Home |
Help |
Advanced search
2024-04-19 21:01:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001197296 2656 bp mRNA linear PRI 14-APR-2013
DEFINITION Homo sapiens extracellular matrix protein 2, female organ and
adipocyte specific (ECM2), transcript variant 3, mRNA.
ACCESSION NM_001197296
VERSION NM_001197296.1 GI:308818205
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2656)
AUTHORS Humphray,S.J., Oliver,K., Hunt,A.R., Plumb,R.W., Loveland,J.E.,
Howe,K.L., Andrews,T.D., Searle,S., Hunt,S.E., Scott,C.E.,
Jones,M.C., Ainscough,R., Almeida,J.P., Ambrose,K.D., Ashwell,R.I.,
Babbage,A.K., Babbage,S., Bagguley,C.L., Bailey,J., Banerjee,R.,
Barker,D.J., Barlow,K.F., Bates,K., Beasley,H., Beasley,O.,
Bird,C.P., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.,
Burrill,W., Burton,J., Carder,C., Carter,N.P., Chapman,J.C.,
Chen,Y., Clarke,G., Clark,S.Y., Clee,C.M., Clegg,S., Collier,R.E.,
Corby,N., Crosier,M., Cummings,A.T., Davies,J., Dhami,P., Dunn,M.,
Dutta,I., Dyer,L.W., Earthrowl,M.E., Faulkner,L., Fleming,C.J.,
Frankish,A., Frankland,J.A., French,L., Fricker,D.G., Garner,P.,
Garnett,J., Ghori,J., Gilbert,J.G., Glison,C., Grafham,D.V.,
Gribble,S., Griffiths,C., Griffiths-Jones,S., Grocock,R., Guy,J.,
Hall,R.E., Hammond,S., Harley,J.L., Harrison,E.S., Hart,E.A.,
Heath,P.D., Henderson,C.D., Hopkins,B.L., Howard,P.J., Howden,P.J.,
Huckle,E., Johnson,C., Johnson,D., Joy,A.A., Kay,M., Keenan,S.,
Kershaw,J.K., Kimberley,A.M., King,A., Knights,A., Laird,G.K.,
Langford,C., Lawlor,S., Leongamornlert,D.A., Leversha,M., Lloyd,C.,
Lloyd,D.M., Lovell,J., Martin,S., Mashreghi-Mohammadi,M.,
Matthews,L., McLaren,S., McLay,K.E., McMurray,A., Milne,S.,
Nickerson,T., Nisbett,J., Nordsiek,G., Pearce,A.V., Peck,A.I.,
Porter,K.M., Pandian,R., Pelan,S., Phillimore,B., Povey,S.,
Ramsey,Y., Rand,V., Scharfe,M., Sehra,H.K., Shownkeen,R.,
Sims,S.K., Skuce,C.D., Smith,M., Steward,C.A., Swarbreck,D.,
Sycamore,N., Tester,J., Thorpe,A., Tracey,A., Tromans,A.,
Thomas,D.W., Wall,M., Wallis,J.M., West,A.P., Whitehead,S.L.,
Willey,D.L., Williams,S.A., Wilming,L., Wray,P.W., Young,L.,
Ashurst,J.L., Coulson,A., Blocker,H., Durbin,R., Sulston,J.E.,
Hubbard,T., Jackson,M.J., Bentley,D.R., Beck,S., Rogers,J. and
Dunham,I.
TITLE DNA sequence and analysis of human chromosome 9
JOURNAL Nature 429 (6990), 369-374 (2004)
PUBMED 15164053
REFERENCE 2 (bases 1 to 2656)
AUTHORS Nishiu,J., Tanaka,T. and Nakamura,Y.
TITLE Identification of a novel gene (ECM2) encoding a putative
extracellular matrix protein expressed predominantly in adipose and
female-specific tissues and its chromosomal localization to 9q22.3
JOURNAL Genomics 52 (3), 378-381 (1998)
PUBMED 9790758
REFERENCE 3 (bases 1 to 2656)
AUTHORS Oritani,K., Kanakura,Y., Aoyama,K., Yokota,T., Copeland,N.G.,
Gilbert,D.J., Jenkins,N.A., Tomiyama,Y., Matsuzawa,Y. and
Kincade,P.W.
TITLE Matrix glycoprotein SC1/ECM2 augments B lymphopoiesis
JOURNAL Blood 90 (9), 3404-3413 (1997)
PUBMED 9345023
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DC300418.1, AB011792.1 and
BX537976.1.
Summary: ECM2 encodes extracellular matrix protein 2, so named
because it shares extensive similarity with known extracelluar
matrix proteins. Three transcript variants encoding different
isoforms have been found for this gene. [provided by RefSeq, Oct
2010].
Transcript Variant: This variant (3) uses an alternate in-frame
splice junction at the 5' end of an exon and differs in the 3' UTR
and coding sequence compared to variant 1. The resulting isoform
(3) lacks an internal segment and has a shorter and distinct
C-terminus compared to isoform 1.
##Evidence-Data-START##
Transcript exon combination :: BX537976.1 [ECO:0000332]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-122 DC300418.1 1-122
123-354 AB011792.1 9-240
355-2656 BX537976.1 318-2619
FEATURES Location/Qualifiers
source 1..2656
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="9"
/map="9q22.3"
gene 1..2656
/gene="ECM2"
/note="extracellular matrix protein 2, female organ and
adipocyte specific"
/db_xref="GeneID:1842"
/db_xref="HGNC:3154"
/db_xref="MIM:603479"
exon 1..160
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
misc_feature 26..28
/gene="ECM2"
/note="upstream in-frame stop codon"
exon 161..479
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
CDS 188..2119
/gene="ECM2"
/note="isoform 3 precursor is encoded by transcript
variant 3; matrix glycoprotein SC1/ECM2"
/codon_start=1
/product="extracellular matrix protein 2 isoform 3
precursor"
/protein_id="NP_001184225.1"
/db_xref="GI:308818206"
/db_xref="CCDS:CCDS56578.1"
/db_xref="GeneID:1842"
/db_xref="HGNC:3154"
/db_xref="MIM:603479"
/translation="
MKIAVLFCFFLLIIFQTDFGKNEEIPRKQRRKIYHRRLRKSSTSHKHRSNRQLGIQQTTVFTPVARLPIVNFDYSMEEKFESFSSFPGVESSYNVLPGKKGHCLVKGITMYNKAVWSPEPCTTCLCSDGRVLCDETMCHPQRCPQTVIPEGECCPVCSATEQREPTNLLHKQLPPPQVGMDRIVRKEALQSEEDEEVKEEDTEQKRETPESRNQGQLYSEGDSRGGDRKQRPGEERRLAHQQQRQGREEEEDEEEEGEEGEEDEEDEEDPVRGDMFRMPSRSPLPAPPRGTLRLPSGCSLSYRTISCINAMLTQIPPLTAPQITSLELTGNSIASIPDEAFNGLPNLERLDLSKNNITSSGIGPKAFKLLKKLMRLNMDGNNLIQIPSQLPSTLEELKVNENNLQAIDEESLSDLNQLVTLELEGNNLSEANVNPLAFKPLKSLAYLRLGKNKFRIIPQGLPGSIEELYLENNQIEEITEICFNHTRKINVIVLRYNKIEENRIAPLAWINQENLESIDLSYNKLYHVPSYLPKSLLHLVLLGNQIERIPGYVFGHMEPGLEYLYLSFNKLADDGMDRVSFYGAYHSLRELFLDHNDLKSIPPGIQEMKALHFLRLNNNKIRCVSDAVLETVTNRSDVAFPLW
"
sig_peptide 188..247
/gene="ECM2"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 248..2116
/gene="ECM2"
/product="extracellular matrix protein 2 isoform 3"
misc_feature 494..658
/gene="ECM2"
/note="von Willebrand factor type C domain; Region: VWC;
pfam00093"
/db_xref="CDD:109161"
misc_feature <1145..1549
/gene="ECM2"
/note="Leucine-rich repeats (LRRs), ribonuclease inhibitor
(RI)-like subfamily. LRRs are 20-29 residue sequence
motifs present in many proteins that participate in
protein-protein interactions and have different functions
and cellular locations. LRRs correspond...; Region:
LRR_RI; cl15309"
/db_xref="CDD:199167"
misc_feature 1151..1336
/gene="ECM2"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature order(1175..1177,1247..1249,1388..1390,1451..1453,
1457..1459,1529..1531)
/gene="ECM2"
/note="Substrate binding site [chemical binding]; other
site"
/db_xref="CDD:29015"
misc_feature 1367..1549
/gene="ECM2"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature 1577..1762
/gene="ECM2"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature 1595..>2077
/gene="ECM2"
/note="Leucine-rich repeats (LRRs), ribonuclease inhibitor
(RI)-like subfamily. LRRs are 20-29 residue sequence
motifs present in many proteins that participate in
protein-protein interactions and have different functions
and cellular locations. LRRs correspond...; Region:
LRR_RI; cl15309"
/db_xref="CDD:199167"
misc_feature 1727..1900
/gene="ECM2"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature 1865..2050
/gene="ECM2"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
variation complement(245)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373531348"
variation complement(337)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:199523075"
variation complement(354)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:10120210"
variation complement(372)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:137948457"
variation complement(417)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200534289"
variation complement(426)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150291467"
variation complement(463)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:9299405"
variation complement(474)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201265258"
exon 480..668
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(513)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:35496743"
variation complement(529)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143418555"
variation complement(537)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149220459"
variation complement(544)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34729575"
variation complement(622)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201771443"
variation complement(651)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147710026"
variation complement(652)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:968040"
variation complement(660)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368912147"
variation complement(667)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139951554"
exon 669..1175
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(681)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:149769253"
variation complement(688)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201071759"
variation complement(696)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139720616"
variation complement(726)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:200225062"
variation complement(731)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368116708"
variation complement(732)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34758505"
variation complement(746)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:13293047"
variation complement(747)
/gene="ECM2"
/replace="a"
/replace="t"
/db_xref="dbSNP:200124000"
variation complement(750)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375328673"
variation complement(759)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:13291847"
variation complement(760)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372289924"
variation complement(769)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368303849"
variation complement(785)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142198335"
variation complement(791)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:13298061"
variation complement(792)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:376085476"
variation complement(802)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:182133503"
variation complement(830)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:145991428"
variation complement(836)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:367636482"
variation complement(852)
/gene="ECM2"
/replace="a"
/replace="t"
/db_xref="dbSNP:13297924"
variation complement(910)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:374472469"
variation complement(917)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142591312"
variation complement(935..936)
/gene="ECM2"
/replace=""
/replace="gtg"
/db_xref="dbSNP:200095306"
variation complement(941)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:137929518"
variation complement(943)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34355623"
variation complement(953)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149244773"
variation complement(996)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369927306"
variation complement(1016)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138357265"
variation complement(1017)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372997619"
variation complement(1029)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143789386"
variation complement(1036)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:41280067"
variation complement(1056)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:142608064"
variation complement(1064)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138567683"
variation complement(1075)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148975367"
variation complement(1137)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201012391"
variation complement(1151)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147083553"
variation complement(1168)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:372699831"
exon 1176..1291
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(1181)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141793116"
variation complement(1187)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142186054"
variation complement(1243)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:73651314"
variation complement(1246)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2296667"
variation complement(1272)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199972367"
variation complement(1278)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146339911"
exon 1292..1427
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(1307)
/gene="ECM2"
/replace="a"
/replace="t"
/db_xref="dbSNP:139215803"
variation complement(1311)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41278707"
variation complement(1355)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370587410"
variation complement(1394)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:142108843"
variation complement(1404)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376172195"
variation complement(1408)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146040741"
variation complement(1414)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:113660659"
variation complement(1420)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:144093801"
exon 1428..1585
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(1462)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:35161698"
variation complement(1475)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:373455336"
variation complement(1483)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369126996"
variation complement(1487)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:199745267"
variation complement(1526)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150773107"
variation complement(1529)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376333101"
variation complement(1561)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141184307"
variation complement(1573)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148225586"
variation complement(1585)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:373635817"
exon 1586..1725
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(1631)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369347015"
variation complement(1642)
/gene="ECM2"
/replace="a"
/replace="t"
/db_xref="dbSNP:143859115"
variation complement(1671)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372302066"
exon 1726..2052
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(1740)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376628552"
variation complement(1748..1749)
/gene="ECM2"
/replace=""
/replace="c"
/db_xref="dbSNP:34868349"
variation complement(1774)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:199713916"
variation complement(1816)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143452414"
variation complement(1829)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199600306"
variation complement(1834)
/gene="ECM2"
/replace="c"
/replace="g"
/db_xref="dbSNP:373764507"
variation complement(1845)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34518968"
variation complement(1882)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:147126273"
variation complement(1906)
/gene="ECM2"
/replace="a"
/replace="t"
/db_xref="dbSNP:141859598"
variation complement(1932)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201745324"
variation complement(1948)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:186648835"
variation complement(1972)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138868045"
variation complement(1991)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150249574"
variation complement(2003)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:140976209"
variation complement(2050)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370627896"
variation complement(2051)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:151070730"
variation complement(2052)
/gene="ECM2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200394678"
exon 2053..2655
/gene="ECM2"
/inference="alignment:Splign:1.39.8"
variation complement(2086)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:375600278"
variation complement(2196)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145750718"
variation complement(2197)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:374607616"
variation complement(2295)
/gene="ECM2"
/replace="g"
/replace="t"
/db_xref="dbSNP:183266211"
variation complement(2310)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:7869742"
variation complement(2593)
/gene="ECM2"
/replace="c"
/replace="t"
/db_xref="dbSNP:111626878"
variation complement(2624)
/gene="ECM2"
/replace="a"
/replace="c"
/db_xref="dbSNP:115693996"
ORIGIN
gggaggcagttattttagattttactaagaagttcagcaaatacttttcaacattcccttctgtcctttctttgtttttaaagaaagctctgattttgtttcattttcagctggagacttaaatgacaccaagcaaagcctacttagtttagatctccagaaattggctggtggaaaaaaatcaaacatgaagattgcagttttgttttgtttttttctgcttatcatttttcaaactgactttggaaaaaatgaagaaattcctaggaagcaaaggaggaagatctaccacagaaggttgaggaaaagttcaacctcacacaagcacagatcaaacagacagcttggaattcagcaaacaacagtttttacaccagtagcaagacttcctattgttaactttgattatagcatggaggaaaagtttgaatccttttcaagttttcctggagtagaatcaagttataatgtgttaccaggaaagaagggacactgtttggtaaagggcataaccatgtacaacaaagctgtgtggtcgcctgagccctgcactacctgcctctgctcagatggaagagttctttgtgatgaaaccatgtgccatccccagaggtgcccccaaacagttatacctgaaggggaatgctgcccggtctgctccgctactgaacaaagagaacctaccaatttacttcataagcaactgccacctcctcaggtgggaatggaccgaatagtaagaaaagaagcacttcaatctgaggaggatgaagaagtgaaagaagaagatacagagcaaaagagagagacccctgaatctagaaatcaggggcaactttacagtgagggggacagcagaggaggagacagaaagcagaggcctggagaggagaggaggctggcacaccagcaacaacgccaaggaagggaggaggaggaggatgaggaggaggagggtgaggagggtgaggaggatgaggaggacgaggaggacccggtaagaggagatatgttccgaatgccctctcgatccccgcttcctgctcctcccagaggcacactgcgcctgccaagcgggtgctctctgtcctacaggaccatcagctgcatcaacgccatgcttacccagataccaccgctgacagcaccacagataacaagtctggagctcactggcaattccatcgcctccatcccagatgaagcatttaatggattaccaaatttggaaaggcttgatctgagtaaaaataatatcacttcttcaggcataggtccaaaagcattcaagcttctgaagaagttaatgcgtttgaatatggatggaaataatttgatacagattccttcacaattgccatctacattagaagaacttaaagtcaatgagaacaatcttcaggctatcgatgaagaaagtttatcagacttaaatcagttggtcaccttagaattggaaggaaacaatctcagtgaagccaatgtcaatcctttagctttcaaacctttgaagagcctagcctacttgcgtctgggaaaaaataaatttagaattataccgcagggtcttcctggttctattgaggaattatacctagaaaataaccaaattgaagaaataactgaaatttgtttcaatcataccagaaagatcaatgtcattgtactacgttataacaaaattgaagaaaataggattgctcctttagcctggataaatcaagaaaatctagaatccattgatctctcctacaacaagctctatcacgtcccgtcctatctacccaagtccttgctgcacctagtactccttgggaaccagattgaacggatccctggctatgtgtttggccacatggaaccaggcctggaatacttgtacctgtcatttaacaaacttgctgatgatggcatggaccgtgtctccttctatggggcatatcattctctgagagaattatttctggatcacaatgacttaaaatctataccacctgggatacaagaaatgaaagcactacattttctgaggctgaacaacaacaagatacgctgtgtttcagatgctgttctagagacagtgacaaacagatcagatgtggcctttcctctctggtagaggcaataagcaggaaatcaaacagacaagtaagcaggcaagtgctgtgcagtcagaaaaatgggtgacaatgcgacgagcacactggggcctgagggccgccaggagactacggccaccctcaacggcctggattaacagcagatccagaccggtgcctgtggagcagacgcactgtgggcttgctgtgtatgtcgcttctcaactctgctctggctgcagaatcccaagaaaaaaatgaaaatcagaatgactgattgaagcttttttcttaagtggaagttgtacttatttctactgattttataatttttaaaatatggctagcatggaacttgttcagccctgaaatttcatgatgttctagatgggaagttttaattccataaaaaagtgataaatgtccttatagcaaacactcttcacaatataatgtactaaaaaacagatgttctgtttggcttcaaaaattacactataattactaacacacatatacactaaagaagtcctggtctagccatgatctaaaaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1842 -> Molecular function: GO:0005178 [integrin binding] evidence: TAS
GeneID:1842 -> Molecular function: GO:0008201 [heparin binding] evidence: IEA
GeneID:1842 -> Molecular function: GO:0070052 [collagen V binding] evidence: IEA
GeneID:1842 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: TAS
GeneID:1842 -> Biological process: GO:0010811 [positive regulation of cell-substrate adhesion] evidence: IEA
GeneID:1842 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: IEA
GeneID:1842 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: TAS
GeneID:1842 -> Cellular component: GO:0005614 [interstitial matrix] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.