GGRNA Home | Help | Advanced search

2020-10-24 07:16:09, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001198944            5741 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 16,
            mRNA.
ACCESSION   NM_001198944
VERSION     NM_001198944.1  GI:312147281
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5741)
  AUTHORS   Navakauskiene,R., Treigyte,G., Borutinskaite,V.V., Matuzevicius,D.,
            Navakauskas,D. and Magnusson,K.E.
  TITLE     Alpha-Dystrobrevin and its associated proteins in human
            promyelocytic leukemia cells induced to apoptosis
  JOURNAL   J Proteomics 75 (11), 3291-3303 (2012)
   PUBMED   22507200
  REMARK    GeneRIF: apoptosis-induction in HL-60 cells involves not only
            classical markers of apoptosis but also a network
            alpha-DB-associated proteins at the cell membrane, the cytoplasm
            and nucleus, affecting key cellular transport processes and
            cellular structure.
REFERENCE   2  (bases 1 to 5741)
  AUTHORS   Borutinskaite,V.V., Magnusson,K.E. and Navakauskiene,R.
  TITLE     alpha-Dystrobrevin distribution and association with other proteins
            in human promyelocytic NB4 cells treated for granulocytic
            differentiation
  JOURNAL   Mol. Biol. Rep. 38 (5), 3001-3011 (2011)
   PUBMED   20111909
  REMARK    GeneRIF: Results suggest that alpha-dystrobrevin isoforms play a
            central role in cytoskeleton reorganization via their multiple
            interactions with actin and actin-associating proteins.
REFERENCE   3  (bases 1 to 5741)
  AUTHORS   Lyssand,J.S., Whiting,J.L., Lee,K.S., Kastl,R., Wacker,J.L.,
            Bruchas,M.R., Miyatake,M., Langeberg,L.K., Chavkin,C., Scott,J.D.,
            Gardner,R.G., Adams,M.E. and Hague,C.
  TITLE     Alpha-dystrobrevin-1 recruits alpha-catulin to the
            alpha1D-adrenergic receptor/dystrophin-associated protein complex
            signalosome
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 107 (50), 21854-21859 (2010)
   PUBMED   21115837
  REMARK    GeneRIF: Data show that alpha-dystrobrevin-1 recruits
            alpha-catulin, which supersensitizes alpha(1D)-AR functional
            responses by recruiting effector molecules to the signalosome.
REFERENCE   4  (bases 1 to 5741)
  AUTHORS   Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
            Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
            Aloisi,F., Petrucci,T.C. and Ambrosini,E.
  TITLE     MLC1 trafficking and membrane expression in astrocytes: role of
            caveolin-1 and phosphorylation
  JOURNAL   Neurobiol. Dis. 37 (3), 581-595 (2010)
   PUBMED   19931615
REFERENCE   5  (bases 1 to 5741)
  AUTHORS   Bohm,S.V., Constantinou,P., Tan,S., Jin,H. and Roberts,R.G.
  TITLE     Profound human/mouse differences in alpha-dystrobrevin isoforms: a
            novel syntrophin-binding site and promoter missing in mouse and rat
  JOURNAL   BMC Biol. 7, 85 (2009)
   PUBMED   19961569
  REMARK    GeneRIF: Fundamental functional differences between the
            alpha-dystrobrevins of mice and humans raises questions about the
            use of the mouse as a model animal for Duchenne muscular dystrophy.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5741)
  AUTHORS   Sadoulet-Puccio,H.M., Feener,C.A., Schaid,D.J., Thibodeau,S.N.,
            Michels,V.V. and Kunkel,L.M.
  TITLE     The genomic organization of human dystrobrevin
  JOURNAL   Neurogenetics 1 (1), 37-42 (1997)
   PUBMED   10735273
REFERENCE   7  (bases 1 to 5741)
  AUTHORS   Blake,D.J., Nawrotzki,R., Peters,M.F., Froehner,S.C. and
            Davies,K.E.
  TITLE     Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic
            protein
  JOURNAL   J. Biol. Chem. 271 (13), 7802-7810 (1996)
   PUBMED   8631824
REFERENCE   8  (bases 1 to 5741)
  AUTHORS   Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
            Kunkel,L.M.
  TITLE     The three human syntrophin genes are expressed in diverse tissues,
            have distinct chromosomal locations, and each bind to dystrophin
            and its relatives
  JOURNAL   J. Biol. Chem. 271 (5), 2724-2730 (1996)
   PUBMED   8576247
REFERENCE   9  (bases 1 to 5741)
  AUTHORS   Ahn,A.H. and Kunkel,L.M.
  TITLE     Syntrophin binds to an alternatively spliced exon of dystrophin
  JOURNAL   J. Cell Biol. 128 (3), 363-371 (1995)
   PUBMED   7844150
REFERENCE   10 (bases 1 to 5741)
  AUTHORS   Khurana,T.S., Engle,E.C., Bennett,R.R., Silverman,G.A., Selig,S.,
            Bruns,G.A. and Kunkel,L.M.
  TITLE     (CA) repeat polymorphism in the chromosome 18 encoded
            dystrophin-like protein
  JOURNAL   Hum. Mol. Genet. 3 (5), 841 (1994)
   PUBMED   8081380
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DN991561.1, AK295789.1 and
            AC068506.10.
            
            Summary: The protein encoded by this gene belongs to the
            dystrobrevin subfamily of the dystrophin family. This protein is a
            component of the dystrophin-associated protein complex (DPC), which
            consists of dystrophin and several integral and peripheral membrane
            proteins, including dystroglycans, sarcoglycans, syntrophins and
            alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma
            and its disruption is associated with various forms of muscular
            dystrophy. Mutations in this gene are associated with left
            ventricular noncompaction with congenital heart defects. Multiple
            alternatively spliced transcript variants encoding different
            isoforms have been identified for this gene. [provided by RefSeq,
            Jul 2008].
            
            Transcript Variant: This variant (16) lacks multiple exons from the
            5' end, contains an alternate 5' exon, and differs in the CDS
            compared to variant 1. The resulting isoform (16) has a much
            shorter N-terminus and lacks two internal segments, compared to
            isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK295789.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-109               DN991561.1         8-116
            110-1735            AK295789.1         1-1626
            1736-5741           AC068506.10        48019-52024         c
FEATURES             Location/Qualifiers
     source          1..5741
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q12"
     gene            1..5741
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="dystrobrevin, alpha"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
     exon            1..365
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       7
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111611922"
     variation       84
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139673882"
     variation       205
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116132890"
     variation       216
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181193302"
     variation       229..230
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34399788"
     misc_feature    318..320
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="upstream in-frame stop codon"
     variation       359
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185407416"
     exon            366..490
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       393
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199983981"
     variation       422
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114170541"
     variation       433
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138085660"
     CDS             444..1631
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="isoform 16 is encoded by transcript variant 16;
                     dystrophin-related protein 3"
                     /codon_start=1
                     /product="dystrobrevin alpha isoform 16"
                     /protein_id="NP_001185873.1"
                     /db_xref="GI:312147282"
                     /db_xref="CCDS:CCDS56063.1"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
                     /translation="
MFPDQPEKPLNLAHIVPPRPVTSMNDTLFSHSVPSSGSPFITRRLPEGISASSPVAEEHSLIKLYVNQLDHGARMLESSNRLDEEHRLIARYAARLAAESSSSQPPQQRSAPDISFTIDANKQQRQLIAELENKNREILQEIQRLRLEHEQASQPTPEKAQQNPTLLAELRLLRQRKDELEQRMSALQESRRELMVQLEGLMKLLKTQGAGSPRSSPSHTISRPIPMPIRSASACSTPTHTPQDSLTGVGGDVQEAFAQSSRRNLRNDLLVAADSITNTMSSLVKELNSEVGSETESNVDSEFARTQFEDLVPSPTSEKAFLAQIHARKPGYIHSGATTSTMRGDMVTEDADPYVQPEDENYENDSVRQLENELQMEEYLKQKLQDEAYQVSLQG
"
     misc_feature    <825..1037
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Seryl-tRNA synthetase N-terminal domain; Region:
                     Seryl_tRNA_N; pfam02403"
                     /db_xref="CDD:202232"
     variation       444
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141981161"
     variation       458
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201472116"
     variation       467
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200830541"
     variation       488
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737438"
     variation       489
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148123045"
     exon            491..574
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     STS             510..726
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="D6S1400E"
                     /db_xref="UniSTS:147378"
     variation       513
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704854"
     variation       519
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374347283"
     exon            575..664
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       663
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80152252"
     exon            665..752
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       673
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374916548"
     variation       722
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144776465"
     variation       742
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147541731"
     variation       749
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202088347"
     exon            753..850
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       756
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77320474"
     variation       772
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190619495"
     variation       797
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145061501"
     variation       798
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144880521"
     exon            851..964
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       884
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149071180"
     variation       910
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199828427"
     variation       954
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371363393"
     exon            965..1061
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       970
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142108185"
     variation       1038
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376207145"
     variation       1047
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370629863"
     exon            1062..1221
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1082
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151158035"
     variation       1084
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200246467"
     variation       1089
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199645550"
     variation       1094
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113072494"
     variation       1139
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9959365"
     variation       1156
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145425478"
     variation       1165
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199556035"
     variation       1166
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373742103"
     variation       1167
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75615735"
     variation       1184
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199774892"
     variation       1195
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200805008"
     variation       1204
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199596768"
     exon            1222..1311
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1236
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372620035"
     variation       1254
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191002814"
     variation       1282
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376597436"
     variation       1289
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199855849"
     exon            1312..1480
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1357
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138143719"
     variation       1381
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201829681"
     variation       1386
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851710"
     variation       1412
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914309"
     variation       1426
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142009291"
     variation       1435
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150410546"
     variation       1440
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138145650"
     variation       1470
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368868084"
     variation       1471
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111587625"
     exon            1481..1613
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1486
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200977103"
     variation       1487
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374444921"
     variation       1496
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145486636"
     variation       1525
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113556738"
     variation       1546
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371303988"
     variation       1601
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187028045"
     exon            1614..1662
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     exon            1663..5741
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1804
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146475795"
     variation       1840
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116400062"
     variation       1861
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57165372"
     variation       1865
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16966155"
     variation       1942
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111248054"
     variation       1960
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139929781"
     variation       1992
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181083183"
     variation       2045
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9950418"
     variation       2122
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:149598633"
     variation       2144
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186132677"
     variation       2177
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200940754"
     variation       2255
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190607495"
     variation       2333
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182840042"
     variation       2502
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187385677"
     variation       2529
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149726324"
     variation       2556
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201835977"
     variation       2580
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111319152"
     variation       2632
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145238763"
     variation       2668
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372818476"
     variation       2672
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373595039"
     variation       3026..3027
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200402891"
     variation       3033..3034
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35125248"
     STS             3036..3300
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-21186"
                     /db_xref="UniSTS:13566"
     variation       3093
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367771488"
     variation       3138
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143236354"
     STS             3159..3361
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH81068"
                     /db_xref="UniSTS:84148"
     variation       3182
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151249058"
     variation       3193
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141815886"
     variation       3205
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3133"
     variation       3222
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192226645"
     variation       3271
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76507055"
     variation       3299
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376804490"
     variation       3356
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147118542"
     variation       3380
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183137910"
     variation       3413..3414
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34117234"
     variation       3431
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187414791"
     variation       3510
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138455778"
     variation       3548
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191833021"
     variation       3569
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16966160"
     variation       3671
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143972699"
     variation       3777
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182528646"
     variation       3903
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10502637"
     variation       3935
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187877718"
     variation       3978
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150254745"
     variation       4059
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138447301"
     variation       4060
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72962231"
     variation       4113
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192501097"
     variation       4154
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114631141"
     variation       4224
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9944927"
     variation       4392
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7227051"
     variation       4500
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184426501"
     variation       4526
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190514847"
     variation       4617
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112055845"
     STS             4697..4856
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="A006B16"
                     /db_xref="UniSTS:3979"
     STS             4697..4856
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="G20674"
                     /db_xref="UniSTS:3978"
     variation       4706
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149271384"
     STS             4809..4958
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-14278"
                     /db_xref="UniSTS:60009"
     variation       4872
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73418686"
     variation       5008
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192402506"
     variation       5055
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996755"
     variation       5141
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:674338"
     variation       5164..5165
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:34383224"
     variation       5165
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201691364"
     variation       5175..5176
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:5823957"
     variation       5187..5188
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:3081492"
     variation       5188..5189
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:200330341"
     STS             5332..5460
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH98997"
                     /db_xref="UniSTS:86943"
     variation       5349
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139109039"
     STS             5388..5672
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="SGC38125"
                     /db_xref="UniSTS:53214"
     variation       5462
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375929758"
     variation       5508
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10153380"
     variation       5562
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376796429"
     variation       5573
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142635681"
     polyA_signal    5723..5728
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
     variation       5730
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372697531"
     polyA_site      5741
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
ORIGIN      
ggtggttctcatagcaaccagcaccaaatgaaagagtacacgtcatgggtaaggcaaggtccaggcaatacttggagttggatgtgtgagtgttgcccagagttaaagggaatatcaaggatggtggcagaattaaagggcaaacttaccttccatcccaggtctagtattcagtcccccttcctcccactctccaccctactgcgtgctcttacttattctgttggaacccagtgtagcttcctgagatttaaaatataggaagactcaaaactatgttacttcttggaatatagataattcagtactgatttaaataacaactgaatagcaaggaccttctggaacataatcttacattcacaaaatcacctgctaagaagctgactaatgcattaagcaagtccctgagctgtgcttccagccgtgaacctttgcaccccatgttcccagatcagcctgagaagccactcaacttggctcacatcgtgcctcccagacctgtaaccagcatgaacgacaccctgttctcccactctgttccctcctcaggaagtccttttattaccaggaggttacctgagggaataagtgcatccagccctgtggctgaagagcattccctcataaagctgtacgtaaatcagcttgatcacggtgcacgcatgcttgagagttcaaaccggcttgatgaagaacacaggctaattgccaggtatgcggcaaggctggcagcagagtcctcttcgtctcagccacctcagcagagaagtgctcctgacatctctttcaccatcgatgcgaataagcagcaaaggcagctgattgctgagctagaaaacaagaacagagaaatcttacaggagatccagagacttcggctagagcatgaacaagcttctcagcccacgccagagaaggcacagcaaaaccccaccctgctggcagaactccggctcctcagacagcgcaaagatgagctggaacagagaatgtctgctctccaggagagccggagagagctaatggtccagttggagggtctcatgaagctactaaagactcagggggcaggctctccccgctcctcccccagccacaccatcagcaggccaattcccatgcccatccggtcagcgtcagcctgctccaccccgacgcacacgccgcaggactccctcacaggagtagggggagatgtacaagaggcatttgcacaaagttcaagaagaaacttaaggaatgacttgctagtggctgcagattccatcactaacactatgtcctctcttgtgaaagagctgaattctgaggttgggagtgaaacagagagtaatgtggattctgaatttgcacggactcagtttgaggatcttgttccctcaccaacctctgaaaaggcttttctagcgcaaatccatgcccgaaaacctgggtacattcacagtggagctaccacaagtaccatgcgtggcgacatggttacggaggatgcagatccctatgtgcagcctgaagatgaaaactatgaaaatgactctgtccggcagctggagaatgagctccagatggaggaatacctgaaacagaagctgcaagatgaagcttatcaggtcagcttgcaaggttgaatgcaatatccttttatcacactcctctcaagcaagctatagtcagacagatgatgaaagtaacatgaaaactggtgatgatggagagccctgtggccacacagaggaggaagacagcagcctggcagcagcctcaccgaagagaggaaccaccacacccagcagctcctgacagacccccacccctaaagatgtgtcctgatgactatagtgcagctaactttttgttctcagatttgtagtgcataggtgtgtgtttcaagaaggaaaaaaaaagacttctgttcaaagttaacttatcagctacatcctctgtaacgtggttcatccctggttaaaaagcaaacaaacacaggctgaaaacccatgctgctgttatacacaatggcagtattaacaagcattttaaacctttgcacatgatattgaacctgttcagtttacaatgacaatattaatactgtttatagctagaagtttgatttctgaattctttgagattttagcaaaacagtttattatacactgtacatttttttcacagcaattggaaaaaaacaaccacttgcaatcattcaataaccctgaagaatttggttcctgagtgtacaaactcagagcccggaagccaagaagggtccttggcctgcacggtctgtagttgactccaagtctctgtgagcagtgacttgaaccaaacacaccaggaataatccattctttggggcctctttccaactcgaggttgttttctttcaagatactctaatcagccatagaatttagtgtaaatatttttttttccaaatagatatcatattcaaaaaaggcagcattcaaattatatagaatctagtttttaaaatcagcacagatcttcttaaaaactgtgaactatgttttgaaatactcgttactaaagctgtttataaaccacaggtgccataagatccccaaacggactaaagttatctctgctcttccatggtcttgttcctctcgttttggctttaggaagcatgtctttaacagcaccgctcgttcacaagttcccccatcaagttgtttggaggccttcagctttaaatgtacaggcttaaagtgcgcttgcaaacgtttgctctcctttttttctgaatgttgattgccttagctggccacctggtgttctgcatgtagccttctgtggtcatgtgaaaggagacaggctcttctaagttgagttgggatttttgcactcagtgaaaagctgaagtgcaaaagagctatcaaagacaagaggataaaagactgggatagtcttttccaaggaccctctttagagggccctaaagacctcctttgggaattctggggaaaaagaaaaagtaatcttctacttgcttcaagatttgatttttttaaaaaagcctgcgacctattcaatacattatgcttaaattagcagtttctctggaattcctgtctctcctttaaaagaaaggagagaacattttagaacaatagttctcaaagtgtgttccccggacaagcagcatctgcaacacttaggaaggtcttcgaaatactaatttgtaagccccacctcaggcctactgaatcagaagctctgggggttgggtccagaagtctgttttagtcaaccctctaggtgattctgatgctcgctaaaggttgagaactactgctttagaatgaagtcgtataataaagtctctgaaaaggccttattcagaataagcaagaaaggttctgtgattcacttttgcttctggggctggcaaaaaccttctctgaacccacacaccaagttcgtagttggtaggtgcccagccaagtcctgacatcttcatgccccctctgcagagggcggctgtacgatgttcacatgtctgcgtttggtcagacatcatctccttggctgccctttgaaaccaaatcacttgccttggggataaagtgctcaattggcattagtgagaagcccatcctatcccttgacatacttaatcatatatctctccagagaactcacctgacaaatgtctctgagcacaggctgacaccaaagtggcacaactgcacagttctcagatttctttgcacagattgatttttattgcgggttttgttggggtgtcttaatgttcatctcttttccactgcccatcctctgtgaacccatacctctctagatggagcaggtggccactggtgcctcatactcagtattgaaaaccactacatcccagctacctataatgctgtcagctcaaaatcatagccaggtagttcttgaactcagaacttaaatcctgcacgtggcactccaccactgactggaccgagctggcatatgttgtttctttgtgtttctacatcaaaatgttcgtctaagatttgaactgttctgctgataaccttccccgttgtcatagctatttcattgccaaccaactccatcacatggttgttgatatcgtcatataaagccattgcaaggactctggaaactgccgccaatgaccaatttctgactaaccagccaccttttctctctcttagctccacgtcagcactgagaccagactcgagcacccctgtcctgtaagcgagacaaaatggcgtgtgttattttggggttttgtgttttttggtgggtttctttccttggctctccagatttacttttggggcctgttctaagtgcaaacccagcaagtttcacttgtcctgtccattagatacaactacatcttgcgggggttgtttctttcttgttccacaatgaattgcacatccatctccatcagagctgatagcctgttaataagcactggtctaacacagccaaccctcctccacagcgccatattaatggaggaggggaggaaggtgaaatctactgcatgggattcaggaaacagttgtggttggtcaggacggaagttggggtaagtttggttggtcagagggagttgtgctggagattgtgaaaaatgggttcttgaatgatctactataaggcagggaaggttcatttgtaagtagtaatgtgaactgaattgcattaagagtgtgtggcctttgttgtgatatactatgtattttcttatatgcatgagccaaactgttgcatcataatttagcactgatgtctgcttttattttgatcatctttgtccacccttattagttcttggctgttaaccgtagatagatcttgtaaatccagcaacctttggttgctgcattccccttggttcgattccacgcaaggagccacaagtgagaactccactgtccttagaagaaagggcatttttacttttgaaccaaaaagagaaaaaaaaatcagaagtgttgcatcttgaggcgaattaactgtaagacatttttaattatgactactgcaatttgacaccatttgaaataatcaattcagagacactaaagatttcacaatattcattggtattgtaaaaaaaaaatactattgtatggatttttgtattgctgttaagtattgttttgtgtgtgtgtgtgtgtgtgtgtgttggaacctcctggggacatgttatattttgaagtgattaaactatttaattgtgtgtctatattttggagtggaataatttcttcattaaaaaatgtttttaaaaacactatatcttgggtggtttattcctttgtttcagtgaatctttcctaaagcaacgtggagtcagtctgttgaaagaaggaaggcaggtacttgcagtttaaagcaggacccattgatggaatattgagccaccgaggcaaaatagctcaccttctcttgccttgggggatgcatggtttttaccattctactgttttattagcatctgtgagcatctaatagaaatactattctgctatttatggaaatccttattataattgatatggaagtgagtttgaaattctaacagctaacatatttcatgtttgtatcacacactgttcttaacactttatgtgacttcactcaattctttgaatcctctgcatctagccatgtattctgcaaatattaagtgctcaatggtttttttgttgaattactgaataaatgaattagtggtg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1837 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1837 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1837 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1837 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007274 [neuromuscular synaptic transmission] evidence: TAS
            GeneID:1837 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1837 -> Cellular component: GO:0045202 [synapse] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.