Home |
Help |
Advanced search
2024-04-26 02:27:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001191037 3236 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit,
non-ATPase, 1 (PSMD1), transcript variant 2, mRNA.
ACCESSION NM_001191037
VERSION NM_001191037.1 GI:300388182
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3236)
AUTHORS Zhang,L., Hu,J.J. and Gong,F.
TITLE MG132 inhibition of proteasome blocks apoptosis induced by severe
DNA damage
JOURNAL Cell Cycle 10 (20), 3515-3518 (2011)
PUBMED 22031102
REMARK GeneRIF: The 26S proteasome plays a key role in promoting apoptosis
induced by high doses of UV irradiation.
REFERENCE 2 (bases 1 to 3236)
AUTHORS Lee,S.H., Park,Y., Yoon,S.K. and Yoon,J.B.
TITLE Osmotic stress inhibits proteasome by p38 MAPK-dependent
phosphorylation
JOURNAL J. Biol. Chem. 285 (53), 41280-41289 (2010)
PUBMED 21044959
REMARK GeneRIF: p38 MAPK negatively regulates the proteasome activity by
phosphorylating Thr-273 of Rpn2
REFERENCE 3 (bases 1 to 3236)
AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B,
Yusuf S, Gerstein HC, Engert JC and Anand S.
CONSRTM DREAM investigators
TITLE Variation at the NFATC2 locus increases the risk of
thiazolidinedione-induced edema in the Diabetes REduction
Assessment with ramipril and rosiglitazone Medication (DREAM) study
JOURNAL Diabetes Care 33 (10), 2250-2253 (2010)
PUBMED 20628086
REMARK GeneRIF: Observational study of gene-disease association,
gene-environment interaction, and pharmacogenomic / toxicogenomic.
(HuGE Navigator)
REFERENCE 4 (bases 1 to 3236)
AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt
TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M,
Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ,
Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S,
Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD,
Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE
and Hingorani AD.
CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium
TITLE Gene-centric association signals for lipids and apolipoproteins
identified via the HumanCVD BeadChip
JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009)
PUBMED 19913121
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 5 (bases 1 to 3236)
AUTHORS da Fonseca,P.C. and Morris,E.P.
TITLE Structure of the human 26S proteasome: subunit radial displacements
open the gate into the proteolytic core
JOURNAL J. Biol. Chem. 283 (34), 23305-23314 (2008)
PUBMED 18534977
REMARK GeneRIF: analysis of how subunit radial displacements open the gate
into the proteolytic core in the human 26S proteasome
REFERENCE 6 (bases 1 to 3236)
AUTHORS Simon,J.H., Gaddis,N.C., Fouchier,R.A. and Malim,M.H.
TITLE Evidence for a newly discovered cellular anti-HIV-1 phenotype
JOURNAL Nat. Med. 4 (12), 1397-1400 (1998)
PUBMED 9846577
REFERENCE 7 (bases 1 to 3236)
AUTHORS Madani,N. and Kabat,D.
TITLE An endogenous inhibitor of human immunodeficiency virus in human
lymphocytes is overcome by the viral Vif protein
JOURNAL J. Virol. 72 (12), 10251-10255 (1998)
PUBMED 9811770
REFERENCE 8 (bases 1 to 3236)
AUTHORS Seeger,M., Ferrell,K., Frank,R. and Dubiel,W.
TITLE HIV-1 tat inhibits the 20 S proteasome and its 11 S
regulator-mediated activation
JOURNAL J. Biol. Chem. 272 (13), 8145-8148 (1997)
PUBMED 9079628
REFERENCE 9 (bases 1 to 3236)
AUTHORS Yokota,K., Kagawa,S., Shimizu,Y., Akioka,H., Tsurumi,C., Noda,C.,
Fujimuro,M., Yokosawa,H., Fujiwara,T., Takahashi,E., Ohba,M.,
Yamasaki,M., DeMartino,G.N., Slaughter,C.A., Toh-e,A. and Tanaka,K.
TITLE CDNA cloning of p112, the largest regulatory subunit of the human
26s proteasome, and functional analysis of its yeast homologue,
sen3p
JOURNAL Mol. Biol. Cell 7 (6), 853-870 (1996)
PUBMED 8816993
REFERENCE 10 (bases 1 to 3236)
AUTHORS Coux,O., Tanaka,K. and Goldberg,A.L.
TITLE Structure and functions of the 20S and 26S proteasomes
JOURNAL Annu. Rev. Biochem. 65, 801-847 (1996)
PUBMED 8811196
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA385817.1, BC064398.1,
AC009407.8 and AA169719.1.
Summary: The 26S proteasome is a multicatalytic proteinase complex
with a highly ordered structure composed of 2 complexes, a 20S core
and a 19S regulator. The 20S core is composed of 4 rings of 28
non-identical subunits; 2 rings are composed of 7 alpha subunits
and 2 rings are composed of 7 beta subunits. The 19S regulator is
composed of a base, which contains 6 ATPase subunits and 2
non-ATPase subunits, and a lid, which contains up to 10 non-ATPase
subunits. Proteasomes are distributed throughout eukaryotic cells
at a high concentration and cleave peptides in an
ATP/ubiquitin-dependent process in a non-lysosomal pathway. An
essential function of a modified proteasome, the immunoproteasome,
is the processing of class I MHC peptides. This gene encodes the
largest non-ATPase subunit of the 19S regulator lid, which is
responsible for substrate recognition and binding. Alternatively
spliced transcript variants have been found for this gene.[provided
by RefSeq, Jul 2010].
Transcript Variant: This variant (2) lacks an in-frame exon in the
3' region, as compared to variant 1. The resulting isoform (2)
lacks an internal segment, as compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: single sample supports all introns ERS025084,
ERS025085 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-30 DA385817.1 1-30
31-2591 BC064398.1 2-2562
2592-2637 AC009407.8 150869-150914
2638-2784 AC009407.8 151499-151645
2785-2940 AC009407.8 156194-156349
2941-3205 AC009407.8 158163-158427
3206-3236 AA169719.1 1-31 c
FEATURES Location/Qualifiers
source 1..3236
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q37.1"
gene 1..3236
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="proteasome (prosome, macropain) 26S subunit,
non-ATPase, 1"
/db_xref="GeneID:5707"
/db_xref="HGNC:9554"
exon 1..178
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 9
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:12469096"
variation 43
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374992564"
misc_feature 85..87
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="upstream in-frame stop codon"
variation 92
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:77415113"
variation 113
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="t"
/db_xref="dbSNP:186537455"
CDS 163..2931
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="isoform 2 is encoded by transcript variant 2; 26S
proteasome non-ATPase regulatory subunit 1; 26S proteasome
subunit p112; 26S proteasome regulatory subunit S1; 26S
proteasome regulatory subunit RPN2"
/codon_start=1
/product="26S proteasome non-ATPase regulatory subunit 1
isoform 2"
/protein_id="NP_001177966.1"
/db_xref="GI:300388183"
/db_xref="CCDS:CCDS54436.1"
/db_xref="GeneID:5707"
/db_xref="HGNC:9554"
/translation="
MITSAAGIISLLDEDEPQLKEFALHKLNAVVNDFWAEISESVDKIEVLYEDEGFRSRQFAALVASKVFYHLGAFEESLNYALGAGDLFNVNDNSEYVETIIAKCIDHYTKQCVENADLPEGEKKPIDQRLEGIVNKMFQRCLDDHKYKQAIGIALETRRLDVFEKTILESNDVPGMLAYSLKLCMSLMQNKQFRNKVLRVLVKIYMNLEKPDFINVCQCLIFLDDPQAVSDILEKLVKEDNLLMAYQICFDLYESASQQFLSSVIQNLRTVGTPIASVPGSTNTGTVPGSEKDSDSMETEEKTSSAFVGKTPEASPEPKDQTLKMIKILSGEMAIELHLQFLIRNNNTDLMILKNTKDAVRNSVCHTATVIANSFMHCGTTSDQFLRDNLEWLARATNWAKFTATASLGVIHKGHEKEALQLMATYLPKDTSPGSAYQEGGGLYALGLIHANHGGDIIDYLLNQLKNASNDIVRHGGSLGLGLAAMGTARQDVYDLLKTNLYQDDAVTGEAAGLALGLVMLGSKNAQAIEDMVGYAQETQHEKILRGLAVGIALVMYGRMEEADALIESLCRDKDPILRRSGMYTVAMAYCGSGNNKAIRRLLHVAVSDVNDDVRRAAVESLGFILFRTPEQCPSVVSLLSESYNPHVRYGAAMALGICCAGTGNKEAINLLEPMTNDPVNYVRQGALIASALIMIQQTEITCPKVNQFRQLYSKVINDKHDDVMAKFGAILAQGILDAGGHNVTISLQSRTGHTHMPSVVGVLVFTQFWFWFPLSHFLSLAYTPTCVIGLNKDLKVSTAVLSITAKAKKKEKEKEKKEEEKMEVDEAEKKEEKEKKKEPEPNFQLLDNPARVMPAQLKVLTMPETCRYQPFKPLSIGGIIILKDTSEDIEELVEPVAAHGPKIEEEEQEPEPPEPFEYIDD
"
misc_feature 1483..1584
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="Proteasome/cyclosome repeat; Region: PC_rep;
pfam01851"
/db_xref="CDD:145164"
misc_feature <1843..2031
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="HEAT repeats; Region: HEAT_2; pfam13646"
/db_xref="CDD:205823"
misc_feature 1966..2232
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="HEAT repeats; Region: HEAT_2; pfam13646"
/db_xref="CDD:205823"
misc_feature 2113..2217
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/note="Proteasome/cyclosome repeat; Region: PC_rep;
pfam01851"
/db_xref="CDD:145164"
exon 179..222
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
exon 223..296
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 285
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:146184522"
exon 297..466
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 415
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042974"
variation 427
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="t"
/db_xref="dbSNP:369643502"
variation 428
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201791497"
exon 467..672
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 495
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148284057"
variation 535
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="c"
/db_xref="dbSNP:201274207"
variation 613
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200311253"
variation 634
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372475021"
variation 646
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140671888"
variation 653
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="c"
/db_xref="dbSNP:75044156"
exon 673..816
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 713
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:193207787"
variation 743
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371110831"
variation 765
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150858671"
variation 806
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148804491"
exon 817..1043
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 819
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367794379"
variation 870
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139078310"
variation 897
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147551981"
variation 968
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140288102"
variation 1008
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371662857"
exon 1044..1104
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1049
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:189385491"
variation 1057
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="t"
/db_xref="dbSNP:77972953"
variation 1058
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145607583"
variation 1100
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113593155"
exon 1105..1233
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1163
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375669050"
variation 1168
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:78959779"
variation 1183
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:113771661"
variation 1213
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143534193"
variation 1219
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140570911"
exon 1234..1322
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1263
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:138367156"
variation 1269
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374861728"
variation 1283
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:369257039"
variation 1308
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:180963792"
exon 1323..1401
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
STS 1342..1441
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/standard_name="PSMD1"
/db_xref="UniSTS:512658"
variation 1361
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="c"
/db_xref="dbSNP:78677083"
exon 1402..1575
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1485
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="c"
/db_xref="dbSNP:138925802"
variation 1525
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144761621"
variation 1563
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377482540"
variation 1564
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369229316"
exon 1576..1687
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1630
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:201769528"
exon 1688..1884
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1729
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375642888"
variation 1736
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199791094"
variation 1756
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:202079241"
variation 1763
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1803433"
variation 1767
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140092851"
variation 1838
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:13408366"
variation 1855
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:201874783"
variation 1877
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:151148079"
exon 1885..1980
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1893
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145132698"
variation 1949
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144805413"
exon 1981..2045
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 1983
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141306258"
variation 2011
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200827781"
exon 2046..2160
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2065
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="t"
/db_xref="dbSNP:201091048"
variation 2066
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149050271"
variation 2068
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:185969599"
variation 2106
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:141525864"
variation 2107
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148049341"
exon 2161..2277
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2185
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201118764"
variation 2193
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373710327"
variation 2247
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:150554194"
variation 2274
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200218090"
exon 2278..2380
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2293
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="g"
/db_xref="dbSNP:375559893"
variation 2315
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142822864"
variation 2349
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140861367"
variation 2353
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:189389369"
exon 2381..2550
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
exon 2551..2637
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2552
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="g"
/replace="t"
/db_xref="dbSNP:35578214"
variation 2616
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:115889584"
exon 2638..2784
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2681
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375200885"
variation 2717
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140293496"
variation 2725
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:75847014"
variation 2769
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:149102064"
exon 2785..2940
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2791
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148285878"
variation 2809
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043022"
variation 2813
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1803432"
variation 2934
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:6749"
STS 2938..3103
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/standard_name="RH36032"
/db_xref="UniSTS:26992"
exon 2941..3233
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/inference="alignment:Splign:1.39.8"
variation 2941
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147107380"
STS 2994..3087
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/standard_name="D2S1672E"
/db_xref="UniSTS:150707"
STS 2995..3087
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/standard_name="D2S1525E"
/db_xref="UniSTS:39887"
STS 3008..3132
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/standard_name="SGC31713"
/db_xref="UniSTS:2873"
variation 3037
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138685132"
variation 3038
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142690475"
variation 3086
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1803434"
polyA_signal 3192..3197
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
polyA_site 3233
/gene="PSMD1"
/gene_synonym="P112; Rpn2; S1"
ORIGIN
ggggtcctggcgagaagcgagccggcggcctgaggaggcgactgactgagcagcgcacccggggagcaaggaggcgcggtgaactgagcggcccctgagctgacagatacactgcgcagctggaacggcgagcgagccgacgggcgagtgaggggcgcagccatgatcacctcggccgctggaattatttctcttctggatgaagatgaaccacagcttaaggaatttgcactacacaaattgaatgcagttgttaatgacttctgggcagaaatttccgagtccgtagacaaaatagaggttttatacgaagatgaaggtttccggagtcggcagtttgcagccttagtggcatctaaagtattttatcacctgggggcttttgaggagtctctgaattatgctcttggagcaggggacctcttcaatgtcaatgataactctgaatatgtggaaactattatagcaaaatgcattgatcactacaccaaacaatgtgtggaaaatgcagatttgcctgaaggagaaaaaaaaccaattgaccagagattggaaggcatcgtaaataaaatgttccagcgatgtctagatgatcacaagtataaacaggctattggcattgctctggagacacgaagactggacgtctttgaaaagaccatactggagtcgaatgatgtcccaggaatgttagcttatagccttaagctctgcatgtctttaatgcagaataaacagtttcggaataaagtactaagagttctagttaaaatctacatgaacttggagaaacctgatttcatcaatgtttgtcagtgcttaattttcttagatgatcctcaggctgtgagtgatatcttagagaaactggtaaaggaagacaacctcctgatggcatatcagatttgttttgatttgtatgaaagtgctagccagcagtttttgtcatctgtaatccagaatcttcgaactgttggcacccctattgcttctgtgcctggatccactaatacgggtactgttccgggatcagagaaagacagtgactcgatggaaacagaagaaaagacaagcagtgcatttgtaggaaagacaccagaagccagtccagagcctaaggaccagactttgaaaatgattaaaattttaagtggtgaaatggctattgagttacatctgcagttcttaatacgaaacaataatacagacctcatgattctaaaaaacacaaaggatgcagtacggaattctgtatgtcatactgcaaccgttatagcaaactcttttatgcactgtgggacaaccagtgaccagtttcttagagataatttggaatggttagccagagccactaactgggcaaaatttactgctacagccagtttgggtgtaattcataagggtcatgaaaaagaagcattacagttaatggcaacataccttcccaaggatacttctccaggatcagcctatcaggaaggtggaggtctctatgcactaggtcttattcatgccaatcatggtggtgatataattgactatctgcttaatcagcttaagaacgccagcaatgatatcgttagacacggtggcagtctgggccttggtttggcagccatgggaactgcacgtcaagatgtttatgatttgctaaaaacaaacctttatcaggatgatgcagtaacaggggaagcagctggcctggccctaggtttggttatgttgggctctaaaaatgctcaggctattgaggacatggttggttatgcacaagaaactcaacatgagaagattctgcgtggtcttgcagttggcatagctttagtaatgtatgggaggatggaagaggctgatgctctcattgaatctctctgtcgtgacaaggacccaattcttcgaaggtctggaatgtatactgtagccatggcttattgtggctctggtaacaacaaagcaattcgacgcctgctacatgttgctgtaagtgatgttaatgatgatgtcaggagggcagcagtagaatcacttgggttcattctattcagaacccctgaacagtgcccaagtgttgtctctttgttgtcagagagttacaaccctcatgtgcgctacggagctgcaatggccttggggatatgctgtgctggtacaggaaacaaggaagccattaatttgctagaaccaatgacaaacgaccccgtgaactacgtgaggcaaggggcactcatagcttcagctctcatcatgatccagcagactgaaatcacttgtccaaaggtgaatcagttcagacagctgtattccaaagtcatcaatgataagcatgatgatgtcatggccaagtttggcgctattctggcccagggcatactggatgcaggtggtcataatgtcacaatctccttgcagtccaggactgggcatactcatatgccttctgtggttggcgtccttgtatttacccagttttggttctggtttcctctttcacacttcctgtcattggcttatacccctacctgtgtcattggccttaacaaggacttaaaggtttctactgctgtattatctataactgccaaggctaaaaagaaggaaaaagaaaaggaaaaaaaggaggaggagaaaatggaagtggatgaggcagagaaaaaggaggaaaaagagaagaaaaaagaacctgagccaaacttccagttattggataacccagcccgagttatgcctgcccagcttaaggtcctaaccatgccggagacctgtagataccagcctttcaaaccactctctattggaggcatcatcattctgaaggataccagtgaagacattgaggagctggtggaacctgtggcagcacatggcccaaaaatcgaggaggaggaacaagagccagaacccccagaaccatttgagtatattgatgattaagggccagaggatctcacttgcttatctgaagaagattgtccaggctcatattgggaatgcttatgaggaaattcatgccgagacctgctattcaatgcatgtatcgttgcctctgcactgacctgaagaaccctgtctccaagtctttggttgaagagaagatatatgactgttgagtgtgctctttcacagaacttggttttcaaataaatataagatctccagatggacaagacatttgtttttcagcctgggtttttaataaatgtatctaatcctccccacaccatgaaatgcctaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5707 -> Molecular function: GO:0030234 [enzyme regulator activity] evidence: IEA
GeneID:5707 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:5707 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:5707 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:5707 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:5707 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
GeneID:5707 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
GeneID:5707 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:5707 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:5707 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0042176 [regulation of protein catabolic process] evidence: IEA
GeneID:5707 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
GeneID:5707 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:5707 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5707 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5707 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
GeneID:5707 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS
GeneID:5707 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:5707 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:5707 -> Cellular component: GO:0005838 [proteasome regulatory particle] evidence: TAS
GeneID:5707 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.