GGRNA Home | Help | Advanced search

2025-07-07 06:21:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001184715            2604 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 3,
            mRNA.
ACCESSION   NM_001184715
VERSION     NM_001184715.1  GI:296040492
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2604)
  AUTHORS   Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V.,
            Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U.
  TITLE     HIV-1 Vpu affects the anterograde transport and the glycosylation
            pattern of NTB-A
  JOURNAL   Virology 440 (2), 190-203 (2013)
   PUBMED   23528733
  REMARK    GeneRIF: Together, these results suggest that the reduction of
            NTB-A from the cell surface is associated with the Vpu-mediated
            effect on the glycosylation pattern of newly synthesized NTB-A
            molecules.
REFERENCE   2  (bases 1 to 2604)
  AUTHORS   Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C.
            and Tsokos,G.C.
  TITLE     CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6
            receptors enhances RORgammat recruitment to the IL17A promoter in
            human T lymphocytes
  JOURNAL   J. Biol. Chem. 287 (45), 38168-38177 (2012)
   PUBMED   22989874
  REMARK    GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6
            pathway in inducing IL-17A production can be attributed to an
            increased nuclear abundance and recruitment of RORgammat to the
            IL17A promoter.
REFERENCE   3  (bases 1 to 2604)
  AUTHORS   Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M.,
            Terhorst,C. and Tsokos,G.C.
  TITLE     Increased expression of SLAM receptors SLAMF3 and SLAMF6 in
            systemic lupus erythematosus T lymphocytes promotes Th17
            differentiation
  JOURNAL   J. Immunol. 188 (3), 1206-1212 (2012)
   PUBMED   22184727
  REMARK    GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17
            levels significantly correlate with disease activity in systemic
            lupus erythematosus patients
REFERENCE   4  (bases 1 to 2604)
  AUTHORS   Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C.
  TITLE     SLAMF6-driven co-stimulation of human peripheral T cells is
            defective in SLE T cells
  JOURNAL   Autoimmunity 44 (3), 211-218 (2011)
   PUBMED   21231893
  REMARK    GeneRIF: Although the expression of SLAMF6 on the surface of T
            cells from patients with systemic lupus erythematosus (SLE) T cells
            is comparable to that on the normal T cells, engagement of SLAMF6
            results in severely reduced Th1 and IL-2 cytokine production
REFERENCE   5  (bases 1 to 2604)
  AUTHORS   Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M.,
            Planelles,V. and Barker,E.
  TITLE     Degranulation of natural killer cells following interaction with
            HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu
  JOURNAL   Cell Host Microbe 8 (5), 397-409 (2010)
   PUBMED   21075351
  REMARK    GeneRIF: Vpu downmodulation of NTB-A protects the infected cell
            from lysis by NK cells.
REFERENCE   6  (bases 1 to 2604)
  AUTHORS   Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q.,
            Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C.
  TITLE     Identification and characterization of SF2000 and SF2001, two new
            members of the immune receptor SLAM/CD2 family
  JOURNAL   Immunogenetics 53 (10-11), 843-850 (2002)
   PUBMED   11862385
REFERENCE   7  (bases 1 to 2604)
  AUTHORS   Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R.,
            Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and
            Moretta,A.
  TITLE     NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface
            molecule contributing to the inability of natural killer cells to
            kill Epstein-Barr virus-infected B cells in X-linked
            lymphoproliferative disease
  JOURNAL   J. Exp. Med. 194 (3), 235-246 (2001)
   PUBMED   11489943
  REMARK    Erratum:[J Exp Med 2001 Sep 3;194(5):following 703]
REFERENCE   8  (bases 1 to 2604)
  AUTHORS   Lee,Y.J., Luisiri,P. and Clark,M.R.
  TITLE     A novel complex, p40/42, is constitutively associated with the B
            cell antigen receptor and phosphorylated upon receptor stimulation
  JOURNAL   J. Immunol. 157 (9), 3828-3837 (1996)
   PUBMED   8892612
REFERENCE   9  (bases 1 to 2604)
  AUTHORS   Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T.
            and Chan,A.C.
  TITLE     Distinct tyrosine phosphorylation sites in ZAP-70 mediate
            activation and negative regulation of antigen receptor function
  JOURNAL   Mol. Cell. Biol. 16 (9), 5026-5035 (1996)
   PUBMED   8756661
REFERENCE   10 (bases 1 to 2604)
  AUTHORS   Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O.,
            Reinherz,E.L., Schlossman,S.F. and Ritz,J.
  TITLE     Natural killer-like function of activated T lymphocytes:
            differential blocking effects of monoclonal antibodies specific for
            a 90-kDa clonotypic structure
  JOURNAL   Cell. Immunol. 86 (2), 381-392 (1984)
   PUBMED   6610481
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB197632.1, AK303990.1,
            AJ277141.1 and AK125624.1.
            
            Summary: The protein encoded by this gene is a type I transmembrane
            protein, belonging to the CD2 subfamily of the immunoglobulin
            superfamily. This encoded protein is expressed on Natural killer
            (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation
            and associates with the Src homology 2 domain-containing protein
            (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs).
            It functions as a coreceptor in the process of NK cell activation.
            It can also mediate inhibitory signals in NK cells from X-linked
            lymphoproliferative patients. Alternative splicing results in
            multiple transcript variants encoding distinct isoforms.[provided
            by RefSeq, May 2010].
            
            Transcript Variant: This variant (3) uses multiple alternate splice
            sites in the coding region, compared to variant 1, which result in
            an isoform (3) with a shorter extracellular domain than isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK303990.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025088 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-7                 DB197632.1         1-7
            8-241               AK303990.1         1-234
            242-1266            AJ277141.1         331-1355
            1267-2604           AK125624.1         1413-2750
FEATURES             Location/Qualifiers
     source          1..2604
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.2"
     gene            1..2604
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="SLAM family member 6"
                     /db_xref="GeneID:114836"
                     /db_xref="HGNC:21392"
                     /db_xref="MIM:606446"
     exon            1..119
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     STS             44..1347
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /db_xref="UniSTS:486452"
     CDS             71..919
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="isoform 3 precursor is encoded by transcript
                     variant 3; activating NK receptor; natural killer-, T- and
                     B-cell antigen; NTBA receptor; NK-T-B-antigen"
                     /codon_start=1
                     /product="SLAM family member 6 isoform 3 precursor"
                     /protein_id="NP_001171644.1"
                     /db_xref="GI:296040493"
                     /db_xref="GeneID:114836"
                     /db_xref="HGNC:21392"
                     /db_xref="MIM:606446"
                     /translation="
MLWLFQSLLFVFCFGPVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
"
     sig_peptide     71..133
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     misc_feature    <77..304
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     mat_peptide     134..916
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /product="SLAM family member 6 isoform 3"
     misc_feature    323..520
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            120..305
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            306..569
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       409
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35414223"
     exon            570..680
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       653
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34355503"
     exon            681..719
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            720..799
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            800..871
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            872..2596
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       2307
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:634791"
     STS             2340..2508
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /standard_name="G35510"
                     /db_xref="UniSTS:44150"
     STS             2382..2472
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /standard_name="D8S2279"
                     /db_xref="UniSTS:473907"
     polyA_signal    2562..2567
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2566..2571
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2570..2575
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2575..2580
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_site      2596
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
ORIGIN      
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccagtaccccatgaaaccaaaagtccagaaatccacgtgactaatccgaaacagggaaagcgactgaacttcacccagtcctactccctgcaactcagcaacctgaagatggaagacacaggctcttacagagcccagatatccacaaagacctctgcaaagctgtccagttacactctgaggatattaagacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
            GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.