GGRNA Home | Help | Advanced search

2020-10-24 07:14:01, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001198942            5912 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 14,
            mRNA.
ACCESSION   NM_001198942
VERSION     NM_001198942.1  GI:312147273
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5912)
  AUTHORS   Navakauskiene,R., Treigyte,G., Borutinskaite,V.V., Matuzevicius,D.,
            Navakauskas,D. and Magnusson,K.E.
  TITLE     Alpha-Dystrobrevin and its associated proteins in human
            promyelocytic leukemia cells induced to apoptosis
  JOURNAL   J Proteomics 75 (11), 3291-3303 (2012)
   PUBMED   22507200
  REMARK    GeneRIF: apoptosis-induction in HL-60 cells involves not only
            classical markers of apoptosis but also a network
            alpha-DB-associated proteins at the cell membrane, the cytoplasm
            and nucleus, affecting key cellular transport processes and
            cellular structure.
REFERENCE   2  (bases 1 to 5912)
  AUTHORS   Borutinskaite,V.V., Magnusson,K.E. and Navakauskiene,R.
  TITLE     alpha-Dystrobrevin distribution and association with other proteins
            in human promyelocytic NB4 cells treated for granulocytic
            differentiation
  JOURNAL   Mol. Biol. Rep. 38 (5), 3001-3011 (2011)
   PUBMED   20111909
  REMARK    GeneRIF: Results suggest that alpha-dystrobrevin isoforms play a
            central role in cytoskeleton reorganization via their multiple
            interactions with actin and actin-associating proteins.
REFERENCE   3  (bases 1 to 5912)
  AUTHORS   Lyssand,J.S., Whiting,J.L., Lee,K.S., Kastl,R., Wacker,J.L.,
            Bruchas,M.R., Miyatake,M., Langeberg,L.K., Chavkin,C., Scott,J.D.,
            Gardner,R.G., Adams,M.E. and Hague,C.
  TITLE     Alpha-dystrobrevin-1 recruits alpha-catulin to the
            alpha1D-adrenergic receptor/dystrophin-associated protein complex
            signalosome
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 107 (50), 21854-21859 (2010)
   PUBMED   21115837
  REMARK    GeneRIF: Data show that alpha-dystrobrevin-1 recruits
            alpha-catulin, which supersensitizes alpha(1D)-AR functional
            responses by recruiting effector molecules to the signalosome.
REFERENCE   4  (bases 1 to 5912)
  AUTHORS   Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
            Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
            Aloisi,F., Petrucci,T.C. and Ambrosini,E.
  TITLE     MLC1 trafficking and membrane expression in astrocytes: role of
            caveolin-1 and phosphorylation
  JOURNAL   Neurobiol. Dis. 37 (3), 581-595 (2010)
   PUBMED   19931615
REFERENCE   5  (bases 1 to 5912)
  AUTHORS   Bohm,S.V., Constantinou,P., Tan,S., Jin,H. and Roberts,R.G.
  TITLE     Profound human/mouse differences in alpha-dystrobrevin isoforms: a
            novel syntrophin-binding site and promoter missing in mouse and rat
  JOURNAL   BMC Biol. 7, 85 (2009)
   PUBMED   19961569
  REMARK    GeneRIF: Fundamental functional differences between the
            alpha-dystrobrevins of mice and humans raises questions about the
            use of the mouse as a model animal for Duchenne muscular dystrophy.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5912)
  AUTHORS   Sadoulet-Puccio,H.M., Feener,C.A., Schaid,D.J., Thibodeau,S.N.,
            Michels,V.V. and Kunkel,L.M.
  TITLE     The genomic organization of human dystrobrevin
  JOURNAL   Neurogenetics 1 (1), 37-42 (1997)
   PUBMED   10735273
REFERENCE   7  (bases 1 to 5912)
  AUTHORS   Blake,D.J., Nawrotzki,R., Peters,M.F., Froehner,S.C. and
            Davies,K.E.
  TITLE     Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic
            protein
  JOURNAL   J. Biol. Chem. 271 (13), 7802-7810 (1996)
   PUBMED   8631824
REFERENCE   8  (bases 1 to 5912)
  AUTHORS   Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
            Kunkel,L.M.
  TITLE     The three human syntrophin genes are expressed in diverse tissues,
            have distinct chromosomal locations, and each bind to dystrophin
            and its relatives
  JOURNAL   J. Biol. Chem. 271 (5), 2724-2730 (1996)
   PUBMED   8576247
REFERENCE   9  (bases 1 to 5912)
  AUTHORS   Ahn,A.H. and Kunkel,L.M.
  TITLE     Syntrophin binds to an alternatively spliced exon of dystrophin
  JOURNAL   J. Cell Biol. 128 (3), 363-371 (1995)
   PUBMED   7844150
REFERENCE   10 (bases 1 to 5912)
  AUTHORS   Khurana,T.S., Engle,E.C., Bennett,R.R., Silverman,G.A., Selig,S.,
            Bruns,G.A. and Kunkel,L.M.
  TITLE     (CA) repeat polymorphism in the chromosome 18 encoded
            dystrophin-like protein
  JOURNAL   Hum. Mol. Genet. 3 (5), 841 (1994)
   PUBMED   8081380
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DN991561.1, AK295732.1 and
            AC068506.10.
            
            Summary: The protein encoded by this gene belongs to the
            dystrobrevin subfamily of the dystrophin family. This protein is a
            component of the dystrophin-associated protein complex (DPC), which
            consists of dystrophin and several integral and peripheral membrane
            proteins, including dystroglycans, sarcoglycans, syntrophins and
            alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma
            and its disruption is associated with various forms of muscular
            dystrophy. Mutations in this gene are associated with left
            ventricular noncompaction with congenital heart defects. Multiple
            alternatively spliced transcript variants encoding different
            isoforms have been identified for this gene. [provided by RefSeq,
            Jul 2008].
            
            Transcript Variant: This variant (14) lacks multiple exons from the
            5' end, contains an alternate 5' exon, and differs in the CDS
            compared to variant 1. The resulting isoform (14) has a much
            shorter N-terminus, lacks an internal segment in one region and
            contains an extra segment in a different region, compared to
            isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK295732.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-98                DN991561.1         8-105
            99-2062             AK295732.1         2-1965
            2063-5912           AC068506.10        48019-51868         c
FEATURES             Location/Qualifiers
     source          1..5912
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q12"
     gene            1..5912
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="dystrobrevin, alpha"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
     exon            1..365
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       7
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111611922"
     variation       84
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139673882"
     variation       205
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116132890"
     variation       216
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181193302"
     variation       229..230
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34399788"
     misc_feature    318..320
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="upstream in-frame stop codon"
     variation       359
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185407416"
     exon            366..490
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       393
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199983981"
     variation       422
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114170541"
     variation       433
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138085660"
     CDS             444..1802
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="isoform 14 is encoded by transcript variant 14;
                     dystrophin-related protein 3"
                     /codon_start=1
                     /product="dystrobrevin alpha isoform 14"
                     /protein_id="NP_001185871.1"
                     /db_xref="GI:312147274"
                     /db_xref="CCDS:CCDS56062.1"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
                     /translation="
MFPDQPEKPLNLAHIVPPRPVTSMNDTLFSHSVPSSGSPFITRRLPEGISASSPVAEEHSLIKLYVNQLDHGARSPPKDSEVEQNKLLARAAPAFLKGKGIQYSLNVADRLADEHVLIGLYVNMLRNNPSCMLESSNRLDEEHRLIARYAARLAAESSSSQPPQQRSAPDISFTIDANKQQRQLIAELENKNREILQEIQRLRLEHEQASQPTPEKAQQNPTLLAELRLLRQRKDELEQRMSALQESRRELMVQLEGLMKLLKTQGAGSPRSSPSHTISRPIPMPIRSASACSTPTHTPQDSLTGVGGDVQEAFAQSSRRNLRNDLLVAADSITNTMSSLVKELNSEVGSETESNVDSEFARTQFEDLVPSPTSEKAFLAQIHARKPGYIHSGATTSTMRGDMVTEDADPYVQPEDENYENDSVRQLENELQMEEYLKQKLQDEAYQVSLQG
"
     misc_feature    <996..1208
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Seryl-tRNA synthetase N-terminal domain; Region:
                     Seryl_tRNA_N; pfam02403"
                     /db_xref="CDD:202232"
     variation       444
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141981161"
     variation       458
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201472116"
     variation       467
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200830541"
     variation       488
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737438"
     variation       489
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148123045"
     exon            491..574
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     STS             510..897
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="D6S1400E"
                     /db_xref="UniSTS:147378"
     variation       513
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704854"
     variation       519
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374347283"
     exon            575..664
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       663
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80152252"
     exon            665..742
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       704
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192673085"
     exon            743..835
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       759
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150679265"
     variation       778
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375890182"
     variation       786
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139872140"
     variation       797
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368913791"
     variation       798
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373427602"
     variation       805
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186573363"
     variation       819
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199867593"
     variation       831..832
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34056668"
     variation       834
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377526715"
     exon            836..923
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       844
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374916548"
     variation       893
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144776465"
     variation       913
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147541731"
     variation       920
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202088347"
     exon            924..1021
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       927
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77320474"
     variation       943
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190619495"
     variation       968
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145061501"
     variation       969
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144880521"
     exon            1022..1135
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1055
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149071180"
     variation       1081
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199828427"
     variation       1125
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371363393"
     exon            1136..1232
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1141
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142108185"
     variation       1209
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376207145"
     variation       1218
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370629863"
     exon            1233..1392
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1253
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151158035"
     variation       1255
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200246467"
     variation       1260
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199645550"
     variation       1265
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113072494"
     variation       1310
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9959365"
     variation       1327
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145425478"
     variation       1336
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199556035"
     variation       1337
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373742103"
     variation       1338
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75615735"
     variation       1355
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199774892"
     variation       1366
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200805008"
     variation       1375
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199596768"
     exon            1393..1482
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1407
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372620035"
     variation       1425
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191002814"
     variation       1453
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376597436"
     variation       1460
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199855849"
     exon            1483..1651
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1528
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138143719"
     variation       1552
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201829681"
     variation       1557
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851710"
     variation       1583
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914309"
     variation       1597
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142009291"
     variation       1606
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150410546"
     variation       1611
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138145650"
     variation       1641
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368868084"
     variation       1642
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111587625"
     exon            1652..1784
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1657
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200977103"
     variation       1658
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374444921"
     variation       1667
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145486636"
     variation       1696
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113556738"
     variation       1717
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371303988"
     variation       1772
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187028045"
     exon            1785..1833
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     exon            1834..5912
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1975
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146475795"
     variation       2011
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116400062"
     variation       2032
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57165372"
     variation       2036
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16966155"
     variation       2113
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111248054"
     variation       2131
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139929781"
     variation       2163
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181083183"
     variation       2216
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9950418"
     variation       2293
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:149598633"
     variation       2315
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186132677"
     variation       2348
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200940754"
     variation       2426
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190607495"
     variation       2504
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182840042"
     variation       2673
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187385677"
     variation       2700
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149726324"
     variation       2727
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201835977"
     variation       2751
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111319152"
     variation       2803
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145238763"
     variation       2839
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372818476"
     variation       2843
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373595039"
     variation       3197..3198
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200402891"
     variation       3204..3205
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35125248"
     STS             3207..3471
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-21186"
                     /db_xref="UniSTS:13566"
     variation       3264
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367771488"
     variation       3309
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143236354"
     STS             3330..3532
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH81068"
                     /db_xref="UniSTS:84148"
     variation       3353
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151249058"
     variation       3364
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141815886"
     variation       3376
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3133"
     variation       3393
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192226645"
     variation       3442
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76507055"
     variation       3470
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376804490"
     variation       3527
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147118542"
     variation       3551
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183137910"
     variation       3584..3585
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34117234"
     variation       3602
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187414791"
     variation       3681
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138455778"
     variation       3719
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191833021"
     variation       3740
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16966160"
     variation       3842
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143972699"
     variation       3948
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182528646"
     variation       4074
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10502637"
     variation       4106
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187877718"
     variation       4149
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150254745"
     variation       4230
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138447301"
     variation       4231
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72962231"
     variation       4284
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192501097"
     variation       4325
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114631141"
     variation       4395
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9944927"
     variation       4563
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7227051"
     variation       4671
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184426501"
     variation       4697
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190514847"
     variation       4788
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112055845"
     STS             4868..5027
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="A006B16"
                     /db_xref="UniSTS:3979"
     STS             4868..5027
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="G20674"
                     /db_xref="UniSTS:3978"
     variation       4877
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149271384"
     STS             4980..5129
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-14278"
                     /db_xref="UniSTS:60009"
     variation       5043
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73418686"
     variation       5179
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192402506"
     variation       5226
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996755"
     variation       5312
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:674338"
     variation       5335..5336
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:34383224"
     variation       5336
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201691364"
     variation       5346..5347
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:5823957"
     variation       5358..5359
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:3081492"
     variation       5359..5360
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:200330341"
     STS             5503..5631
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH98997"
                     /db_xref="UniSTS:86943"
     variation       5520
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139109039"
     STS             5559..5843
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="SGC38125"
                     /db_xref="UniSTS:53214"
     variation       5633
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375929758"
     variation       5679
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10153380"
     variation       5733
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376796429"
     variation       5744
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142635681"
     polyA_signal    5894..5899
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
     variation       5901
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372697531"
     polyA_site      5912
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
ORIGIN      
ggtggttctcatagcaaccagcaccaaatgaaagagtacacgtcatgggtaaggcaaggtccaggcaatacttggagttggatgtgtgagtgttgcccagagttaaagggaatatcaaggatggtggcagaattaaagggcaaacttaccttccatcccaggtctagtattcagtcccccttcctcccactctccaccctactgcgtgctcttacttattctgttggaacccagtgtagcttcctgagatttaaaatataggaagactcaaaactatgttacttcttggaatatagataattcagtactgatttaaataacaactgaatagcaaggaccttctggaacataatcttacattcacaaaatcacctgctaagaagctgactaatgcattaagcaagtccctgagctgtgcttccagccgtgaacctttgcaccccatgttcccagatcagcctgagaagccactcaacttggctcacatcgtgcctcccagacctgtaaccagcatgaacgacaccctgttctcccactctgttccctcctcaggaagtccttttattaccaggaggttacctgagggaataagtgcatccagccctgtggctgaagagcattccctcataaagctgtacgtaaatcagcttgatcacggtgcacgctctcctcccaaggacagtgaagtagagcagaacaaactgctggctagggctgctccagcttttctgaagggcaaagggatacagtacagcctgaatgtggcagacaggctagctgatgaacatgttctcatcgggttgtatgtcaacatgctccggaacaacccctcatgcatgcttgagagttcaaaccggcttgatgaagaacacaggctaattgccaggtatgcggcaaggctggcagcagagtcctcttcgtctcagccacctcagcagagaagtgctcctgacatctctttcaccatcgatgcgaataagcagcaaaggcagctgattgctgagctagaaaacaagaacagagaaatcttacaggagatccagagacttcggctagagcatgaacaagcttctcagcccacgccagagaaggcacagcaaaaccccaccctgctggcagaactccggctcctcagacagcgcaaagatgagctggaacagagaatgtctgctctccaggagagccggagagagctaatggtccagttggagggtctcatgaagctactaaagactcagggggcaggctctccccgctcctcccccagccacaccatcagcaggccaattcccatgcccatccggtcagcgtcagcctgctccaccccgacgcacacgccgcaggactccctcacaggagtagggggagatgtacaagaggcatttgcacaaagttcaagaagaaacttaaggaatgacttgctagtggctgcagattccatcactaacactatgtcctctcttgtgaaagagctgaattctgaggttgggagtgaaacagagagtaatgtggattctgaatttgcacggactcagtttgaggatcttgttccctcaccaacctctgaaaaggcttttctagcgcaaatccatgcccgaaaacctgggtacattcacagtggagctaccacaagtaccatgcgtggcgacatggttacggaggatgcagatccctatgtgcagcctgaagatgaaaactatgaaaatgactctgtccggcagctggagaatgagctccagatggaggaatacctgaaacagaagctgcaagatgaagcttatcaggtcagcttgcaaggttgaatgcaatatccttttatcacactcctctcaagcaagctatagtcagacagatgatgaaagtaacatgaaaactggtgatgatggagagccctgtggccacacagaggaggaagacagcagcctggcagcagcctcaccgaagagaggaaccaccacacccagcagctcctgacagacccccacccctaaagatgtgtcctgatgactatagtgcagctaactttttgttctcagatttgtagtgcataggtgtgtgtttcaagaaggaaaaaaaaagacttctgttcaaagttaacttatcagctacatcctctgtaacgtggttcatccctggttaaaaagcaaacaaacacaggctgaaaacccatgctgctgttatacacaatggcagtattaacaagcattttaaacctttgcacatgatattgaacctgttcagtttacaatgacaatattaatactgtttatagctagaagtttgatttctgaattctttgagattttagcaaaacagtttattatacactgtacatttttttcacagcaattggaaaaaaacaaccacttgcaatcattcaataaccctgaagaatttggttcctgagtgtacaaactcagagcccggaagccaagaagggtccttggcctgcacggtctgtagttgactccaagtctctgtgagcagtgacttgaaccaaacacaccaggaataatccattctttggggcctctttccaactcgaggttgttttctttcaagatactctaatcagccatagaatttagtgtaaatatttttttttccaaatagatatcatattcaaaaaaggcagcattcaaattatatagaatctagtttttaaaatcagcacagatcttcttaaaaactgtgaactatgttttgaaatactcgttactaaagctgtttataaaccacaggtgccataagatccccaaacggactaaagttatctctgctcttccatggtcttgttcctctcgttttggctttaggaagcatgtctttaacagcaccgctcgttcacaagttcccccatcaagttgtttggaggccttcagctttaaatgtacaggcttaaagtgcgcttgcaaacgtttgctctcctttttttctgaatgttgattgccttagctggccacctggtgttctgcatgtagccttctgtggtcatgtgaaaggagacaggctcttctaagttgagttgggatttttgcactcagtgaaaagctgaagtgcaaaagagctatcaaagacaagaggataaaagactgggatagtcttttccaaggaccctctttagagggccctaaagacctcctttgggaattctggggaaaaagaaaaagtaatcttctacttgcttcaagatttgatttttttaaaaaagcctgcgacctattcaatacattatgcttaaattagcagtttctctggaattcctgtctctcctttaaaagaaaggagagaacattttagaacaatagttctcaaagtgtgttccccggacaagcagcatctgcaacacttaggaaggtcttcgaaatactaatttgtaagccccacctcaggcctactgaatcagaagctctgggggttgggtccagaagtctgttttagtcaaccctctaggtgattctgatgctcgctaaaggttgagaactactgctttagaatgaagtcgtataataaagtctctgaaaaggccttattcagaataagcaagaaaggttctgtgattcacttttgcttctggggctggcaaaaaccttctctgaacccacacaccaagttcgtagttggtaggtgcccagccaagtcctgacatcttcatgccccctctgcagagggcggctgtacgatgttcacatgtctgcgtttggtcagacatcatctccttggctgccctttgaaaccaaatcacttgccttggggataaagtgctcaattggcattagtgagaagcccatcctatcccttgacatacttaatcatatatctctccagagaactcacctgacaaatgtctctgagcacaggctgacaccaaagtggcacaactgcacagttctcagatttctttgcacagattgatttttattgcgggttttgttggggtgtcttaatgttcatctcttttccactgcccatcctctgtgaacccatacctctctagatggagcaggtggccactggtgcctcatactcagtattgaaaaccactacatcccagctacctataatgctgtcagctcaaaatcatagccaggtagttcttgaactcagaacttaaatcctgcacgtggcactccaccactgactggaccgagctggcatatgttgtttctttgtgtttctacatcaaaatgttcgtctaagatttgaactgttctgctgataaccttccccgttgtcatagctatttcattgccaaccaactccatcacatggttgttgatatcgtcatataaagccattgcaaggactctggaaactgccgccaatgaccaatttctgactaaccagccaccttttctctctcttagctccacgtcagcactgagaccagactcgagcacccctgtcctgtaagcgagacaaaatggcgtgtgttattttggggttttgtgttttttggtgggtttctttccttggctctccagatttacttttggggcctgttctaagtgcaaacccagcaagtttcacttgtcctgtccattagatacaactacatcttgcgggggttgtttctttcttgttccacaatgaattgcacatccatctccatcagagctgatagcctgttaataagcactggtctaacacagccaaccctcctccacagcgccatattaatggaggaggggaggaaggtgaaatctactgcatgggattcaggaaacagttgtggttggtcaggacggaagttggggtaagtttggttggtcagagggagttgtgctggagattgtgaaaaatgggttcttgaatgatctactataaggcagggaaggttcatttgtaagtagtaatgtgaactgaattgcattaagagtgtgtggcctttgttgtgatatactatgtattttcttatatgcatgagccaaactgttgcatcataatttagcactgatgtctgcttttattttgatcatctttgtccacccttattagttcttggctgttaaccgtagatagatcttgtaaatccagcaacctttggttgctgcattccccttggttcgattccacgcaaggagccacaagtgagaactccactgtccttagaagaaagggcatttttacttttgaaccaaaaagagaaaaaaaaatcagaagtgttgcatcttgaggcgaattaactgtaagacatttttaattatgactactgcaatttgacaccatttgaaataatcaattcagagacactaaagatttcacaatattcattggtattgtaaaaaaaaaatactattgtatggatttttgtattgctgttaagtattgttttgtgtgtgtgtgtgtgtgtgtgtgttggaacctcctggggacatgttatattttgaagtgattaaactatttaattgtgtgtctatattttggagtggaataatttcttcattaaaaaatgtttttaaaaacactatatcttgggtggtttattcctttgtttcagtgaatctttcctaaagcaacgtggagtcagtctgttgaaagaaggaaggcaggtacttgcagtttaaagcaggacccattgatggaatattgagccaccgaggcaaaatagctcaccttctcttgccttgggggatgcatggtttttaccattctactgttttattagcatctgtgagcatctaatagaaatactattctgctatttatggaaatccttattataattgatatggaagtgagtttgaaattctaacagctaacatatttcatgtttgtatcacacactgttcttaacactttatgtgacttcactcaattctttgaatcctctgcatctagccatgtattctgcaaatattaagtgctcaatggtttttttgttgaattactgaataaatgaattagtggtg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1837 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1837 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1837 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1837 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007274 [neuromuscular synaptic transmission] evidence: TAS
            GeneID:1837 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1837 -> Cellular component: GO:0045202 [synapse] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.