GGRNA Home | Help | Advanced search

2020-10-26 19:35:30, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001198943            5655 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 15,
            mRNA.
ACCESSION   NM_001198943
VERSION     NM_001198943.1  GI:312147277
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5655)
  AUTHORS   Navakauskiene,R., Treigyte,G., Borutinskaite,V.V., Matuzevicius,D.,
            Navakauskas,D. and Magnusson,K.E.
  TITLE     Alpha-Dystrobrevin and its associated proteins in human
            promyelocytic leukemia cells induced to apoptosis
  JOURNAL   J Proteomics 75 (11), 3291-3303 (2012)
   PUBMED   22507200
  REMARK    GeneRIF: apoptosis-induction in HL-60 cells involves not only
            classical markers of apoptosis but also a network
            alpha-DB-associated proteins at the cell membrane, the cytoplasm
            and nucleus, affecting key cellular transport processes and
            cellular structure.
REFERENCE   2  (bases 1 to 5655)
  AUTHORS   Borutinskaite,V.V., Magnusson,K.E. and Navakauskiene,R.
  TITLE     alpha-Dystrobrevin distribution and association with other proteins
            in human promyelocytic NB4 cells treated for granulocytic
            differentiation
  JOURNAL   Mol. Biol. Rep. 38 (5), 3001-3011 (2011)
   PUBMED   20111909
  REMARK    GeneRIF: Results suggest that alpha-dystrobrevin isoforms play a
            central role in cytoskeleton reorganization via their multiple
            interactions with actin and actin-associating proteins.
REFERENCE   3  (bases 1 to 5655)
  AUTHORS   Lyssand,J.S., Whiting,J.L., Lee,K.S., Kastl,R., Wacker,J.L.,
            Bruchas,M.R., Miyatake,M., Langeberg,L.K., Chavkin,C., Scott,J.D.,
            Gardner,R.G., Adams,M.E. and Hague,C.
  TITLE     Alpha-dystrobrevin-1 recruits alpha-catulin to the
            alpha1D-adrenergic receptor/dystrophin-associated protein complex
            signalosome
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 107 (50), 21854-21859 (2010)
   PUBMED   21115837
  REMARK    GeneRIF: Data show that alpha-dystrobrevin-1 recruits
            alpha-catulin, which supersensitizes alpha(1D)-AR functional
            responses by recruiting effector molecules to the signalosome.
REFERENCE   4  (bases 1 to 5655)
  AUTHORS   Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
            Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
            Aloisi,F., Petrucci,T.C. and Ambrosini,E.
  TITLE     MLC1 trafficking and membrane expression in astrocytes: role of
            caveolin-1 and phosphorylation
  JOURNAL   Neurobiol. Dis. 37 (3), 581-595 (2010)
   PUBMED   19931615
REFERENCE   5  (bases 1 to 5655)
  AUTHORS   Bohm,S.V., Constantinou,P., Tan,S., Jin,H. and Roberts,R.G.
  TITLE     Profound human/mouse differences in alpha-dystrobrevin isoforms: a
            novel syntrophin-binding site and promoter missing in mouse and rat
  JOURNAL   BMC Biol. 7, 85 (2009)
   PUBMED   19961569
  REMARK    GeneRIF: Fundamental functional differences between the
            alpha-dystrobrevins of mice and humans raises questions about the
            use of the mouse as a model animal for Duchenne muscular dystrophy.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5655)
  AUTHORS   Sadoulet-Puccio,H.M., Feener,C.A., Schaid,D.J., Thibodeau,S.N.,
            Michels,V.V. and Kunkel,L.M.
  TITLE     The genomic organization of human dystrobrevin
  JOURNAL   Neurogenetics 1 (1), 37-42 (1997)
   PUBMED   10735273
REFERENCE   7  (bases 1 to 5655)
  AUTHORS   Blake,D.J., Nawrotzki,R., Peters,M.F., Froehner,S.C. and
            Davies,K.E.
  TITLE     Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic
            protein
  JOURNAL   J. Biol. Chem. 271 (13), 7802-7810 (1996)
   PUBMED   8631824
REFERENCE   8  (bases 1 to 5655)
  AUTHORS   Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
            Kunkel,L.M.
  TITLE     The three human syntrophin genes are expressed in diverse tissues,
            have distinct chromosomal locations, and each bind to dystrophin
            and its relatives
  JOURNAL   J. Biol. Chem. 271 (5), 2724-2730 (1996)
   PUBMED   8576247
REFERENCE   9  (bases 1 to 5655)
  AUTHORS   Ahn,A.H. and Kunkel,L.M.
  TITLE     Syntrophin binds to an alternatively spliced exon of dystrophin
  JOURNAL   J. Cell Biol. 128 (3), 363-371 (1995)
   PUBMED   7844150
REFERENCE   10 (bases 1 to 5655)
  AUTHORS   Khurana,T.S., Engle,E.C., Bennett,R.R., Silverman,G.A., Selig,S.,
            Bruns,G.A. and Kunkel,L.M.
  TITLE     (CA) repeat polymorphism in the chromosome 18 encoded
            dystrophin-like protein
  JOURNAL   Hum. Mol. Genet. 3 (5), 841 (1994)
   PUBMED   8081380
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK296450.1 and AC068506.10.
            
            Summary: The protein encoded by this gene belongs to the
            dystrobrevin subfamily of the dystrophin family. This protein is a
            component of the dystrophin-associated protein complex (DPC), which
            consists of dystrophin and several integral and peripheral membrane
            proteins, including dystroglycans, sarcoglycans, syntrophins and
            alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma
            and its disruption is associated with various forms of muscular
            dystrophy. Mutations in this gene are associated with left
            ventricular noncompaction with congenital heart defects. Multiple
            alternatively spliced transcript variants encoding different
            isoforms have been identified for this gene. [provided by RefSeq,
            Jul 2008].
            
            Transcript Variant: This variant (15) lacks multiple exons from the
            5' end, contains an alternate 5' UTR, and differs in the CDS
            compared to variant 1. The resulting isoform (15) has a much
            shorter N-terminus and lacks two internal segments, compared to
            isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK296450.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1931              AK296450.1         2-1932
            1932-5655           AC068506.10        48019-51742         c
FEATURES             Location/Qualifiers
     source          1..5655
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q12"
     gene            1..5655
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="dystrobrevin, alpha"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
     exon            1..369
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       27
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189743071"
     variation       51
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149336290"
     misc_feature    130..132
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="upstream in-frame stop codon"
     variation       152
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369435061"
     variation       154
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144522727"
     variation       176
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372301591"
     CDS             244..1545
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="isoform 15 is encoded by transcript variant 15;
                     dystrophin-related protein 3"
                     /codon_start=1
                     /product="dystrobrevin alpha isoform 15"
                     /protein_id="NP_001185872.1"
                     /db_xref="GI:312147278"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
                     /translation="
MMGFRYRCQQCHNYQLCQDCFWRGHAGGSHSNQHQMKEYTSWKSPAKKLTNALSKSLSCASSREPLHPMFPDQPEKPLNLAHIVPPRPVTSMNDTLFSHSVPSSGSPFITRSMLESSNRLDEEHRLIARYAARLAAESSSSQPPQQRSAPDISFTIDANKQQRQLIAELENKNREILQEIQRLRLEHEQASQPTPEKAQQNPTLLAELRLLRQRKDELEQRMSALQESRRELMVQLEGLMKLLKTQGAGSPRSSPSHTISRPIPMPIRSASACSTPTHTPQDSLTGVGGDVQEAFAQSSRRNLRNDLLVAADSITNTMSSLVKELNSEVGSETESNVDSEFARTQFEDLVPSPTSEKAFLAQIHARKPGYIHSGATTSTMRGDMVTEDADPYVQPEDENYENDSVRQLENELQMEEYLKQKLQDEAYQVSLQG
"
     misc_feature    <244..360
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Zinc finger, ZZ type. Zinc finger present in
                     dystrophin and dystrobrevin. The ZZ motif coordinates two
                     zinc ions and most likely participates in ligand binding
                     or molecular scaffolding. Dystrophin attaches actin
                     filaments to an integral membrane...; Region:
                     ZZ_dystrophin; cd02334"
                     /db_xref="CDD:30238"
     misc_feature    order(256..258,262..264,280..282,286..288)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="putative charged binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(259..261,304..306,349..351,358..360)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="putative hydrophobic binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(265..267,274..276,292..294,301..303,331..333,
                     343..345)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Zinc-binding sites [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(265..267,274..276,331..333,343..345)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="zinc cluster 2 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(292..294,301..303)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="zinc cluster 1 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    <739..951
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Seryl-tRNA synthetase N-terminal domain; Region:
                     Seryl_tRNA_N; pfam02403"
                     /db_xref="CDD:202232"
     variation       277
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369043538"
     variation       312
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199617326"
     variation       317
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373047659"
     variation       328
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111611922"
     exon            370..494
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       397
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199983981"
     variation       426
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114170541"
     variation       437
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138085660"
     variation       448
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141981161"
     variation       462
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201472116"
     variation       471
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200830541"
     variation       492
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737438"
     variation       493
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148123045"
     exon            495..578
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     STS             514..640
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="D6S1400E"
                     /db_xref="UniSTS:147378"
     variation       517
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704854"
     variation       523
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374347283"
     exon            579..666
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       587
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374916548"
     variation       636
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144776465"
     variation       656
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147541731"
     variation       663
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202088347"
     exon            667..764
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       670
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77320474"
     variation       686
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190619495"
     variation       711
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145061501"
     variation       712
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144880521"
     exon            765..878
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       798
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149071180"
     variation       824
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199828427"
     variation       868
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371363393"
     exon            879..975
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       884
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142108185"
     variation       952
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376207145"
     variation       961
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370629863"
     exon            976..1135
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       996
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151158035"
     variation       998
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200246467"
     variation       1003
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199645550"
     variation       1008
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113072494"
     variation       1053
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9959365"
     variation       1070
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145425478"
     variation       1079
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199556035"
     variation       1080
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373742103"
     variation       1081
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75615735"
     variation       1098
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199774892"
     variation       1109
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200805008"
     variation       1118
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199596768"
     exon            1136..1225
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1150
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372620035"
     variation       1168
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191002814"
     variation       1196
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376597436"
     variation       1203
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199855849"
     exon            1226..1394
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1271
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138143719"
     variation       1295
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201829681"
     variation       1300
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851710"
     variation       1326
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914309"
     variation       1340
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142009291"
     variation       1349
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150410546"
     variation       1354
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138145650"
     variation       1384
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368868084"
     variation       1385
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111587625"
     exon            1395..1527
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1400
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200977103"
     variation       1401
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374444921"
     variation       1410
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145486636"
     variation       1439
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113556738"
     variation       1460
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371303988"
     variation       1515
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187028045"
     exon            1528..1576
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     exon            1577..5655
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1718
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146475795"
     variation       1754
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116400062"
     variation       1775
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57165372"
     variation       1779
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16966155"
     variation       1856
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111248054"
     variation       1874
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139929781"
     variation       1906
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181083183"
     variation       1959
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9950418"
     variation       2036
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:149598633"
     variation       2058
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186132677"
     variation       2091
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200940754"
     variation       2169
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190607495"
     variation       2247
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182840042"
     variation       2416
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187385677"
     variation       2443
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149726324"
     variation       2470
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201835977"
     variation       2494
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111319152"
     variation       2546
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145238763"
     variation       2582
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372818476"
     variation       2586
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373595039"
     variation       2940..2941
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200402891"
     variation       2947..2948
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35125248"
     STS             2950..3214
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-21186"
                     /db_xref="UniSTS:13566"
     variation       3007
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367771488"
     variation       3052
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143236354"
     STS             3073..3275
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH81068"
                     /db_xref="UniSTS:84148"
     variation       3096
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151249058"
     variation       3107
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141815886"
     variation       3119
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3133"
     variation       3136
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192226645"
     variation       3185
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76507055"
     variation       3213
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376804490"
     variation       3270
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147118542"
     variation       3294
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183137910"
     variation       3327..3328
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34117234"
     variation       3345
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187414791"
     variation       3424
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138455778"
     variation       3462
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191833021"
     variation       3483
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16966160"
     variation       3585
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143972699"
     variation       3691
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182528646"
     variation       3817
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10502637"
     variation       3849
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187877718"
     variation       3892
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150254745"
     variation       3973
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138447301"
     variation       3974
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72962231"
     variation       4027
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192501097"
     variation       4068
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114631141"
     variation       4138
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9944927"
     variation       4306
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7227051"
     variation       4414
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184426501"
     variation       4440
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190514847"
     variation       4531
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112055845"
     STS             4611..4770
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="A006B16"
                     /db_xref="UniSTS:3979"
     STS             4611..4770
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="G20674"
                     /db_xref="UniSTS:3978"
     variation       4620
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149271384"
     STS             4723..4872
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-14278"
                     /db_xref="UniSTS:60009"
     variation       4786
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73418686"
     variation       4922
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192402506"
     variation       4969
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996755"
     variation       5055
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:674338"
     variation       5078..5079
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:34383224"
     variation       5079
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201691364"
     variation       5089..5090
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:5823957"
     variation       5101..5102
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:3081492"
     variation       5102..5103
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:200330341"
     STS             5246..5374
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH98997"
                     /db_xref="UniSTS:86943"
     variation       5263
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139109039"
     STS             5302..5586
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="SGC38125"
                     /db_xref="UniSTS:53214"
     variation       5376
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375929758"
     variation       5422
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10153380"
     variation       5476
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376796429"
     variation       5487
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142635681"
     polyA_signal    5637..5642
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
     variation       5644
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372697531"
     polyA_site      5655
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
ORIGIN      
ttcatttcatttccccacaggcatgattgaaaagggttgtaagattccaggaatgaactaaatgtttctctgagcccaaatcaactatcatctgaaatcgtggtgcagagaagaaaggtgcaattcctgtaaggctgtatttttccttcttctggttcatacttttgttttcttggtttttcttcacttacttcccccttagtcttccatccggttgagtgttcctactgccacagtgagagtatgatgggatttcgctaccgatgccaacagtgtcacaattaccagctctgtcaggactgcttctggaggggacatgccggtggttctcatagcaaccagcaccaaatgaaagagtacacgtcatggaaatcacctgctaagaagctgactaatgcattaagcaagtccctgagctgtgcttccagccgtgaacctttgcaccccatgttcccagatcagcctgagaagccactcaacttggctcacatcgtgcctcccagacctgtaaccagcatgaacgacaccctgttctcccactctgttccctcctcaggaagtccttttattaccaggagcatgcttgagagttcaaaccggcttgatgaagaacacaggctaattgccaggtatgcggcaaggctggcagcagagtcctcttcgtctcagccacctcagcagagaagtgctcctgacatctctttcaccatcgatgcgaataagcagcaaaggcagctgattgctgagctagaaaacaagaacagagaaatcttacaggagatccagagacttcggctagagcatgaacaagcttctcagcccacgccagagaaggcacagcaaaaccccaccctgctggcagaactccggctcctcagacagcgcaaagatgagctggaacagagaatgtctgctctccaggagagccggagagagctaatggtccagttggagggtctcatgaagctactaaagactcagggggcaggctctccccgctcctcccccagccacaccatcagcaggccaattcccatgcccatccggtcagcgtcagcctgctccaccccgacgcacacgccgcaggactccctcacaggagtagggggagatgtacaagaggcatttgcacaaagttcaagaagaaacttaaggaatgacttgctagtggctgcagattccatcactaacactatgtcctctcttgtgaaagagctgaattctgaggttgggagtgaaacagagagtaatgtggattctgaatttgcacggactcagtttgaggatcttgttccctcaccaacctctgaaaaggcttttctagcgcaaatccatgcccgaaaacctgggtacattcacagtggagctaccacaagtaccatgcgtggcgacatggttacggaggatgcagatccctatgtgcagcctgaagatgaaaactatgaaaatgactctgtccggcagctggagaatgagctccagatggaggaatacctgaaacagaagctgcaagatgaagcttatcaggtcagcttgcaaggttgaatgcaatatccttttatcacactcctctcaagcaagctatagtcagacagatgatgaaagtaacatgaaaactggtgatgatggagagccctgtggccacacagaggaggaagacagcagcctggcagcagcctcaccgaagagaggaaccaccacacccagcagctcctgacagacccccacccctaaagatgtgtcctgatgactatagtgcagctaactttttgttctcagatttgtagtgcataggtgtgtgtttcaagaaggaaaaaaaaagacttctgttcaaagttaacttatcagctacatcctctgtaacgtggttcatccctggttaaaaagcaaacaaacacaggctgaaaacccatgctgctgttatacacaatggcagtattaacaagcattttaaacctttgcacatgatattgaacctgttcagtttacaatgacaatattaatactgtttatagctagaagtttgatttctgaattctttgagattttagcaaaacagtttattatacactgtacatttttttcacagcaattggaaaaaaacaaccacttgcaatcattcaataaccctgaagaatttggttcctgagtgtacaaactcagagcccggaagccaagaagggtccttggcctgcacggtctgtagttgactccaagtctctgtgagcagtgacttgaaccaaacacaccaggaataatccattctttggggcctctttccaactcgaggttgttttctttcaagatactctaatcagccatagaatttagtgtaaatatttttttttccaaatagatatcatattcaaaaaaggcagcattcaaattatatagaatctagtttttaaaatcagcacagatcttcttaaaaactgtgaactatgttttgaaatactcgttactaaagctgtttataaaccacaggtgccataagatccccaaacggactaaagttatctctgctcttccatggtcttgttcctctcgttttggctttaggaagcatgtctttaacagcaccgctcgttcacaagttcccccatcaagttgtttggaggccttcagctttaaatgtacaggcttaaagtgcgcttgcaaacgtttgctctcctttttttctgaatgttgattgccttagctggccacctggtgttctgcatgtagccttctgtggtcatgtgaaaggagacaggctcttctaagttgagttgggatttttgcactcagtgaaaagctgaagtgcaaaagagctatcaaagacaagaggataaaagactgggatagtcttttccaaggaccctctttagagggccctaaagacctcctttgggaattctggggaaaaagaaaaagtaatcttctacttgcttcaagatttgatttttttaaaaaagcctgcgacctattcaatacattatgcttaaattagcagtttctctggaattcctgtctctcctttaaaagaaaggagagaacattttagaacaatagttctcaaagtgtgttccccggacaagcagcatctgcaacacttaggaaggtcttcgaaatactaatttgtaagccccacctcaggcctactgaatcagaagctctgggggttgggtccagaagtctgttttagtcaaccctctaggtgattctgatgctcgctaaaggttgagaactactgctttagaatgaagtcgtataataaagtctctgaaaaggccttattcagaataagcaagaaaggttctgtgattcacttttgcttctggggctggcaaaaaccttctctgaacccacacaccaagttcgtagttggtaggtgcccagccaagtcctgacatcttcatgccccctctgcagagggcggctgtacgatgttcacatgtctgcgtttggtcagacatcatctccttggctgccctttgaaaccaaatcacttgccttggggataaagtgctcaattggcattagtgagaagcccatcctatcccttgacatacttaatcatatatctctccagagaactcacctgacaaatgtctctgagcacaggctgacaccaaagtggcacaactgcacagttctcagatttctttgcacagattgatttttattgcgggttttgttggggtgtcttaatgttcatctcttttccactgcccatcctctgtgaacccatacctctctagatggagcaggtggccactggtgcctcatactcagtattgaaaaccactacatcccagctacctataatgctgtcagctcaaaatcatagccaggtagttcttgaactcagaacttaaatcctgcacgtggcactccaccactgactggaccgagctggcatatgttgtttctttgtgtttctacatcaaaatgttcgtctaagatttgaactgttctgctgataaccttccccgttgtcatagctatttcattgccaaccaactccatcacatggttgttgatatcgtcatataaagccattgcaaggactctggaaactgccgccaatgaccaatttctgactaaccagccaccttttctctctcttagctccacgtcagcactgagaccagactcgagcacccctgtcctgtaagcgagacaaaatggcgtgtgttattttggggttttgtgttttttggtgggtttctttccttggctctccagatttacttttggggcctgttctaagtgcaaacccagcaagtttcacttgtcctgtccattagatacaactacatcttgcgggggttgtttctttcttgttccacaatgaattgcacatccatctccatcagagctgatagcctgttaataagcactggtctaacacagccaaccctcctccacagcgccatattaatggaggaggggaggaaggtgaaatctactgcatgggattcaggaaacagttgtggttggtcaggacggaagttggggtaagtttggttggtcagagggagttgtgctggagattgtgaaaaatgggttcttgaatgatctactataaggcagggaaggttcatttgtaagtagtaatgtgaactgaattgcattaagagtgtgtggcctttgttgtgatatactatgtattttcttatatgcatgagccaaactgttgcatcataatttagcactgatgtctgcttttattttgatcatctttgtccacccttattagttcttggctgttaaccgtagatagatcttgtaaatccagcaacctttggttgctgcattccccttggttcgattccacgcaaggagccacaagtgagaactccactgtccttagaagaaagggcatttttacttttgaaccaaaaagagaaaaaaaaatcagaagtgttgcatcttgaggcgaattaactgtaagacatttttaattatgactactgcaatttgacaccatttgaaataatcaattcagagacactaaagatttcacaatattcattggtattgtaaaaaaaaaatactattgtatggatttttgtattgctgttaagtattgttttgtgtgtgtgtgtgtgtgtgtgtgttggaacctcctggggacatgttatattttgaagtgattaaactatttaattgtgtgtctatattttggagtggaataatttcttcattaaaaaatgtttttaaaaacactatatcttgggtggtttattcctttgtttcagtgaatctttcctaaagcaacgtggagtcagtctgttgaaagaaggaaggcaggtacttgcagtttaaagcaggacccattgatggaatattgagccaccgaggcaaaatagctcaccttctcttgccttgggggatgcatggtttttaccattctactgttttattagcatctgtgagcatctaatagaaatactattctgctatttatggaaatccttattataattgatatggaagtgagtttgaaattctaacagctaacatatttcatgtttgtatcacacactgttcttaacactttatgtgacttcactcaattctttgaatcctctgcatctagccatgtattctgcaaatattaagtgctcaatggtttttttgttgaattactgaataaatgaattagtggtg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1837 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1837 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1837 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1837 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007274 [neuromuscular synaptic transmission] evidence: TAS
            GeneID:1837 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1837 -> Cellular component: GO:0045202 [synapse] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.