2025-07-19 08:48:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001184715 2604 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 3, mRNA. ACCESSION NM_001184715 VERSION NM_001184715.1 GI:296040492 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2604) AUTHORS Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V., Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U. TITLE HIV-1 Vpu affects the anterograde transport and the glycosylation pattern of NTB-A JOURNAL Virology 440 (2), 190-203 (2013) PUBMED 23528733 REMARK GeneRIF: Together, these results suggest that the reduction of NTB-A from the cell surface is associated with the Vpu-mediated effect on the glycosylation pattern of newly synthesized NTB-A molecules. REFERENCE 2 (bases 1 to 2604) AUTHORS Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C. and Tsokos,G.C. TITLE CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6 receptors enhances RORgammat recruitment to the IL17A promoter in human T lymphocytes JOURNAL J. Biol. Chem. 287 (45), 38168-38177 (2012) PUBMED 22989874 REMARK GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6 pathway in inducing IL-17A production can be attributed to an increased nuclear abundance and recruitment of RORgammat to the IL17A promoter. REFERENCE 3 (bases 1 to 2604) AUTHORS Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M., Terhorst,C. and Tsokos,G.C. TITLE Increased expression of SLAM receptors SLAMF3 and SLAMF6 in systemic lupus erythematosus T lymphocytes promotes Th17 differentiation JOURNAL J. Immunol. 188 (3), 1206-1212 (2012) PUBMED 22184727 REMARK GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17 levels significantly correlate with disease activity in systemic lupus erythematosus patients REFERENCE 4 (bases 1 to 2604) AUTHORS Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C. TITLE SLAMF6-driven co-stimulation of human peripheral T cells is defective in SLE T cells JOURNAL Autoimmunity 44 (3), 211-218 (2011) PUBMED 21231893 REMARK GeneRIF: Although the expression of SLAMF6 on the surface of T cells from patients with systemic lupus erythematosus (SLE) T cells is comparable to that on the normal T cells, engagement of SLAMF6 results in severely reduced Th1 and IL-2 cytokine production REFERENCE 5 (bases 1 to 2604) AUTHORS Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M., Planelles,V. and Barker,E. TITLE Degranulation of natural killer cells following interaction with HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu JOURNAL Cell Host Microbe 8 (5), 397-409 (2010) PUBMED 21075351 REMARK GeneRIF: Vpu downmodulation of NTB-A protects the infected cell from lysis by NK cells. REFERENCE 6 (bases 1 to 2604) AUTHORS Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q., Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C. TITLE Identification and characterization of SF2000 and SF2001, two new members of the immune receptor SLAM/CD2 family JOURNAL Immunogenetics 53 (10-11), 843-850 (2002) PUBMED 11862385 REFERENCE 7 (bases 1 to 2604) AUTHORS Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R., Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and Moretta,A. TITLE NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface molecule contributing to the inability of natural killer cells to kill Epstein-Barr virus-infected B cells in X-linked lymphoproliferative disease JOURNAL J. Exp. Med. 194 (3), 235-246 (2001) PUBMED 11489943 REMARK Erratum:[J Exp Med 2001 Sep 3;194(5):following 703] REFERENCE 8 (bases 1 to 2604) AUTHORS Lee,Y.J., Luisiri,P. and Clark,M.R. TITLE A novel complex, p40/42, is constitutively associated with the B cell antigen receptor and phosphorylated upon receptor stimulation JOURNAL J. Immunol. 157 (9), 3828-3837 (1996) PUBMED 8892612 REFERENCE 9 (bases 1 to 2604) AUTHORS Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T. and Chan,A.C. TITLE Distinct tyrosine phosphorylation sites in ZAP-70 mediate activation and negative regulation of antigen receptor function JOURNAL Mol. Cell. Biol. 16 (9), 5026-5035 (1996) PUBMED 8756661 REFERENCE 10 (bases 1 to 2604) AUTHORS Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O., Reinherz,E.L., Schlossman,S.F. and Ritz,J. TITLE Natural killer-like function of activated T lymphocytes: differential blocking effects of monoclonal antibodies specific for a 90-kDa clonotypic structure JOURNAL Cell. Immunol. 86 (2), 381-392 (1984) PUBMED 6610481 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB197632.1, AK303990.1, AJ277141.1 and AK125624.1. Summary: The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]. Transcript Variant: This variant (3) uses multiple alternate splice sites in the coding region, compared to variant 1, which result in an isoform (3) with a shorter extracellular domain than isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK303990.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025084, ERS025088 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-7 DB197632.1 1-7 8-241 AK303990.1 1-234 242-1266 AJ277141.1 331-1355 1267-2604 AK125624.1 1413-2750 FEATURES Location/Qualifiers source 1..2604 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q23.2" gene 1..2604 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="SLAM family member 6" /db_xref="GeneID:114836" /db_xref="HGNC:21392" /db_xref="MIM:606446" exon 1..119 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" STS 44..1347 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /db_xref="UniSTS:486452" CDS 71..919 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="isoform 3 precursor is encoded by transcript variant 3; activating NK receptor; natural killer-, T- and B-cell antigen; NTBA receptor; NK-T-B-antigen" /codon_start=1 /product="SLAM family member 6 isoform 3 precursor" /protein_id="NP_001171644.1" /db_xref="GI:296040493" /db_xref="GeneID:114836" /db_xref="HGNC:21392" /db_xref="MIM:606446" /translation="
MLWLFQSLLFVFCFGPVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
" sig_peptide 71..133 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" misc_feature <77..304 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" mat_peptide 134..916 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /product="SLAM family member 6 isoform 3" misc_feature 323..520 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" exon 120..305 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 306..569 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 409 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:35414223" exon 570..680 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 653 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="c" /replace="t" /db_xref="dbSNP:34355503" exon 681..719 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 720..799 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 800..871 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 872..2596 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 2307 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="a" /replace="t" /db_xref="dbSNP:634791" STS 2340..2508 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /standard_name="G35510" /db_xref="UniSTS:44150" STS 2382..2472 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /standard_name="D8S2279" /db_xref="UniSTS:473907" polyA_signal 2562..2567 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2566..2571 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2570..2575 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2575..2580 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_site 2596 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" ORIGIN
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccagtaccccatgaaaccaaaagtccagaaatccacgtgactaatccgaaacagggaaagcgactgaacttcacccagtcctactccctgcaactcagcaacctgaagatggaagacacaggctcttacagagcccagatatccacaaagacctctgcaaagctgtccagttacactctgaggatattaagacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.