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 959..1099
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1100..1177
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1178..1285
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1286..1403
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1404..1434
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1435..1487
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
STS 1445..1741
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="Ptk2"
/db_xref="UniSTS:516686"
exon 1488..1544
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1545..1642
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1643..1727
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1728..1828
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1829..1944
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 1945..2045
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2046..2135
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2136..2340
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2341..2452
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2453..2539
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2540..2677
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
variation 2642
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/replace="c"
/replace="t"
/db_xref="dbSNP:1126498"
exon 2678..2809
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2810..2872
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2873..2942
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 2943..3049
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 3050..3058
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 3059..3214
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 3215..3295
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
exon 3296..4592
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/inference="alignment:Splign:1.39.8"
STS 3520..3869
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="SHGC-12766"
/db_xref="UniSTS:44306"
STS 3553..3689
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="WI-18850"
/db_xref="UniSTS:37328"
STS 3582..3858
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="RH69012"
/db_xref="UniSTS:3029"
STS 3841..4006
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="STS-T29673"
/db_xref="UniSTS:29448"
variation 4213
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/replace="a"
/replace="t"
/db_xref="dbSNP:7460"
STS 4359..4550
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="A006E44"
/db_xref="UniSTS:62565"
STS 4359..4550
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="G20751"
/db_xref="UniSTS:62564"
STS 4434..4567
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
/standard_name="WI-11480"
/db_xref="UniSTS:74034"
polyA_signal 4550..4555
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
polyA_site 4572
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
polyA_site 4592
/gene="PTK2"
/gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK;
PPP1R71"
ORIGIN
gcgcacgcgcgcgggcccgcgccgacgcagcacggcctcgagggcgcgagcccgcgccgccgccgccgccgccggtcccggaccactgtgagcccgcggcgtgaggcgtgggaggaagcgcggctgctgtcgcccagcgccgccccgtcgtcgtctgccttcgcttcacggcgccgagccgcggtccgagcagaactggggctcccttgcatcttccagttacaaattcagtgccttctgcagtttccccagagctcctcaagaataacggaagggagaatatgacagatacctagcatctagcaaaataatggcagctgcttaccttgaccccaacttgaatcacacaccaaattcgagtactaagactcacctgggtactggtatggaacgttctcctggtgcaatggagcgagtattaaaggtctttcattattttgaaagcaatagtgagccaaccacctgggccagtattatcaggcatggagatgctactgatgtcaggggcatcattcagaagatagtggacagtcacaaagtaaagcatgtggcctgctatggattccgcctcagtcacctgcggtcagaggaggttcactggcttcacgtggatatgggcgtctccagtgtgagggagaagtatgagcttgctcacccaccagaggagtggaaatatgaattgagaattcgttatttgccaaaaggatttctaaaccagtttactgaagataagccaactttgaatttcttctatcaacaggtgaagagcgattatatgttagagatagctgatcaagtggaccaggaaattgctttgaagttgggttgtctagaaatacggcgatcatactgggagatgcggggcaatgcactagaaaagaagtctaactatgaagtattagaaaaagatgttggtttaaagcgattttttcctaagagtttactggattctgtcaaggccaaaacactaagaaaactgatccaacaaacatttagacaatttgccaaccttaatagagaagaaagtattctgaaattctttgagatcctgtctccagtctacagatttgataaggaatgcttcaagtgtgctcttggttcaagctggattatttcagtggaactggcaatcggcccagaagaaggaatcagttacctaacggacaagggctgcaatcccacacatcttgctgacttcactcaagtgcaaaccattcagtattcaaacagtgaagacaaggacagaaaaggaatgctacaactaaaaatagcaggtgcacccgagcctctgacagtgacggcaccatccctaaccattgcggagaatatggctgacctaatagatgggtactgccggctggtgaatggaacctcgcagtcatttatcatcagacctcagaaagaaggtgaacgggctttgccatcaataccaaagttggccaacagcgaaaagcaaggcatgcggacacacgccgtctctgtgtcagaaacagatgattatgctgagattatagatgaagaagatacttacaccatgccctcaaccagggattatgagattcaaagagaaagaatagaacttggacgatgtattggagaaggccaatttggagatgtacatcaaggcatttatatgagtccagagaatccagctttggcggttgcaattaaaacatgtaaaaactgtacttcggacagcgtgagagagaaatttcttcaagaagccttaacaatgcgtcagtttgaccatcctcatattgtgaagctgattggagtcatcacagagaatcctgtctggataatcatggagctgtgcacacttggagagctgaggtcatttttgcaagtaaggaaatacagtttggatctagcatctttgatcctgtatgcctatcagcttagtacagctcttgcatatctagagagcaaaagatttgtacacagggacattgctgctcggaatgttctggtgtcctcaaatgattgtgtaaaattaggagactttggattatcccgatatatggaagatagtacttactacaaagcttccaaaggaaaattgcctattaaatggatggctccagagtcaatcaattttcgacgttttacctcagctagtgacgtatggatgtttggtgtgtgtatgtgggagatactgatgcatggtgtgaagccttttcaaggagtgaagaacaatgatgtaatcggtcgaattgaaaatggggaaagattaccaatgcctccaaattgtcctcctaccctctacagccttatgacgaaatgctgggcctatgaccccagcaggcggcccaggtttactgaacttaaagctcagctcagcacaatcctggaggaagagaaggctcagcaagaagagcgcatgaggatggagtccagaagacaggccacagtgtcctgggactccggagggtctgatgaagcaccgcccaagcccagcagaccgggttatcccagtccgaggtccagcgaaggattttatcccagcccacagcacatggtacaaaccaatcattaccaggtttctggctaccctggttcacatggaatcacagccatggctggcagcatctatccaggtcaggcatctcttttggaccaaacagattcatggaatcatagacctcaggagatagcaatgtggcagcccaatgtggaggactctacagtattggacctgcgagggattgggcaagtgttgccaacccatctgatggaagagcgtctaatccgacagcaacaggaaatggaagaagatcagcgctggctggaaaaagaggaaagatttctgaaacctgatgtgagactctctcgaggcagtattgacagggaggatggaagtcttcagggtccgattggaaaccaacatatatatcagcctgtgggtaaaccaggtaaagaagaaaagaattgggcggaaagaaatcctgcagctccaccaaagaaaccgcctcgccctggagctcccggtcatctgggaagccttgccagcctcagcagccctgctgacagctacaacgagggtgtcaagccatggaggcttcagccccaggaaatcagcccccctcctactgccaacctggaccggtcgaatgataaggtgtacgagaatgtgacgggcctggtgaaagctgtcatcgagatgtccagtaaaatccagccagccccaccagaggagtatgtccctatggtgaaggaagtcggcttggccctgaggacattattggccactgtggatgagaccattcccctcctaccagccagcacccaccgagagattgagatggcacagaagctattgaactctgacctgggtgagctcatcaacaagatgaaactggcccagcagtatgtcatgaccagcctccagcaagagtacaaaaagcaaatgctgactgctgctcacgccctggctgtggatgccaaaaacttactcgatgtcattgaccaagcaagactgaaaatgcttgggcagacgagaccacactgagcctcccctaggagcacgtcttgctaccctcttttgaagatgttctctagccttccaccagcagcgaggaattaaccctgtgtcctcagtcgccagcacttacagctccaacttttttgaatgaccatctggttgaaaaatctttctcatataagtttaaccacactttgatttgggttcattttttgttttgtttttttcaatcatgatattcagaaaaatccaggatccaaaatgtggcgtttttctaagaatgaaaattatatgtaagcttttaagcatcatgaagaacaatttatgttcacattaagatacgttctaaagggggatggccaaggggtgacatcttaattcctaaactaccttagctgcatagtggaagaggagagcatgaagcaaagaattccaggaaacccaagaggctgagaattcttttgtctaccatagaattattatccagactggaatttttgtttgttagaacacccttcagttgcaatatgctaatcccactttacaaagaatataaaagctatattttgaagacttgagttatttcagaaaaaactacagccctttttgtcttacctgccttttactttcgtgtggatatgtgaagcattgggtcgggaactagctgtagaacacaactaaaaactcatgtcttttttcacagaataatgtgccagttttttgtagcaatgttatttctcttggaagcagaaatgctttgtaccagagcacctccaaactgcattgaggagaagttccagaaccatcccctttttccatttttatataatttataaagaaagattaaagccatgttgactattttacagccactggagttaactaacccttccttgtatctgtcttcccaggagagaatgaagcaaaacaggaatttggttttcttttgatgtccagttacaccatccattctgttaattttgaaaaaatataccctccctttagtttgttgggggatataaattattctcaggaagaatataatgaactgtacagttactttgacctattaaaaaggtgttaccagtaaagttcttgttgtaatatccttaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5747 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
GeneID:5747 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:5747 -> Molecular function: GO:0004715 [non-membrane spanning protein tyrosine kinase activity] evidence: IDA
GeneID:5747 -> Molecular function: GO:0004871 [signal transducer activity] evidence: IEA
GeneID:5747 -> Molecular function: GO:0005178 [integrin binding] evidence: IEA
GeneID:5747 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5747 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:5747 -> Molecular function: GO:0008432 [JUN kinase binding] evidence: IDA
GeneID:5747 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
GeneID:5747 -> Molecular function: GO:0042169 [SH2 domain binding] evidence: IPI
GeneID:5747 -> Molecular function: GO:0043548 [phosphatidylinositol 3-kinase binding] evidence: IEA
GeneID:5747 -> Biological process: GO:0000226 [microtubule cytoskeleton organization] evidence: IEA
GeneID:5747 -> Biological process: GO:0001525 [angiogenesis] evidence: TAS
GeneID:5747 -> Biological process: GO:0001570 [vasculogenesis] evidence: IEA
GeneID:5747 -> Biological process: GO:0001764 [neuron migration] evidence: IEA
GeneID:5747 -> Biological process: GO:0001890 [placenta development] evidence: TAS
GeneID:5747 -> Biological process: GO:0001934 [positive regulation of protein phosphorylation] evidence: IMP
GeneID:5747 -> Biological process: GO:0003007 [heart morphogenesis] evidence: TAS
GeneID:5747 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5747 -> Biological process: GO:0006921 [cellular component disassembly involved in execution phase of apoptosis] evidence: TAS
GeneID:5747 -> Biological process: GO:0007172 [signal complex assembly] evidence: IEA
GeneID:5747 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IMP
GeneID:5747 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: TAS
GeneID:5747 -> Biological process: GO:0007254 [JNK cascade] evidence: IEA
GeneID:5747 -> Biological process: GO:0007411 [axon guidance] evidence: TAS
GeneID:5747 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
GeneID:5747 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: ISS
GeneID:5747 -> Biological process: GO:0008360 [regulation of cell shape] evidence: IMP
GeneID:5747 -> Biological process: GO:0009612 [response to mechanical stimulus] evidence: IEA
GeneID:5747 -> Biological process: GO:0009749 [response to glucose stimulus] evidence: IEA
GeneID:5747 -> Biological process: GO:0009790 [embryo development] evidence: TAS
GeneID:5747 -> Biological process: GO:0010594 [regulation of endothelial cell migration] evidence: TAS
GeneID:5747 -> Biological process: GO:0014068 [positive regulation of phosphatidylinositol 3-kinase cascade] evidence: IMP
GeneID:5747 -> Biological process: GO:0014911 [positive regulation of smooth muscle cell migration] evidence: IEA
GeneID:5747 -> Biological process: GO:0018108 [peptidyl-tyrosine phosphorylation] evidence: IDA
GeneID:5747 -> Biological process: GO:0021955 [central nervous system neuron axonogenesis] evidence: IEA
GeneID:5747 -> Biological process: GO:0022408 [negative regulation of cell-cell adhesion] evidence: IDA
GeneID:5747 -> Biological process: GO:0030010 [establishment of cell polarity] evidence: TAS
GeneID:5747 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
GeneID:5747 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: IEA
GeneID:5747 -> Biological process: GO:0030307 [positive regulation of cell growth] evidence: IEA
GeneID:5747 -> Biological process: GO:0030335 [positive regulation of cell migration] evidence: IDA
GeneID:5747 -> Biological process: GO:0030336 [negative regulation of cell migration] evidence: IEA
GeneID:5747 -> Biological process: GO:0030644 [cellular chloride ion homeostasis] evidence: IEA
GeneID:5747 -> Biological process: GO:0032319 [regulation of Rho GTPase activity] evidence: TAS
GeneID:5747 -> Biological process: GO:0032355 [response to estradiol stimulus] evidence: IEA
GeneID:5747 -> Biological process: GO:0033628 [regulation of cell adhesion mediated by integrin] evidence: IDA
GeneID:5747 -> Biological process: GO:0038007 [netrin-activated signaling pathway] evidence: TAS
GeneID:5747 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS
GeneID:5747 -> Biological process: GO:0040023 [establishment of nucleus localization] evidence: IEA
GeneID:5747 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IMP
GeneID:5747 -> Biological process: GO:0042493 [response to drug] evidence: IEA
GeneID:5747 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP
GeneID:5747 -> Biological process: GO:0043542 [endothelial cell migration] evidence: IEA
GeneID:5747 -> Biological process: GO:0043552 [positive regulation of phosphatidylinositol 3-kinase activity] evidence: TAS
GeneID:5747 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:5747 -> Biological process: GO:0045444 [fat cell differentiation] evidence: IEA
GeneID:5747 -> Biological process: GO:0045667 [regulation of osteoblast differentiation] evidence: IMP
GeneID:5747 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IEA
GeneID:5747 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IMP
GeneID:5747 -> Biological process: GO:0045909 [positive regulation of vasodilation] evidence: IEA
GeneID:5747 -> Biological process: GO:0046621 [negative regulation of organ growth] evidence: IEA
GeneID:5747 -> Biological process: GO:0046685 [response to arsenic-containing substance] evidence: IEA
GeneID:5747 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:5747 -> Biological process: GO:0048013 [ephrin receptor signaling pathway] evidence: IDA
GeneID:5747 -> Biological process: GO:0048661 [positive regulation of smooth muscle cell proliferation] evidence: IEA
GeneID:5747 -> Biological process: GO:0048870 [cell motility] evidence: TAS
GeneID:5747 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IEA
GeneID:5747 -> Biological process: GO:0050771 [negative regulation of axonogenesis] evidence: IEA
GeneID:5747 -> Biological process: GO:0050806 [positive regulation of synaptic transmission] evidence: IEA
GeneID:5747 -> Biological process: GO:0051493 [regulation of cytoskeleton organization] evidence: TAS
GeneID:5747 -> Biological process: GO:0051893 [regulation of focal adhesion assembly] evidence: TAS
GeneID:5747 -> Biological process: GO:0051897 [positive regulation of protein kinase B signaling cascade] evidence: IMP
GeneID:5747 -> Biological process: GO:0051964 [negative regulation of synapse assembly] evidence: IEA
GeneID:5747 -> Biological process: GO:0060252 [positive regulation of glial cell proliferation] evidence: IEA
GeneID:5747 -> Biological process: GO:0060396 [growth hormone receptor signaling pathway] evidence: IDA
GeneID:5747 -> Biological process: GO:2000060 [positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process] evidence: ISS
GeneID:5747 -> Biological process: GO:2000811 [negative regulation of anoikis] evidence: IMP
GeneID:5747 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:5747 -> Cellular component: GO:0005730 [nucleolus] evidence: IEA
GeneID:5747 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:5747 -> Cellular component: GO:0005815 [microtubule organizing center] evidence: IEA
GeneID:5747 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
GeneID:5747 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5747 -> Cellular component: GO:0005856 [cytoskeleton] evidence: TAS
GeneID:5747 -> Cellular component: GO:0005925 [focal adhesion] evidence: IDA
GeneID:5747 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA
GeneID:5747 -> Cellular component: GO:0014704 [intercalated disc] evidence: IEA
GeneID:5747 -> Cellular component: GO:0016323 [basolateral plasma membrane] evidence: IEA
GeneID:5747 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
GeneID:5747 -> Cellular component: GO:0016604 [nuclear body] evidence: IEA
GeneID:5747 -> Cellular component: GO:0030027 [lamellipodium] evidence: IEA
GeneID:5747 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001186578 -> EC 2.7.10.2
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.