GGRNA Home | Help | Advanced search

2019-03-24 19:52:31, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001197297            4745 bp    mRNA    linear   PRI 24-JUN-2013
DEFINITION  Homo sapiens GA binding protein transcription factor, alpha subunit
            60kDa (GABPA), transcript variant 2, mRNA.
ACCESSION   NM_001197297
VERSION     NM_001197297.1  GI:308818208
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4745)
  AUTHORS   Khan,A.O., Alrashed,M. and Alkuraya,F.S.
  TITLE     Clinical characterisation of the CABP4-related retinal phenotype
  JOURNAL   Br J Ophthalmol 97 (3), 262-265 (2013)
   PUBMED   23099293
  REMARK    GeneRIF: The phenotype is best uniformly termed congenital cone-rod
            synaptic disorder. In Saudi Arabia a founder homozygous c.81_82insA
            CABP4 mutation is a recurrent cause.
REFERENCE   2  (bases 1 to 4745)
  AUTHORS   Odrowaz,Z. and Sharrocks,A.D.
  TITLE     The ETS transcription factors ELK1 and GABPA regulate different
            gene networks to control MCF10A breast epithelial cell migration
  JOURNAL   PLoS ONE 7 (12), E49892 (2012)
   PUBMED   23284628
  REMARK    GeneRIF: although ELK1 and GABPA ultimately control the same
            biological process, they do so by regulating different cohorts of
            target genes associated with cytoskeletal functions and cell
            migration contro
REFERENCE   3  (bases 1 to 4745)
  AUTHORS   Weng,C.J., Chen,M.J., Yeh,C.T. and Yen,G.C.
  TITLE     Hepatoprotection of quercetin against oxidative stress by induction
            of metallothionein expression through activating MAPK and PI3K
            pathways and enhancing Nrf2 DNA-binding activity
  JOURNAL   N Biotechnol 28 (6), 767-777 (2011)
   PUBMED   21624509
  REMARK    GeneRIF: Hepatoprotection of quercetin against oxidative stress by
            induction of metallothionein expression through activating MAPK and
            PI3K pathways and enhancing Nrf2 DNA-binding activity.
REFERENCE   4  (bases 1 to 4745)
  AUTHORS   Zhang,Y.Q., Li,K.N., Cui,J.H., Liu,Y.F. and Yang,S.J.
  TITLE     Abnormal expression of NRF-2alpha in hepatocellular carcinoma
            identified with a newly prepared monoclonal antibody against human
            NRF-2alpha protein
  JOURNAL   Mol. Biol. Rep. 38 (5), 3083-3088 (2011)
   PUBMED   20127517
  REMARK    GeneRIF: expression of NRF-2alpha in hepatocellular carcinoma (HCC)
            and tumor-adjacent specimens; higher-grade frequency of expression
            of NRF-2alpha in tumor-adjacent tissues was higher than tumor
            tissues, suggesting NRF-2alpha may play important role in
            carcinogenesis of HCC
REFERENCE   5  (bases 1 to 4745)
  AUTHORS   Masuko,H., Sakamoto,T., Kaneko,Y., Iijima,H., Naito,T., Noguchi,E.,
            Hirota,T., Tamari,M. and Hizawa,N.
  TITLE     An interaction between Nrf2 polymorphisms and smoking status
            affects annual decline in FEV1: a longitudinal retrospective cohort
            study
  JOURNAL   BMC Med. Genet. 12, 97 (2011)
   PUBMED   21774808
  REMARK    GeneRIF: an Nrf2-dependent response to exogenous stimuli may affect
            annual FEV1 decline
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4745)
  AUTHORS   Goto,M., Shimizu,T., Sawada,J., Sawa,C., Watanabe,H., Ichikawa,H.,
            Ohira,M., Ohki,M. and Handa,H.
  TITLE     Assignment of the E4TF1-60 gene to human chromosome 21q21.2-q21.3
  JOURNAL   Gene 166 (2), 337-338 (1995)
   PUBMED   8543189
REFERENCE   7  (bases 1 to 4745)
  AUTHORS   Chrast,R., Chen,H., Morris,M.A. and Antonarakis,S.E.
  TITLE     Mapping of the human transcription factor GABPA (E4TF1-60) gene to
            chromosome 21
  JOURNAL   Genomics 28 (1), 119-122 (1995)
   PUBMED   7590737
REFERENCE   8  (bases 1 to 4745)
  AUTHORS   Gugneja,S., Virbasius,J.V. and Scarpulla,R.C.
  TITLE     Four structurally distinct, non-DNA-binding subunits of human
            nuclear respiratory factor 2 share a conserved transcriptional
            activation domain
  JOURNAL   Mol. Cell. Biol. 15 (1), 102-111 (1995)
   PUBMED   7799916
REFERENCE   9  (bases 1 to 4745)
  AUTHORS   Sawada,J., Goto,M., Watanabe,H., Handa,H. and Yoshida,M.C.
  TITLE     Regional mapping of two subunits of transcription factor E4TF1 to
            human chromosome
  JOURNAL   Jpn. J. Cancer Res. 86 (1), 10-12 (1995)
   PUBMED   7737900
REFERENCE   10 (bases 1 to 4745)
  AUTHORS   Watanabe,H., Sawada,J., Yano,K., Yamaguchi,K., Goto,M. and Handa,H.
  TITLE     cDNA cloning of transcription factor E4TF1 subunits with Ets and
            notch motifs
  JOURNAL   Mol. Cell. Biol. 13 (3), 1385-1391 (1993)
   PUBMED   8441384
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX647755.1, AP000226.2 and BU683067.1.
            
            Summary: This gene encodes one of three GA-binding protein
            transcription factor subunits which functions as a DNA-binding
            subunit. Since this subunit shares identity with a subunit encoding
            the nuclear respiratory factor 2 gene, it is likely involved in
            activation of cytochrome oxidase expression and nuclear control of
            mitochondrial function. This subunit also shares identity with a
            subunit constituting the transcription factor E4TF1, responsible
            for expression of the adenovirus E4 gene. Because of its
            chromosomal localization and ability to form heterodimers with
            other polypeptides, this gene may play a role in the Down Syndrome
            phenotype. Two transcript variants encoding the same protein have
            been found for this gene. [provided by RefSeq, Oct 2010].
            
            Transcript Variant: This variant differs in the 5' UTR compared to
            variant 1. Variants 1 and 2 both encode the same protein.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX647755.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-3388              BX647755.1         379-3766
            3389-4672           AP000226.2         68979-70262
            4673-4745           BU683067.1         16-88               c
FEATURES             Location/Qualifiers
     source          1..4745
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="21"
                     /map="21q21.3"
     gene            1..4745
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="GA binding protein transcription factor, alpha
                     subunit 60kDa"
                     /db_xref="GeneID:2551"
                     /db_xref="HGNC:4071"
                     /db_xref="MIM:600609"
     exon            1..124
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       20
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369659239"
     exon            125..227
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    136..138
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="upstream in-frame stop codon"
     variation       145
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201162106"
     CDS             151..1515
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="human nuclear respiratory factor-2 subunit alpha;
                     nuclear respiratory factor 2 alpha subunit; GABP subunit
                     alpha; transcription factor E4TF1-60; nuclear respiratory
                     factor 2 subunit alpha; GA binding protein transcription
                     factor alpha subunit 60kDa"
                     /codon_start=1
                     /product="GA-binding protein alpha chain"
                     /protein_id="NP_001184226.1"
                     /db_xref="GI:308818209"
                     /db_xref="CCDS:CCDS13575.1"
                     /db_xref="GeneID:2551"
                     /db_xref="HGNC:4071"
                     /db_xref="MIM:600609"
                     /translation="
MTKREAEELIEIEIDGTEKAECTEESIVEQTYAPAECVSQAIDINEPIGNLKKLLEPRLQCSLDAHEICLQDIQLDPERSLFDQGVKTDGTVQLSVQVISYQGIEPKLNILEIVKPADTVEVVIDPDAHHAESEAHLVEEAQVITLDGTKHITTISDETSEQVTRWAAALEGYRKEQERLGIPYDPIQWSTDQVLHWVVWVMKEFSMTDIDLTTLNISGRELCSLNQEDFFQRVPRGEILWSHLELLRKYVLASQEQQMNEIVTIDQPVQIIPASVQSATPTTIKVINSSAKAAKVQRAPRISGEDRSSPGNRTGNNGQIQLWQFLLELLTDKDARDCISWVGDEGEFKLNQPELVAQKWGQRKNKPTMNYEKLSRALRYYYDGDMICKVQGKRFVYKFVCDLKTLIGYSAAELNRLVTECEQKKLAKMQLHGIAQPVTAVALATASLQTEKDN
"
     misc_feature    253..513
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="GA-binding protein alpha chain; Region: GABP-alpha;
                     pfam11620"
                     /db_xref="CDD:152056"
     misc_feature    652..912
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="Sterile alpha motif (SAM)/Pointed domain of
                     GA-binding protein (GABP) alpha chain; Region:
                     SAM_PNT-GABP-alpha; cd08534"
                     /db_xref="CDD:176084"
     misc_feature    1105..1356
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /note="Ets-domain; Region: Ets; pfam00178"
                     /db_xref="CDD:143944"
     exon            228..372
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       243
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143783879"
     variation       248
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200493501"
     variation       249
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734758"
     variation       297
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201420702"
     variation       361
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111555508"
     exon            373..457
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       402
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182635910"
     variation       414
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9981487"
     variation       452
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142853007"
     exon            458..703
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       458
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199641457"
     variation       658
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201578633"
     variation       685
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201624532"
     variation       687
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114798549"
     exon            704..898
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       774
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111301212"
     variation       775
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151066489"
     variation       776
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140912056"
     variation       779
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200365343"
     variation       794
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112195834"
     variation       856
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144668707"
     variation       865
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147848277"
     exon            899..952
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       903
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201347218"
     variation       927
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141466398"
     variation       940
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370739443"
     variation       951
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373747685"
     exon            953..1093
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1009
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376096956"
     variation       1022
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2829897"
     variation       1040
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200165925"
     variation       1047
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147015240"
     exon            1094..1286
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1116
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138014763"
     variation       1119
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829898"
     variation       1128
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78950085"
     variation       1156
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115851866"
     variation       1164
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2829899"
     variation       1183
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829900"
     variation       1224
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2829901"
     variation       1236
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149087448"
     variation       1239
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376559681"
     variation       1254
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143054530"
     exon            1287..4743
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /inference="alignment:Splign:1.39.8"
     variation       1302
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372224151"
     variation       1329
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734759"
     STS             1339..1886
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="GABPA_8360"
                     /db_xref="UniSTS:468432"
     variation       1350
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371993253"
     variation       1407
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141519478"
     variation       1425
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61750211"
     variation       1480
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17853379"
     variation       1499
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144078894"
     STS             1512..1757
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="SHGC-52145"
                     /db_xref="UniSTS:79570"
     variation       1512
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374974940"
     STS             1515..1753
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="RH18000"
                     /db_xref="UniSTS:13351"
     variation       1519
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202051040"
     variation       1529
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368818775"
     variation       1591
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45602531"
     STS             1609..1933
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="D21S1963"
                     /db_xref="UniSTS:81900"
     variation       1613
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376856537"
     variation       1683
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369063682"
     variation       1710
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2694"
     variation       1729
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371743228"
     variation       1781
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55846831"
     variation       1848
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1062461"
     variation       1947..1948
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34459326"
     variation       2074
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188275683"
     STS             2086..2208
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /standard_name="RH69339"
                     /db_xref="UniSTS:91245"
     variation       2186
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139934166"
     variation       2379
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191917080"
     variation       2402
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184207125"
     variation       2419
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370006698"
     variation       2591
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143469868"
     variation       2605
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151233050"
     variation       2654
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61156591"
     variation       2742
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188492582"
     variation       2752
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182061978"
     variation       2780..2781
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:200795121"
     variation       2809
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185031969"
     variation       2820
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112093941"
     variation       2886
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897808"
     variation       2902
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115790549"
     variation       2981
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373887995"
     variation       3134
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2154472"
     variation       3153
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11910323"
     variation       3218
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190765412"
     variation       3251
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11910413"
     variation       3254
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71651662"
     variation       3421
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71651663"
     variation       3520
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11910425"
     variation       3540..3543
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="tgtg"
                     /db_xref="dbSNP:142668569"
     variation       3627
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35429903"
     variation       3635
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189760448"
     variation       3662
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:148811101"
     variation       3727
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201353954"
     variation       3758
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180691813"
     variation       3793
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141668617"
     variation       3807
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71651665"
     variation       3843
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147069073"
     variation       3881
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370384324"
     variation       3912
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138464454"
     variation       3921
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117179423"
     variation       3924..3928
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="ctttg"
                     /db_xref="dbSNP:199776826"
     variation       3974
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191051389"
     variation       4118
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183804750"
     variation       4199
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112288038"
     variation       4280
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376957538"
     variation       4287
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71651668"
     variation       4463..4464
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35609693"
     variation       4511
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188295759"
     variation       4513
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368427310"
     variation       4540..4541
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34074450"
     variation       4577
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375530790"
     variation       4592
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192499722"
     variation       4604..4605
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34230234"
     variation       4655..4656
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:36008029"
     variation       4680
                     /gene="GABPA"
                     /gene_synonym="E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A;
                     RCH04A07"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:71651669"
ORIGIN      
gcaatgcattatgggccgccgtttcagtcggtcgacgctcaccggacaggaagcgtctcggagacagtctgcgaccggacgggtctaggtgagacagaagccaaacaggaggaggaagtggagggactgatcctttgaaatactccagccatgactaaaagagaagcagaggagctgatagaaattgagattgatggaacagagaaagcagagtgcacagaagaaagcattgtagaacaaacctacgcgccagctgaatgtgtaagccaggccatagacatcaatgaaccaataggcaatttaaagaaactgctagaaccaagactacagtgttctttggatgctcatgaaatttgtctgcaagatatccagctggatccagaacgaagtttatttgaccaaggagtaaaaacagatggaactgtacagcttagtgtacaggtaatttcttaccaaggaattgaaccaaagttaaacatccttgaaattgttaaacctgcggacactgttgaggttgttattgatccagatgcccaccatgctgaatcagaagcacatcttgttgaagaagctcaagtgataactcttgatggcacaaaacacatcacaaccatttcagatgaaacttcagaacaagtgacaagatgggctgctgcactggaaggctataggaaagaacaagaacgccttgggataccctatgatcccatacagtggtccacagaccaagtcctgcattgggtggtttgggtaatgaaggaattcagcatgaccgatatagacctcaccacactcaacatttcggggagagaattatgtagtctcaaccaagaagatttttttcagcgggttcctcggggagaaattctctggagtcatctggaacttctccgaaaatatgtattggcaagtcaagaacaacagatgaatgaaatagttacaattgatcaacctgtgcaaattattccagcatcagtgcaatctgctacacctactaccattaaagttataaatagtagtgcgaaagcagccaaagtacaaagagcgccgaggatttcaggagaagatagaagctcacctgggaacagaacaggaaacaatggccaaatccaactatggcagtttttgctagaacttcttactgataaggacgctcgagactgcatttcttgggttggtgatgaaggtgaatttaagctaaatcagcctgaactggttgcacagaaatggggacagcgtaaaaataagcctacgatgaactatgagaaactcagtcgtgcattaagatattattacgatggggacatgatttgtaaagttcaaggcaagagatttgtgtacaagtttgtctgtgacttgaagactcttattggatacagtgcagcggagttgaaccgtttggtcacagaatgtgaacagaagaaacttgcaaagatgcagctccatggaattgcccagccagtcacagcagtagctctggctactgcttctctgcaaacggaaaaggataattgagccccaggacattctgagactccaaagtctttcttaaaatgtttagagcaagtatagctcttacctttattactgaatttgaatcttcttttatttctaggctgtacagtctgatgcatgatttttttataaatatttcatactcttgtgaatttggatctttttactttgagcatatattttagaatatgtgtatgttaaaggatctccacaatgtctgcagtgtgaaggcaggttcattgtggaatagtttaacagtcaggaaggctaaactggtcagtattaatgtgtagccctaccaaaaatagccagtagtatctgaaaatgaaaaataaatgaagtatctctaggaaacagtctggcttaactatttttgaaaatataactgtttcccctctctgctgctttagatgttgctttacatagaaccagaaaatggaatttctcagctaaagcatgtgtgcctgtttcatctaatcaagcagagctaaaatgttcataccgaataaatttatattaataaattactaaactaagagtatcaggttatttatatatttgcaagcaaaggacagtaagaagttgactggcaaaagagcagtgctgaaggaggagatccaggtttaaatctggcttattaactcaagccaattttaaggattttctgtatagattactcatgtcagaccaagaatttaaattattttgagagaggcatttaattctaataaaccagctgttataaaaattataaaatgatctctgtttttcctgtcagagatttaaaaaactgaaaaggtatacctcaacccaaaaataaaggtttgttttggtttgttatggcttccttttttaaaaaattaccctgtagtgccagtttattatgcaaagcagcttatattcctttgtttctgataaaatgaagactttaaatcagtcagtagtactttacctttcaaggcattagtaaattacttgcaaatagttttaaaaggaaaatacgacctttgttataggcagtcttctctttaagacaatacttttccacttgttttccttttccatattatatatgtgtattcatatagctgtatacatattcagttgatcattttataaacatatgaaggcataaagatatacagaagaaaaattattaaacaactcattttaagattcaaattaactaattcctgcatatatgacattccttacataagcgaacactaaacaaaaatggctagaaatgtctttttctttcttttctctctttgttgtttaaggtattaagcacgaattattacatgagactggcagatagctattaatcctcttacagatttgagaaagttgattctcaaatatttatgcaccttctccttcattgttttctttaaatctgtcctcttaaaaagcttcttaagagctcagttaatgcttttgacttaactaggagaaaaaggcatgataatacaggcaagatggcattgttagcaattctggtagtggtttggaatgaatcctaagaggcagggatcttaaggacaaggaagagaagagagagagggagggatctttgatctctttctctggtaatcttaatgcataattttactaaaacatgttctcaattcattcatattattaagctcttcctgcagttgatatctgagcagagtaagatttgtatttccatttttacttttttgaaagagaatatatggacagattattagtacaatttgggcactgtggttttaagaatatctgagtaaaataacaatatgaaataataaacagaagctctaacgtcaggtaacaaatagacagcaagaaaggttttgcaccatcctcttacggcctagagagttgacaagttgcttgtagttttaaaaaaataataaagtatacccttctggtatatcatcaagagcttaagaatcttggctttcatatttaaaatgcttttggggagacatatattaaaattttagccaagatgatagacatgtctcaattatatatgtgtgtgtatgtttttaaagctaaaaacattacttttagatccctagaatgaaaatttttttctcatctatgcaattcccatatggtttttttttaaatcatattttattcattttctccctttagcaattttcattttatttctcataatttgaacagagacagttctcatacatgatcagatgctttttttttcttcttaccatcatttatgcatgacataggtaatgtgactaatttctccagttgattcaagaaactcattactttgcctcaaattatatgtaaaatatttgttttacttaggttacagttatcagaaaggtagtttttttcttctattaaaatataacattgtgaaagaaaataaaatttatgctattctttgctttgtttttataaatgaatttttcatagaatttacagtatattcaaaggaagaaagataaaattattggtcatcatttgtaccttagaagtacaagaatttaagtaaaagaaatgttcatttttgttttaaaatttgttttccatgtgaagtttttattgagccaactttcatacatatcttgctagcctaaagtctaaatatttgtgttggcatcagaaaaacaaatgaggcagaattgctatgtgtggttgatcttcagataaattgactgatcacagttatttttgtatcagtctatgttattaggaaaaattgtttagttgttttctcccctgattaatggtgatattcaagtatgatacaaaaagaattgtaccaccaaatatttttgtgaggtctgctgttttccatattcattttatgctactgcctttaagaaagaactagtgtatccttgaaatagcacaaaaatgttttaaaattcataattgcaaaacaaatctgtgactaacttaatgtcttcagatctaaagggtgtaaaaatattgatacttcaatatttcacttgctgccaggaaaaacaaaattctcaatcttttgtaaatgggaggaggacttttgcatacatttttactctttaaataacgacaacgacacttatactgtcataataacaattatgtatttctttgtggttttaattttttttgtaattttacataaaacagttattttctatttttacgcagataaatatttgtgcataaaatgtaaaaatagtaaaatgagaaaaataaaactattatacagtaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2551 -> Molecular function: GO:0000978 [RNA polymerase II core promoter proximal region sequence-specific DNA binding] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0001228 [RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
            GeneID:2551 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
            GeneID:2551 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:2551 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA
            GeneID:2551 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IDA
            GeneID:2551 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:2551 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:2551 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:2551 -> Biological process: GO:0045653 [negative regulation of megakaryocyte differentiation] evidence: IEA
            GeneID:2551 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:2551 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.