GGRNA Home | Help | Advanced search

2020-10-24 07:06:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001198939            6530 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 11,
            mRNA.
ACCESSION   NM_001198939
VERSION     NM_001198939.1  GI:312147258
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6530)
  AUTHORS   Navakauskiene,R., Treigyte,G., Borutinskaite,V.V., Matuzevicius,D.,
            Navakauskas,D. and Magnusson,K.E.
  TITLE     Alpha-Dystrobrevin and its associated proteins in human
            promyelocytic leukemia cells induced to apoptosis
  JOURNAL   J Proteomics 75 (11), 3291-3303 (2012)
   PUBMED   22507200
  REMARK    GeneRIF: apoptosis-induction in HL-60 cells involves not only
            classical markers of apoptosis but also a network
            alpha-DB-associated proteins at the cell membrane, the cytoplasm
            and nucleus, affecting key cellular transport processes and
            cellular structure.
REFERENCE   2  (bases 1 to 6530)
  AUTHORS   Borutinskaite,V.V., Magnusson,K.E. and Navakauskiene,R.
  TITLE     alpha-Dystrobrevin distribution and association with other proteins
            in human promyelocytic NB4 cells treated for granulocytic
            differentiation
  JOURNAL   Mol. Biol. Rep. 38 (5), 3001-3011 (2011)
   PUBMED   20111909
  REMARK    GeneRIF: Results suggest that alpha-dystrobrevin isoforms play a
            central role in cytoskeleton reorganization via their multiple
            interactions with actin and actin-associating proteins.
REFERENCE   3  (bases 1 to 6530)
  AUTHORS   Lyssand,J.S., Whiting,J.L., Lee,K.S., Kastl,R., Wacker,J.L.,
            Bruchas,M.R., Miyatake,M., Langeberg,L.K., Chavkin,C., Scott,J.D.,
            Gardner,R.G., Adams,M.E. and Hague,C.
  TITLE     Alpha-dystrobrevin-1 recruits alpha-catulin to the
            alpha1D-adrenergic receptor/dystrophin-associated protein complex
            signalosome
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 107 (50), 21854-21859 (2010)
   PUBMED   21115837
  REMARK    GeneRIF: Data show that alpha-dystrobrevin-1 recruits
            alpha-catulin, which supersensitizes alpha(1D)-AR functional
            responses by recruiting effector molecules to the signalosome.
REFERENCE   4  (bases 1 to 6530)
  AUTHORS   Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
            Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
            Aloisi,F., Petrucci,T.C. and Ambrosini,E.
  TITLE     MLC1 trafficking and membrane expression in astrocytes: role of
            caveolin-1 and phosphorylation
  JOURNAL   Neurobiol. Dis. 37 (3), 581-595 (2010)
   PUBMED   19931615
REFERENCE   5  (bases 1 to 6530)
  AUTHORS   Bohm,S.V., Constantinou,P., Tan,S., Jin,H. and Roberts,R.G.
  TITLE     Profound human/mouse differences in alpha-dystrobrevin isoforms: a
            novel syntrophin-binding site and promoter missing in mouse and rat
  JOURNAL   BMC Biol. 7, 85 (2009)
   PUBMED   19961569
  REMARK    GeneRIF: Fundamental functional differences between the
            alpha-dystrobrevins of mice and humans raises questions about the
            use of the mouse as a model animal for Duchenne muscular dystrophy.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 6530)
  AUTHORS   Sadoulet-Puccio,H.M., Feener,C.A., Schaid,D.J., Thibodeau,S.N.,
            Michels,V.V. and Kunkel,L.M.
  TITLE     The genomic organization of human dystrobrevin
  JOURNAL   Neurogenetics 1 (1), 37-42 (1997)
   PUBMED   10735273
REFERENCE   7  (bases 1 to 6530)
  AUTHORS   Blake,D.J., Nawrotzki,R., Peters,M.F., Froehner,S.C. and
            Davies,K.E.
  TITLE     Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic
            protein
  JOURNAL   J. Biol. Chem. 271 (13), 7802-7810 (1996)
   PUBMED   8631824
REFERENCE   8  (bases 1 to 6530)
  AUTHORS   Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
            Kunkel,L.M.
  TITLE     The three human syntrophin genes are expressed in diverse tissues,
            have distinct chromosomal locations, and each bind to dystrophin
            and its relatives
  JOURNAL   J. Biol. Chem. 271 (5), 2724-2730 (1996)
   PUBMED   8576247
REFERENCE   9  (bases 1 to 6530)
  AUTHORS   Ahn,A.H. and Kunkel,L.M.
  TITLE     Syntrophin binds to an alternatively spliced exon of dystrophin
  JOURNAL   J. Cell Biol. 128 (3), 363-371 (1995)
   PUBMED   7844150
REFERENCE   10 (bases 1 to 6530)
  AUTHORS   Khurana,T.S., Engle,E.C., Bennett,R.R., Silverman,G.A., Selig,S.,
            Bruns,G.A. and Kunkel,L.M.
  TITLE     (CA) repeat polymorphism in the chromosome 18 encoded
            dystrophin-like protein
  JOURNAL   Hum. Mol. Genet. 3 (5), 841 (1994)
   PUBMED   8081380
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA197970.1, AL833285.1,
            BC005300.1 and AC068506.10.
            
            Summary: The protein encoded by this gene belongs to the
            dystrobrevin subfamily of the dystrophin family. This protein is a
            component of the dystrophin-associated protein complex (DPC), which
            consists of dystrophin and several integral and peripheral membrane
            proteins, including dystroglycans, sarcoglycans, syntrophins and
            alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma
            and its disruption is associated with various forms of muscular
            dystrophy. Mutations in this gene are associated with left
            ventricular noncompaction with congenital heart defects. Multiple
            alternatively spliced transcript variants encoding different
            isoforms have been identified for this gene. [provided by RefSeq,
            Jul 2008].
            
            Transcript Variant: This variant (11) differs in the CDS compared
            to variant 1. The resulting isoform (11) lacks two internal
            segments but has an extra segment in a downstream region, compared
            to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AL833285.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-40                DA197970.1         1-40
            41-605              AL833285.1         1-565
            606-1432            BC005300.1         566-1392
            1433-3222           AL833285.1         1393-3182
            3223-6530           AC068506.10        48019-51326         c
FEATURES             Location/Qualifiers
     source          1..6530
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q12"
     gene            1..6530
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="dystrobrevin, alpha"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
     exon            1..221
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       115
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148813783"
     variation       126
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143454310"
     variation       170
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183120151"
     exon            222..346
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       222
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116580692"
     variation       229
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78178126"
     misc_feature    312..314
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="upstream in-frame stop codon"
     exon            347..414
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     CDS             348..2420
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="isoform 11 is encoded by transcript variant 11;
                     dystrophin-related protein 3"
                     /codon_start=1
                     /product="dystrobrevin alpha isoform 11"
                     /protein_id="NP_001185868.1"
                     /db_xref="GI:312147259"
                     /db_xref="CCDS:CCDS56061.1"
                     /db_xref="GeneID:1837"
                     /db_xref="HGNC:3057"
                     /db_xref="MIM:601239"
                     /translation="
MIEDSGKRGNTMAERRQLFAEMRAQDLDRIRLSTYRTACKLRFVQKKCNLHLVDIWNVIEALRENALNNLDPNTELNVSRLEAVLSTIFYQLNKRMPTTHQIHVEQSISLLLNFLLAAFDPEGHGKISVFAVKMALATLCGGKIMDKLRYIFSMISDSSGVMVYGRYDQFLREVLKLPTAVFEGPSFGYTEQSARSCFSQQKKVTLNGFLDTLMSDPPPQCLVWLPLLHRLANVENVFHPVECSYCHSESMMGFRYRCQQCHNYQLCQDCFWRGHAGGSHSNQHQMKEYTSWKSPAKKLTNALSKSLSCASSREPLHPMFPDQPEKPLNLAHIVPPRPVTSMNDTLFSHSVPSSGSPFITRSMLESSNRLDEEHRLIARYAARLAAESSSSQPPQQRSAPDISFTIDANKQQRQLIAELENKNREILQEIQRLRLEHEQASQPTPEKAQQNPTLLAELRLLRQRKDELEQRMSALQESRRELMVQLEGLMKLLKEEELKQGTQGAGSPRSSPSHTISRPIPMPIRSASACSTPTHTPQDSLTGVGGDVQEAFAQSSRRNLRNDLLVAADSITNTMSSLVKELNSEVGSETESNVDSEFARTQFEDLVPSPTSEKAFLAQIHARKPGYIHSGATTSTMRGDMVTEDADPYVQPEDENYENDSVRQLENELQMEEYLKQKLQDEAYQVSLQG
"
     misc_feature    387..767
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="EF hand; Region: efhand_1; pfam09068"
                     /db_xref="CDD:149945"
     misc_feature    777..1043
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="EF-hand; Region: efhand_2; pfam09069"
                     /db_xref="CDD:149946"
     misc_feature    1068..1214
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Zinc finger, ZZ type. Zinc finger present in
                     dystrophin and dystrobrevin. The ZZ motif coordinates two
                     zinc ions and most likely participates in ligand binding
                     or molecular scaffolding. Dystrophin attaches actin
                     filaments to an integral membrane...; Region:
                     ZZ_dystrophin; cd02334"
                     /db_xref="CDD:30238"
     misc_feature    order(1074..1076,1083..1085,1119..1121,1128..1130,
                     1146..1148,1155..1157,1185..1187,1197..1199)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Zinc-binding sites [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(1074..1076,1083..1085,1146..1148,1155..1157)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="zinc cluster 1 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(1077..1079,1110..1112,1116..1118,1134..1136,
                     1140..1142)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="putative charged binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(1113..1115,1158..1160,1203..1205,1212..1214)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="putative hydrophobic binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(1119..1121,1128..1130,1185..1187,1197..1199)
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="zinc cluster 2 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    <1593..1796
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /note="Seryl-tRNA synthetase N-terminal domain; Region:
                     Seryl_tRNA_N; pfam02403"
                     /db_xref="CDD:202232"
     variation       354
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200021359"
     variation       398
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368000651"
     exon            415..495
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       439
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202046233"
     variation       446
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200882383"
     variation       459
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200256996"
     variation       473
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376001633"
     variation       482
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1071632"
     exon            496..709
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       521
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145335092"
     variation       553
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148805060"
     variation       557
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117571555"
     variation       573
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113870126"
     variation       576
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147782267"
     variation       578
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147759402"
     variation       590
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146923532"
     variation       639
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150961489"
     variation       642
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200736432"
     variation       663
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140768365"
     variation       700
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141141892"
     variation       709
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:104894654"
     exon            710..795
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       718
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150147476"
     variation       735
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375175495"
     variation       770
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376651004"
     exon            796..950
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       818..819
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:11417127"
     variation       823
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147115867"
     variation       826
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201550119"
     variation       829
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199960642"
     variation       844
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376007740"
     variation       853
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201674479"
     variation       854
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367763240"
     variation       884
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11877640"
     variation       886
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1048081"
     variation       899
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201461820"
     variation       900
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200306991"
     exon            951..1056
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       961
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201071018"
     variation       1004
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140446215"
     variation       1022
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376519672"
     exon            1057..1223
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1131
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369043538"
     variation       1166
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199617326"
     variation       1171
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373047659"
     variation       1182
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111611922"
     exon            1224..1348
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1251
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199983981"
     variation       1280
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114170541"
     variation       1291
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138085660"
     variation       1302
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141981161"
     variation       1316
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201472116"
     variation       1325
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200830541"
     variation       1346
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737438"
     variation       1347
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148123045"
     exon            1349..1432
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     STS             1368..1494
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="D6S1400E"
                     /db_xref="UniSTS:147378"
     variation       1371
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704854"
     variation       1377
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374347283"
     exon            1433..1520
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1441
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374916548"
     variation       1490
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144776465"
     variation       1510
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147541731"
     variation       1517
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202088347"
     exon            1521..1618
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1524
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77320474"
     variation       1540
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190619495"
     variation       1565
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145061501"
     variation       1566
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144880521"
     exon            1619..1732
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1652
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149071180"
     variation       1678
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199828427"
     variation       1722
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371363393"
     exon            1733..1829
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1738
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142108185"
     variation       1806
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376207145"
     variation       1815
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370629863"
     exon            1830..1850
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     exon            1851..2010
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       1871
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151158035"
     variation       1873
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200246467"
     variation       1878
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199645550"
     variation       1883
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113072494"
     variation       1928
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9959365"
     variation       1945
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145425478"
     variation       1954
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199556035"
     variation       1955
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373742103"
     variation       1956
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75615735"
     variation       1973
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199774892"
     variation       1984
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200805008"
     variation       1993
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199596768"
     exon            2011..2100
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2025
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372620035"
     variation       2043
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191002814"
     variation       2071
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376597436"
     variation       2078
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199855849"
     exon            2101..2269
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2146
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138143719"
     variation       2170
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201829681"
     variation       2175
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851710"
     variation       2201
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914309"
     variation       2215
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142009291"
     variation       2224
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150410546"
     variation       2229
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138145650"
     variation       2259
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368868084"
     variation       2260
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111587625"
     exon            2270..2402
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2275
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200977103"
     variation       2276
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374444921"
     variation       2285
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145486636"
     variation       2314
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113556738"
     variation       2335
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371303988"
     variation       2390
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187028045"
     exon            2403..2451
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     exon            2452..6530
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /inference="alignment:Splign:1.39.8"
     variation       2593
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146475795"
     variation       2629
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116400062"
     variation       2650
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57165372"
     variation       2654
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16966155"
     variation       2731
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111248054"
     variation       2749
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139929781"
     variation       2781
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181083183"
     variation       2834
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9950418"
     variation       2911
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:149598633"
     variation       2933
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186132677"
     variation       2966
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200940754"
     variation       3044
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190607495"
     variation       3122
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182840042"
     variation       3291
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187385677"
     variation       3318
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149726324"
     variation       3345
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201835977"
     variation       3369
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111319152"
     variation       3421
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145238763"
     variation       3457
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372818476"
     variation       3461
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373595039"
     variation       3815..3816
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200402891"
     variation       3822..3823
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35125248"
     STS             3825..4089
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-21186"
                     /db_xref="UniSTS:13566"
     variation       3882
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367771488"
     variation       3927
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143236354"
     STS             3948..4150
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH81068"
                     /db_xref="UniSTS:84148"
     variation       3971
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151249058"
     variation       3982
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141815886"
     variation       3994
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3133"
     variation       4011
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192226645"
     variation       4060
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76507055"
     variation       4088
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376804490"
     variation       4145
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147118542"
     variation       4169
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183137910"
     variation       4202..4203
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34117234"
     variation       4220
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187414791"
     variation       4299
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138455778"
     variation       4337
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191833021"
     variation       4358
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16966160"
     variation       4460
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143972699"
     variation       4566
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182528646"
     variation       4692
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10502637"
     variation       4724
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187877718"
     variation       4767
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150254745"
     variation       4848
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138447301"
     variation       4849
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72962231"
     variation       4902
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192501097"
     variation       4943
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114631141"
     variation       5013
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9944927"
     variation       5181
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7227051"
     variation       5289
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184426501"
     variation       5315
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190514847"
     variation       5406
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112055845"
     STS             5486..5645
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="A006B16"
                     /db_xref="UniSTS:3979"
     STS             5486..5645
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="G20674"
                     /db_xref="UniSTS:3978"
     variation       5495
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149271384"
     STS             5598..5747
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="WI-14278"
                     /db_xref="UniSTS:60009"
     variation       5661
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73418686"
     variation       5797
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192402506"
     variation       5844
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996755"
     variation       5930
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:674338"
     variation       5953..5954
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:34383224"
     variation       5954
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201691364"
     variation       5964..5965
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:5823957"
     variation       5976..5977
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:3081492"
     variation       5977..5978
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace=""
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:200330341"
     STS             6121..6249
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="RH98997"
                     /db_xref="UniSTS:86943"
     variation       6138
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139109039"
     STS             6177..6461
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /standard_name="SGC38125"
                     /db_xref="UniSTS:53214"
     variation       6251
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375929758"
     variation       6297
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10153380"
     variation       6351
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376796429"
     variation       6362
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142635681"
     polyA_signal    6512..6517
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
     variation       6519
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372697531"
     polyA_site      6530
                     /gene="DTNA"
                     /gene_synonym="D18S892E; DRP3; DTN; DTN-A; LVNC1"
ORIGIN      
attttcaagttaaagatagacacagtacacaccaggatctagaggctggatttcatactcatagctctccctagaatttcagagagttctgttatgatctctgttgtaattaccaatttggttcaagtttgttctttaaatgaatatgcttagaattcacatatgttctggatgtactggaattaaaaggatttaagagatcatggtgtgcatgttctaggataaataggatttaccaatccttggatgaagtgcttgggaagtctttaagtgccataatcaactgccatttcaaagaatatagatggttttgaaaagttcatgctgtcccttcattgaattttagaatgattgaagatagtgggaaaagaggaaataccatggcagaaagaagacagctgtttgcagagatgagggctcaagatctggatcgcatccgactctccacctacagaacagcatgcaagcttaggtttgttcagaagaaatgcaatttgcacctggtggacatatggaatgtcatagaagcattgcgggaaaatgctctgaacaacctggacccaaacactgaactcaacgtgtcccgcttagaggctgtgctctccactattttttaccagctcaacaaacggatgccaaccactcaccaaatccatgtggagcagtccatcagcctcctccttaacttcctgcttgcagcgtttgatccggaaggccatggtaaaatttcagtatttgctgtcaaaatggctttagccacattgtgtggagggaagatcatggacaaattaagatatattttctcaatgatttctgactccagtggggtgatggtttatggacgatatgaccaattccttcgggaagttctcaaactacccacggcagtttttgaaggtccttcatttggttacacagaacagtcagccagatcctgtttctcccaacagaaaaaagtcacgttaaatggtttcttggacacgcttatgtcagatcctcccccgcagtgtctggtctggttgcctcttctgcatcgactagcaaatgtggaaaatgtcttccatccggttgagtgttcctactgccacagtgagagtatgatgggatttcgctaccgatgccaacagtgtcacaattaccagctctgtcaggactgcttctggaggggacatgccggtggttctcatagcaaccagcaccaaatgaaagagtacacgtcatggaaatcacctgctaagaagctgactaatgcattaagcaagtccctgagctgtgcttccagccgtgaacctttgcaccccatgttcccagatcagcctgagaagccactcaacttggctcacatcgtgcctcccagacctgtaaccagcatgaacgacaccctgttctcccactctgttccctcctcaggaagtccttttattaccaggagcatgcttgagagttcaaaccggcttgatgaagaacacaggctaattgccaggtatgcggcaaggctggcagcagagtcctcttcgtctcagccacctcagcagagaagtgctcctgacatctctttcaccatcgatgcgaataagcagcaaaggcagctgattgctgagctagaaaacaagaacagagaaatcttacaggagatccagagacttcggctagagcatgaacaagcttctcagcccacgccagagaaggcacagcaaaaccccaccctgctggcagaactccggctcctcagacagcgcaaagatgagctggaacagagaatgtctgctctccaggagagccggagagagctaatggtccagttggagggtctcatgaagctactaaaggaagaagaactgaagcagggaactcagggggcaggctctccccgctcctcccccagccacaccatcagcaggccaattcccatgcccatccggtcagcgtcagcctgctccaccccgacgcacacgccgcaggactccctcacaggagtagggggagatgtacaagaggcatttgcacaaagttcaagaagaaacttaaggaatgacttgctagtggctgcagattccatcactaacactatgtcctctcttgtgaaagagctgaattctgaggttgggagtgaaacagagagtaatgtggattctgaatttgcacggactcagtttgaggatcttgttccctcaccaacctctgaaaaggcttttctagcgcaaatccatgcccgaaaacctgggtacattcacagtggagctaccacaagtaccatgcgtggcgacatggttacggaggatgcagatccctatgtgcagcctgaagatgaaaactatgaaaatgactctgtccggcagctggagaatgagctccagatggaggaatacctgaaacagaagctgcaagatgaagcttatcaggtcagcttgcaaggttgaatgcaatatccttttatcacactcctctcaagcaagctatagtcagacagatgatgaaagtaacatgaaaactggtgatgatggagagccctgtggccacacagaggaggaagacagcagcctggcagcagcctcaccgaagagaggaaccaccacacccagcagctcctgacagacccccacccctaaagatgtgtcctgatgactatagtgcagctaactttttgttctcagatttgtagtgcataggtgtgtgtttcaagaaggaaaaaaaaagacttctgttcaaagttaacttatcagctacatcctctgtaacgtggttcatccctggttaaaaagcaaacaaacacaggctgaaaacccatgctgctgttatacacaatggcagtattaacaagcattttaaacctttgcacatgatattgaacctgttcagtttacaatgacaatattaatactgtttatagctagaagtttgatttctgaattctttgagattttagcaaaacagtttattatacactgtacatttttttcacagcaattggaaaaaaacaaccacttgcaatcattcaataaccctgaagaatttggttcctgagtgtacaaactcagagcccggaagccaagaagggtccttggcctgcacggtctgtagttgactccaagtctctgtgagcagtgacttgaaccaaacacaccaggaataatccattctttggggcctctttccaactcgaggttgttttctttcaagatactctaatcagccatagaatttagtgtaaatatttttttttccaaatagatatcatattcaaaaaaggcagcattcaaattatatagaatctagtttttaaaatcagcacagatcttcttaaaaactgtgaactatgttttgaaatactcgttactaaagctgtttataaaccacaggtgccataagatccccaaacggactaaagttatctctgctcttccatggtcttgttcctctcgttttggctttaggaagcatgtctttaacagcaccgctcgttcacaagttcccccatcaagttgtttggaggccttcagctttaaatgtacaggcttaaagtgcgcttgcaaacgtttgctctcctttttttctgaatgttgattgccttagctggccacctggtgttctgcatgtagccttctgtggtcatgtgaaaggagacaggctcttctaagttgagttgggatttttgcactcagtgaaaagctgaagtgcaaaagagctatcaaagacaagaggataaaagactgggatagtcttttccaaggaccctctttagagggccctaaagacctcctttgggaattctggggaaaaagaaaaagtaatcttctacttgcttcaagatttgatttttttaaaaaagcctgcgacctattcaatacattatgcttaaattagcagtttctctggaattcctgtctctcctttaaaagaaaggagagaacattttagaacaatagttctcaaagtgtgttccccggacaagcagcatctgcaacacttaggaaggtcttcgaaatactaatttgtaagccccacctcaggcctactgaatcagaagctctgggggttgggtccagaagtctgttttagtcaaccctctaggtgattctgatgctcgctaaaggttgagaactactgctttagaatgaagtcgtataataaagtctctgaaaaggccttattcagaataagcaagaaaggttctgtgattcacttttgcttctggggctggcaaaaaccttctctgaacccacacaccaagttcgtagttggtaggtgcccagccaagtcctgacatcttcatgccccctctgcagagggcggctgtacgatgttcacatgtctgcgtttggtcagacatcatctccttggctgccctttgaaaccaaatcacttgccttggggataaagtgctcaattggcattagtgagaagcccatcctatcccttgacatacttaatcatatatctctccagagaactcacctgacaaatgtctctgagcacaggctgacaccaaagtggcacaactgcacagttctcagatttctttgcacagattgatttttattgcgggttttgttggggtgtcttaatgttcatctcttttccactgcccatcctctgtgaacccatacctctctagatggagcaggtggccactggtgcctcatactcagtattgaaaaccactacatcccagctacctataatgctgtcagctcaaaatcatagccaggtagttcttgaactcagaacttaaatcctgcacgtggcactccaccactgactggaccgagctggcatatgttgtttctttgtgtttctacatcaaaatgttcgtctaagatttgaactgttctgctgataaccttccccgttgtcatagctatttcattgccaaccaactccatcacatggttgttgatatcgtcatataaagccattgcaaggactctggaaactgccgccaatgaccaatttctgactaaccagccaccttttctctctcttagctccacgtcagcactgagaccagactcgagcacccctgtcctgtaagcgagacaaaatggcgtgtgttattttggggttttgtgttttttggtgggtttctttccttggctctccagatttacttttggggcctgttctaagtgcaaacccagcaagtttcacttgtcctgtccattagatacaactacatcttgcgggggttgtttctttcttgttccacaatgaattgcacatccatctccatcagagctgatagcctgttaataagcactggtctaacacagccaaccctcctccacagcgccatattaatggaggaggggaggaaggtgaaatctactgcatgggattcaggaaacagttgtggttggtcaggacggaagttggggtaagtttggttggtcagagggagttgtgctggagattgtgaaaaatgggttcttgaatgatctactataaggcagggaaggttcatttgtaagtagtaatgtgaactgaattgcattaagagtgtgtggcctttgttgtgatatactatgtattttcttatatgcatgagccaaactgttgcatcataatttagcactgatgtctgcttttattttgatcatctttgtccacccttattagttcttggctgttaaccgtagatagatcttgtaaatccagcaacctttggttgctgcattccccttggttcgattccacgcaaggagccacaagtgagaactccactgtccttagaagaaagggcatttttacttttgaaccaaaaagagaaaaaaaaatcagaagtgttgcatcttgaggcgaattaactgtaagacatttttaattatgactactgcaatttgacaccatttgaaataatcaattcagagacactaaagatttcacaatattcattggtattgtaaaaaaaaaatactattgtatggatttttgtattgctgttaagtattgttttgtgtgtgtgtgtgtgtgtgtgtgttggaacctcctggggacatgttatattttgaagtgattaaactatttaattgtgtgtctatattttggagtggaataatttcttcattaaaaaatgtttttaaaaacactatatcttgggtggtttattcctttgtttcagtgaatctttcctaaagcaacgtggagtcagtctgttgaaagaaggaaggcaggtacttgcagtttaaagcaggacccattgatggaatattgagccaccgaggcaaaatagctcaccttctcttgccttgggggatgcatggtttttaccattctactgttttattagcatctgtgagcatctaatagaaatactattctgctatttatggaaatccttattataattgatatggaagtgagtttgaaattctaacagctaacatatttcatgtttgtatcacacactgttcttaacactttatgtgacttcactcaattctttgaatcctctgcatctagccatgtattctgcaaatattaagtgctcaatggtttttttgttgaattactgaataaatgaattagtggtg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1837 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1837 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1837 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1837 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:1837 -> Biological process: GO:0007274 [neuromuscular synaptic transmission] evidence: TAS
            GeneID:1837 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:1837 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1837 -> Cellular component: GO:0045202 [synapse] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.