GGRNA Home | Help | Advanced search

2020-10-24 07:28:48, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001184               8258 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens ataxia telangiectasia and Rad3 related (ATR), mRNA.
ACCESSION   NM_001184 XM_940761
VERSION     NM_001184.3  GI:157266316
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8258)
  AUTHORS   Somyajit,K., Basavaraju,S., Scully,R. and Nagaraju,G.
  TITLE     ATM- and ATR-mediated phosphorylation of XRCC3 regulates DNA
            double-strand break-induced checkpoint activation and repair
  JOURNAL   Mol. Cell. Biol. 33 (9), 1830-1844 (2013)
   PUBMED   23438602
  REMARK    GeneRIF: hXRCC3 S225 phosphorylation is mediated by ATR via an
            ATM-dependent signaling pathway.
REFERENCE   2  (bases 1 to 8258)
  AUTHORS   Ding,G., Liu,H.D., Liang,H.X., Ni,R.F., Ding,Z.Y., Ni,G.Y.,
            Hua,H.W. and Xu,W.G.
  TITLE     HIF1-regulated ATRIP expression is required for hypoxia induced ATR
            activation
  JOURNAL   FEBS Lett. 587 (7), 930-935 (2013)
   PUBMED   23454212
  REMARK    GeneRIF: indicate that ATRIP is a direct target gene of HIF-1, and
            the increased ATRIP then activates the ATR signaling pathway under
            hypoxia.
REFERENCE   3  (bases 1 to 8258)
  AUTHORS   Liu,S., Ho,C.K., Ouyang,J. and Zou,L.
  TITLE     Nek1 kinase associates with ATR-ATRIP and primes ATR for efficient
            DNA damage signaling
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (6), 2175-2180 (2013)
   PUBMED   23345434
  REMARK    GeneRIF: as an ATR-associated kinase, Nek1 enhances the stability
            and activity of ATR-ATRIP before DNA damage, priming ATR-ATRIP for
            a robust DNA damage response
REFERENCE   4  (bases 1 to 8258)
  AUTHORS   Xie,L., Gazin,C., Park,S.M., Zhu,L.J., Debily,M.A., Kittler,E.L.,
            Zapp,M.L., Lapointe,D., Gobeil,S., Virbasius,C.M. and Green,M.R.
  TITLE     A synthetic interaction screen identifies factors selectively
            required for proliferation and TERT transcription in p53-deficient
            human cancer cells
  JOURNAL   PLoS Genet. 8 (12), E1003151 (2012)
   PUBMED   23284306
  REMARK    GeneRIF: Our collective results identify a regulatory pathway
            involving ETV1, ATR, and TERT that is preferentially important for
            proliferation of diverse p53- cancer cells
REFERENCE   5  (bases 1 to 8258)
  AUTHORS   Chiu,Y.T., Liu,J., Tang,K., Wong,Y.C., Khanna,K.K. and Ling,M.T.
  TITLE     Inactivation of ATM/ATR DNA damage checkpoint promotes androgen
            induced chromosomal instability in prostate epithelial cells
  JOURNAL   PLoS ONE 7 (12), E51108 (2012)
   PUBMED   23272087
  REMARK    GeneRIF: ATM/ATR inactivation is a crucial step in promoting
            androgen-induced genomic instability and prostate carcinogenesis
REFERENCE   6  (bases 1 to 8258)
  AUTHORS   Wright,J.A., Keegan,K.S., Herendeen,D.R., Bentley,N.J., Carr,A.M.,
            Hoekstra,M.F. and Concannon,P.
  TITLE     Protein kinase mutants of human ATR increase sensitivity to UV and
            ionizing radiation and abrogate cell cycle checkpoint control
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 95 (13), 7445-7450 (1998)
   PUBMED   9636169
REFERENCE   7  (bases 1 to 8258)
  AUTHORS   Cliby,W.A., Roberts,C.J., Cimprich,K.A., Stringer,C.M., Lamb,J.R.,
            Schreiber,S.L. and Friend,S.H.
  TITLE     Overexpression of a kinase-inactive ATR protein causes sensitivity
            to DNA-damaging agents and defects in cell cycle checkpoints
  JOURNAL   EMBO J. 17 (1), 159-169 (1998)
   PUBMED   9427750
REFERENCE   8  (bases 1 to 8258)
  AUTHORS   Bentley,N.J., Holtzman,D.A., Flaggs,G., Keegan,K.S., DeMaggio,A.,
            Ford,J.C., Hoekstra,M. and Carr,A.M.
  TITLE     The Schizosaccharomyces pombe rad3 checkpoint gene
  JOURNAL   EMBO J. 15 (23), 6641-6651 (1996)
   PUBMED   8978690
REFERENCE   9  (bases 1 to 8258)
  AUTHORS   Keegan,K.S., Holtzman,D.A., Plug,A.W., Christenson,E.R.,
            Brainerd,E.E., Flaggs,G., Bentley,N.J., Taylor,E.M., Meyn,M.S.,
            Moss,S.B., Carr,A.M., Ashley,T. and Hoekstra,M.F.
  TITLE     The Atr and Atm protein kinases associate with different sites
            along meiotically pairing chromosomes
  JOURNAL   Genes Dev. 10 (19), 2423-2437 (1996)
   PUBMED   8843195
REFERENCE   10 (bases 1 to 8258)
  AUTHORS   Cimprich,K.A., Shin,T.B., Keith,C.T. and Schreiber,S.L.
  TITLE     cDNA cloning and gene mapping of a candidate human cell cycle
            checkpoint protein
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 93 (7), 2850-2855 (1996)
   PUBMED   8610130
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC346860.1, U49844.1, U76308.1
            and BE859077.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Sep 14, 2007 this sequence version replaced gi:20143978.
            
            Summary: The protein encoded by this gene belongs the
            PI3/PI4-kinase family, and is most closely related to ATM, a
            protein kinase encoded by the gene mutated in ataxia
            telangiectasia. This protein and ATM share similarity with
            Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene
            required for cell cycle arrest and DNA damage repair in response to
            DNA damage. This kinase has been shown to phosphorylate checkpoint
            kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor
            suppressor protein BRCA1. Mutations of this gene are associated
            with Seckel syndrome. An alternatively spliced transcript variant
            of this gene has been reported, however, its full length nature is
            not known. Transcript variants utilizing alternative polyA sites
            exist. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U76308.1, Y09077.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-17                DC346860.1         2-18
            18-4342             U49844.1           1-4325
            4343-7996           U76308.1           4300-7953
            7997-8258           BE859077.1         1-262               c
FEATURES             Location/Qualifiers
     source          1..8258
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q23"
     gene            1..8258
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="ataxia telangiectasia and Rad3 related"
                     /db_xref="GeneID:545"
                     /db_xref="HGNC:882"
                     /db_xref="MIM:601215"
     exon            1..181
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    99..101
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="upstream in-frame stop codon"
     CDS             123..8057
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /EC_number="2.7.11.1"
                     /note="MEC1, mitosis entry checkpoint 1, homolog; Rad3
                     related protein; FRAP-related protein-1; protein kinase
                     ATR; FRAP-related protein 1; ataxia telangiectasia and
                     Rad3-related protein"
                     /codon_start=1
                     /product="serine/threonine-protein kinase ATR"
                     /protein_id="NP_001175.2"
                     /db_xref="GI:157266317"
                     /db_xref="CCDS:CCDS3124.1"
                     /db_xref="GeneID:545"
                     /db_xref="HGNC:882"
                     /db_xref="MIM:601215"
                     /translation="
MGEHGLELASMIPALRELGSATPEEYNTVVQKPRQILCQFIDRILTDVNVVAVELVKKTDSQPTSVMLLDFIQHIMKSSPLMFVNVSGSHEAKGSCIEFSNWIITRLLRIAATPSCHLLHKKICEVICSLLFLFKSKSPAIFGVLTKELLQLFEDLVYLHRRNVMGHAVEWPVVMSRFLSQLDEHMGYLQSAPLQLMSMQNLEFIEVTLLMVLTRIIAIVFFRRQELLLWQIGCVLLEYGSPKIKSLAISFLTELFQLGGLPAQPASTFFSSFLELLKHLVEMDTDQLKLYEEPLSKLIKTLFPFEAEAYRNIEPVYLNMLLEKLCVMFEDGVLMRLKSDLLKAALCHLLQYFLKFVPAGYESALQVRKVYVRNICKALLDVLGIEVDAEYLLGPLYAALKMESMEIIEEIQCQTQQENLSSNSDGISPKRRRLSSSLNPSKRAPKQTEEIKHVDMNQKSILWSALKQKAESLQISLEYSGLKNPVIEMLEGIAVVLQLTALCTVHCSHQNMNCRTFKDCQHKSKKKPSVVITWMSLDFYTKVLKSCRSLLESVQKLDLEATIDKVVKIYDALIYMQVNSSFEDHILEDLCGMLSLPWIYSHSDDGCLKLTTFAANLLTLSCRISDSYSPQAQSRCVFLLTLFPRRIFLEWRTAVYNWALQSSHEVIRASCVSGFFILLQQQNSCNRVPKILIDKVKDDSDIVKKEFASILGQLVCTLHGMFYLTSSLTEPFSEHGHVDLFCRNLKATSQHECSSSQLKASVCKPFLFLLKKKIPSPVKLAFIDNLHHLCKHLDFREDETDVKAVLGTLLNLMEDPDKDVRVAFSGNIKHILESLDSEDGFIKELFVLRMKEAYTHAQISRNNELKDTLILTTGDIGRAAKGDLVPFALLHLLHCLLSKSASVSGAAYTEIRALVAAKSVKLQSFFSQYKKPICQFLVESLHSSQMTALPNTPCQNADVRKQDVAHQREMALNTLSEIANVFDFPDLNRFLTRTLQVLLPDLAAKASPAASALIRTLGKQLNVNRREILINNFKYIFSHLVCSCSKDELERALHYLKNETEIELGSLLRQDFQGLHNELLLRIGEHYQQVFNGLSILASFASSDDPYQGPRDIISPELMADYLQPKLLGILAFFNMQLLSSSVGIEDKKMALNSLMSLMKLMGPKHVSSVRVKMMTTLRTGLRFKDDFPELCCRAWDCFVRCLDHACLGSLLSHVIVALLPLIHIQPKETAAIFHYLIIENRDAVQDFLHEIYFLPDHPELKKIKAVLQEYRKETSESTDLQTTLQLSMKAIQHENVDVRIHALTSLKETLYKNQEKLIKYATDSETVEPIISQLVTVLLKGCQDANSQARLLCGECLGELGAIDPGRLDFSTTETQGKDFTFVTGVEDSSFAYGLLMELTRAYLAYADNSRAQDSAAYAIQELLSIYDCREMETNGPGHQLWRRFPEHVREILEPHLNTRYKSSQKSTDWSGVKKPIYLSKLGSNFAEWSASWAGYLITKVRHDLASKIFTCCSIMMKHDFKVTIYLLPHILVYVLLGCNQEDQQEVYAEIMAVLKHDDQHTINTQDIASDLCQLSTQTVFSMLDHLTQWARHKFQALKAEKCPHSKSNRNKVDSMVSTVDYEDYQSVTRFLDLIPQDTLAVASFRSKAYTRAVMHFESFITEKKQNIQEHLGFLQKLYAAMHEPDGVAGVSAIRKAEPSLKEQILEHESLGLLRDATACYDRAIQLEPDQIIHYHGVVKSMLGLGQLSTVITQVNGVHANRSEWTDELNTYRVEAAWKLSQWDLVENYLAADGKSTTWSVRLGQLLLSAKKRDITAFYDSLKLVRAEQIVPLSAASFERGSYQRGYEYIVRLHMLCELEHSIKPLFQHSPGDSSQEDSLNWVARLEMTQNSYRAKEPILALRRALLSLNKRPDYNEMVGECWLQSARVARKAGHHQTAYNALLNAGESRLAELYVERAKWLWSKGDVHQALIVLQKGVELCFPENETPPEGKNMLIHGRAMLLVGRFMEETANFESNAIMKKYKDVTACLPEWEDGHFYLAKYYDKLMPMVTDNKMEKQGDLIRYIVLHFGRSLQYGNQFIYQSMPRMLTLWLDYGTKAYEWEKAGRSDRVQMRNDLGKINKVITEHTNYLAPYQFLTAFSQLISRICHSHDEVFVVLMEIIAKVFLAYPQQAMWMMTAVSKSSYPMRVNRCKEILNKAIHMKKSLEKFVGDATRLTDKLLELCNKPVDGSSSTLSMSTHFKMLKKLVEEATFSEILIPLQSVMIPTLPSILGTHANHASHEPFPGHWAYIAGFDDMVEILASLQKPKKISLKGSDGKFYIMMCKPKDDLRKDCRLMEFNSLINKCLRKDAESRRRELHIRTYAVIPLNDECGIIEWVNNTAGLRPILTKLYKEKGVYMTGKELRQCMLPKSAALSEKLKVFREFLLPRHPPIFHEWFLRTFPDPTSWYSSRSAYCRSTAVMSMVGYILGLGDRHGENILFDSLTGECVHVDFNCLFNKGETFEVPEIVPFRLTHNMVNGMGPMGTEGLFRRACEVTMRLMRDQREPLMSVLKTFLHDPLVEWSKPVKGHSKAPLNETGEVVNEKAKTHVLDIEQRLQGVIKTRNRVTGLPLSIEGHVHYLIQEATDENLLCQMYLGWTPYM
"
     misc_feature    1404..1406
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13535.3); phosphorylation site"
     misc_feature    2517..2627
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q13535.3);
                     Region: HEAT 1"
     misc_feature    3477..3794
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="Domain in UVSB PI-3 kinase, MEI-41 and ESR-1;
                     Region: UME; smart00802"
                     /db_xref="CDD:129038"
     misc_feature    4107..4217
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q13535.3);
                     Region: HEAT 2"
     misc_feature    5433..6398
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="FAT domain; Region: FAT; pfam02259"
                     /db_xref="CDD:202179"
     misc_feature    6087..6089
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q13535.3); phosphorylation site"
     misc_feature    6999..7823
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="ATR (Ataxia telangiectasia and Rad3-related),
                     catalytic domain; The ATR catalytic domain subfamily is
                     part of a larger superfamily that includes the catalytic
                     domains of other kinases such as the typical
                     serine/threonine/tyrosine protein kinases (PKs); Region:
                     PIKKc_ATR; cd00892"
                     /db_xref="CDD:119418"
     misc_feature    order(7029..7031,7035..7043,7047..7049,7095..7097,
                     7101..7103,7110..7112,7215..7217,7251..7262,7275..7277,
                     7560..7562,7566..7568,7599..7604)
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:119418"
     misc_feature    7092..7823
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="Phosphoinositide 3-kinase, catalytic domain;
                     Region: PI3Kc; smart00146"
                     /db_xref="CDD:197542"
     misc_feature    7536..7562
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="catalytic loop [active]"
                     /db_xref="CDD:119418"
     misc_feature    7602..7670
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:119418"
     misc_feature    7956..8054
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /note="FATC domain; Region: FATC; pfam02260"
                     /db_xref="CDD:202180"
     exon            182..273
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            274..414
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       390
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28897763"
     exon            415..1292
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       754
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2227928"
     variation       938
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34685245"
     variation       1013
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2229033"
     variation       1068
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28897764"
     exon            1293..1471
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       1448
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28897765"
     exon            1472..1663
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            1664..1854
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            1855..2007
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       1898
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2227930"
     variation       1937
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2227929"
     exon            2008..2200
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       2072
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28910270"
     exon            2201..2463
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            2464..2654
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            2655..2755
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            2756..2927
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            2928..3098
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       2997
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28910271"
     exon            3099..3293
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       3242
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28910272"
     exon            3294..3479
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            3480..3572
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            3573..3703
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            3704..3847
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            3848..3941
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            3942..4067
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4068..4274
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4275..4388
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4389..4504
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4505..4625
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4626..4763
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4764..4974
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            4975..5153
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            5154..5318
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            5319..5410
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       5330
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2227931"
     exon            5411..5502
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            5503..5680
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       5582
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2227932"
     exon            5681..5860
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            5861..6020
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            6021..6200
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            6201..6343
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            6344..6441
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            6442..6674
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       6516
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:28910273"
     exon            6675..6809
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            6810..7019
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7020..7163
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7164..7314
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7315..7471
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       7396
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229032"
     variation       7422
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:33972295"
     exon            7472..7625
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7626..7777
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7778..7883
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     exon            7884..8251
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /inference="alignment:Splign:1.39.8"
     variation       7997
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1802904"
     variation       8023
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1804758"
     STS             8100..8183
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
                     /standard_name="STS-U76308"
                     /db_xref="UniSTS:71733"
     polyA_signal    8230..8235
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
     polyA_site      8251
                     /gene="ATR"
                     /gene_synonym="FCTCS; FRP1; MEC1; SCKL; SCKL1"
ORIGIN      
ttccgggaggagttttggcctccacacggctccgtcgggcgccgcgctcttccggcagcggtagctttggagacgccgggaacccgcgttggcgtggttgactagtgcctcgcagcctcagcatgggggaacatggcctggagctggcttccatgatccccgccctgcgggagctgggcagtgccacaccagaggaatataatacagttgtacagaagccaagacaaattctgtgtcaattcattgaccggatacttacagatgtaaatgttgttgctgtagaacttgtaaagaaaactgactctcagccaacctccgtgatgttgcttgatttcatccagcatatcatgaaatcctccccacttatgtttgtaaatgtgagtggaagccatgaggccaaaggcagttgtattgaattcagtaattggatcataacgagacttctgcggattgcagcaactccctcctgtcatttgttacacaagaaaatctgtgaagtcatctgttcattattatttctttttaaaagcaagagtcctgctatttttggggtactcacaaaagaattattacaactttttgaagacttggtttacctccatagaagaaatgtgatgggtcatgctgtggaatggccagtggtcatgagccgatttttaagtcaattagatgaacacatgggatatttacaatcagctcctttgcagttgatgagtatgcaaaatttagaatttattgaagtcactttattaatggttcttactcgtattattgcaattgtgttttttagaaggcaagaactcttactttggcagataggttgtgttctgctagagtatggtagtccaaaaattaaatccctagcaattagctttttaacagaactttttcagcttggaggactaccagcacaaccagctagcacttttttcagctcatttttggaattattaaaacaccttgtagaaatggatactgaccaattgaaactctatgaagagccattatcaaagctgataaagacactatttccctttgaagcagaagcttatagaaatattgaacctgtctatttaaatatgctgctggaaaaactctgtgtcatgtttgaagacggtgtgctcatgcggcttaagtctgatttgctaaaagcagctttgtgccatttactgcagtatttccttaaatttgtgccagctgggtatgaatctgctttacaagtcaggaaggtctatgtgagaaatatttgtaaagctcttttggatgtgcttggaattgaggtagatgcagagtacttgttgggcccactttatgcagctttgaaaatggaaagtatggaaatcattgaggagattcaatgccaaactcaacaggaaaacctcagcagtaatagtgatggaatatcacccaaaaggcgtcgtctcagctcgtctctaaacccttctaaaagagcaccaaaacagactgaggaaattaaacatgtggacatgaaccaaaagagcatattatggagtgcactgaaacagaaagctgaatcccttcagatttcccttgaatacagtggcctaaagaatcctgttattgagatgttagaaggaattgctgttgtcttacaactgactgctctgtgtactgttcattgttctcatcaaaacatgaactgccgtactttcaaggactgtcaacataaatccaagaagaaaccttctgtagtgataacttggatgtcattggatttttacacaaaagtgcttaagagctgtagaagtttgttagaatctgttcagaaactggacctggaggcaaccattgataaggtggtgaaaatttatgatgctttgatttatatgcaagtaaacagttcatttgaagatcatatcctggaagatttatgtggtatgctctcacttccatggatttattcccattctgatgatggctgtttaaagttgaccacatttgccgctaatcttctaacattaagctgtaggatttcagatagctattcaccacaggcacaatcacgatgtgtgtttcttctgactctgtttccaagaagaatattccttgagtggagaacagcagtttacaactgggccctgcagagctcccatgaagtaatccgggctagttgtgttagtggattttttatcttattgcagcagcagaattcttgtaacagagttcccaagattcttatagataaagtcaaagatgattctgacattgtcaagaaagaatttgcttctatacttggtcaacttgtctgtactcttcacggcatgttttatctgacaagttctttaacagaacctttctctgaacacggacatgtggacctcttctgtaggaacttgaaagccacttctcaacatgaatgttcatcttctcaactaaaagcttctgtctgcaagccattccttttcctactgaaaaaaaaaatacctagtccagtaaaacttgctttcatagataatctacatcatctttgtaagcatcttgattttagagaagatgaaacagatgtaaaagcagttcttggaactttattaaatttaatggaagatccagacaaagatgttagagtggcttttagtggaaatatcaagcacatattggaatccttggactctgaagatggatttataaaggagctttttgtcttaagaatgaaggaagcatatacacatgcccaaatatcaagaaataatgagctgaaggataccttgattcttacaacaggggatattggaagggccgcaaaaggagatttggtaccatttgcactcttacacttattgcattgtttgttatccaagtcagcatctgtctctggagcagcatacacagaaattagagctctggttgcagctaaaagtgttaaactgcaaagttttttcagccagtataagaaacccatctgtcagtttttggtagaatcccttcactctagtcagatgacagcacttccgaatactccatgccagaatgctgacgtgcgaaaacaagatgtggctcaccagagagaaatggctttaaatacgttgtctgaaattgccaacgttttcgactttcctgatcttaatcgttttcttactaggacattacaagttctactacctgatcttgctgccaaagcaagccctgcagcttctgctctcattcgaactttaggaaaacaattaaatgtcaatcgtagagagattttaataaacaacttcaaatatattttttctcatttggtctgttcttgttccaaagatgaattagaacgtgcccttcattatctgaagaatgaaacagaaattgaactggggagcctgttgagacaagatttccaaggattgcataatgaattattgctgcgtattggagaacactatcaacaggtttttaatggtttgtcaatacttgcctcatttgcatccagtgatgatccatatcagggcccgagagatatcatatcacctgaactgatggctgattatttacaacccaaattgttgggcattttggctttttttaacatgcagttactgagctctagtgttggcattgaagataagaaaatggccttgaacagtttgatgtctttgatgaagttaatgggacccaaacatgtcagttctgtgagggtgaagatgatgaccacactgagaactggccttcgattcaaggatgattttcctgaattgtgttgcagagcttgggactgctttgttcgctgcctggatcatgcttgtctgggctcccttctcagtcatgtaatagtagctttgttacctcttatacacatccagcctaaagaaactgcagctatcttccactacctcataattgaaaacagggatgctgtgcaagattttcttcatgaaatatattttttacctgatcatccagaattaaaaaagataaaagccgttctccaggaatacagaaaggagacctctgagagcactgatcttcagacaactcttcagctctctatgaaggccattcaacatgaaaatgtcgatgttcgtattcatgctcttacaagcttgaaggaaaccttgtataaaaatcaggaaaaactgataaagtatgcaacagacagtgaaacagtagaacctattatctcacagttggtgacagtgcttttgaaaggttgccaagatgcaaactctcaagctcggttgctctgtggggaatgtttaggggaattgggggcgatagatccaggtcgattagatttctcaacaactgaaactcaaggaaaagattttacatttgtgactggagtagaagattcaagctttgcctatggattattgatggagctaacaagagcttaccttgcgtatgctgataatagccgagctcaagattcagctgcctatgccattcaggagttgctttctatttatgactgtagagagatggagaccaacggcccaggtcaccaattgtggaggagatttcctgagcatgttcgggaaatactagaacctcatctaaataccagatacaagagttctcagaagtcaaccgattggtctggagtaaagaagccaatttacttaagtaaattgggtagtaactttgcagaatggtcagcatcttgggcaggttatcttattacaaaggttcgacatgatcttgccagtaaaattttcacctgctgtagcattatgatgaagcatgatttcaaagtgaccatctatcttcttccacatattctggtgtatgtcttactgggttgtaatcaagaagatcagcaggaggtttatgcagaaattatggcagttctaaagcatgacgatcagcataccataaatacccaagacattgcatctgatctgtgtcaactcagtacacagactgtgttctccatgcttgaccatctcacacagtgggcaaggcacaaatttcaggcactgaaagctgagaaatgtccacacagcaaatcaaacagaaataaggtagactcaatggtatctactgtggattatgaagactatcagagtgtaacccgttttctagacctcataccccaggatactctggcagtagcttcctttcgctccaaagcatacacacgagctgtaatgcactttgaatcatttattacagaaaagaagcaaaatattcaggaacatcttggatttttacagaaattgtatgctgctatgcatgaacctgatggagtggccggagtcagtgcaattagaaaggcagaaccatctctaaaagaacagatccttgaacatgaaagccttggcttgctgagggatgccactgcttgttatgacagggctattcagctagaaccagaccagatcattcattatcatggtgtagtaaagtccatgttaggtcttggtcagctgtctactgttatcactcaggtgaatggagtgcatgctaacaggtccgagtggacagatgaattaaacacgtacagagtggaagcagcttggaaattgtcacagtgggatttggtggaaaactatttggcagcagatggaaaatctacaacatggagtgtcagactgggacagctattattatcagccaaaaaaagagatatcacagctttttatgactcactgaaactagtgagagcagaacaaattgtacctctttcagctgcaagctttgaaagaggctcctaccaacgaggatatgaatatattgtgagattgcacatgttatgtgagttggagcatagcatcaaaccacttttccagcattctccaggtgacagttctcaagaagattctctaaactgggtagctcgactagaaatgacccagaattcctacagagccaaggagcctatcctggctctccggagggctttactaagcctcaacaaaagaccagattacaatgaaatggttggagaatgctggctgcagagtgccagggtagctagaaaggctggtcaccaccagacagcctacaatgctctccttaatgcaggggaatcacgactcgctgaactgtacgtggaaagggcaaagtggctctggtccaagggtgatgttcaccaggcactaattgttcttcaaaaaggtgttgaattatgttttcctgaaaatgaaaccccacctgagggtaagaacatgttaatccatggtcgagctatgctactagtgggccgatttatggaagaaacagctaactttgaaagcaatgcaattatgaaaaaatataaggatgtgaccgcgtgcctgccagaatgggaggatgggcatttttaccttgccaagtactatgacaaattgatgcccatggtcacagacaacaaaatggaaaagcaaggtgatctcatccggtatatagttcttcattttggcagatctctacaatatggaaatcagttcatatatcagtcaatgccacgaatgttaactctatggcttgattatggtacaaaggcatatgaatgggaaaaagctggccgctccgatcgtgtacaaatgaggaatgatttgggtaaaataaacaaggttatcacagagcatacaaactatttagctccatatcaatttttgactgctttttcacaattgatctctcgaatttgtcattctcacgatgaagtttttgttgtcttgatggaaataatagccaaagtatttctagcctatcctcaacaagcaatgtggatgatgacagctgtgtcaaagtcatcttatcccatgcgtgtgaacagatgcaaggaaatcctcaataaagctattcatatgaaaaaatccttagagaagtttgttggagatgcaactcgcctaacagataagcttctagaattgtgcaataaaccggttgatggaagtagttccacattaagcatgagcactcattttaaaatgcttaaaaagctggtagaagaagcaacatttagtgaaatcctcattcctctacaatcagtcatgatacctacacttccatcaattctgggtacccatgctaaccatgctagccatgaaccatttcctggacattgggcctatattgcagggtttgatgatatggtggaaattcttgcttctcttcagaaaccaaagaagatttctttaaaaggctcagatggaaagttctacatcatgatgtgtaagccaaaagatgacctgagaaaggattgtagactaatggaattcaattccttgattaataagtgcttaagaaaagatgcagagtctcgtagaagagaacttcatattcgaacatatgcagttattccactaaatgatgaatgtgggattattgaatgggtgaacaacactgctggtttgagacctattctgaccaaactatataaagaaaagggagtgtatatgacaggaaaagaacttcgccagtgtatgctaccaaagtcagcagctttatctgaaaaactcaaagtattccgagaatttctcctgcccaggcatcctcctatttttcatgagtggtttctgagaacattccctgatcctacatcatggtacagtagtagatcagcttactgccgttccactgcagtaatgtcaatggttggttatattctggggcttggagaccgtcatggtgaaaatattctctttgattctttgactggtgaatgcgtacatgtagatttcaattgtcttttcaataagggagaaacctttgaagttccagaaattgtgccatttcgcctgactcataatatggttaatggaatgggtcctatgggaacagagggtctttttcgaagagcatgtgaagttacaatgaggctgatgcgtgatcagcgagagcctttaatgagtgtcttaaagacttttctacatgatcctcttgtggaatggagtaaaccagtgaaagggcattccaaagcgccactgaatgaaactggagaagttgtcaatgaaaaggccaagacccatgttcttgacattgagcagcgactacaaggtgtaatcaagactcgaaatagagtgacaggactgccgttatctattgaaggacatgtgcattaccttatacaggaagctactgatgaaaacttactatgccagatgtatcttggttggactccatatatgtgaaatgaaattatgtaaaagaatatgttaataatctaaaagtaatgcatttggtatgaatctgtggttgtatctgttcaattctaaagtacaacataaatttacgttctcagcaactgttatttctctctgatcattaattatatgtaaaataatatacattcagttattaagaaataaactgctttcttaatacaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:545 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:545 -> Molecular function: GO:0004672 [protein kinase activity] evidence: IDA
            GeneID:545 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:545 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:545 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:545 -> Molecular function: GO:0032405 [MutLalpha complex binding] evidence: IDA
            GeneID:545 -> Molecular function: GO:0032407 [MutSalpha complex binding] evidence: IDA
            GeneID:545 -> Biological process: GO:0000077 [DNA damage checkpoint] evidence: IDA
            GeneID:545 -> Biological process: GO:0006260 [DNA replication] evidence: TAS
            GeneID:545 -> Biological process: GO:0006281 [DNA repair] evidence: TAS
            GeneID:545 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: TAS
            GeneID:545 -> Biological process: GO:0007049 [cell cycle] evidence: TAS
            GeneID:545 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS
            GeneID:545 -> Biological process: GO:0008156 [negative regulation of DNA replication] evidence: IMP
            GeneID:545 -> Biological process: GO:0018105 [peptidyl-serine phosphorylation] evidence: IDA
            GeneID:545 -> Biological process: GO:0034644 [cellular response to UV] evidence: IMP
            GeneID:545 -> Biological process: GO:0043393 [regulation of protein binding] evidence: IEA
            GeneID:545 -> Biological process: GO:0043517 [positive regulation of DNA damage response, signal transduction by p53 class mediator] evidence: IMP
            GeneID:545 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
            GeneID:545 -> Biological process: GO:0071480 [cellular response to gamma radiation] evidence: IDA
            GeneID:545 -> Biological process: GO:0090399 [replicative senescence] evidence: IMP
            GeneID:545 -> Cellular component: GO:0001741 [XY body] evidence: IEA
            GeneID:545 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:545 -> Cellular component: GO:0005694 [chromosome] evidence: ISS
            GeneID:545 -> Cellular component: GO:0016605 [PML body] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001175 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.