GGRNA Home | Help | Advanced search

2020-10-24 07:23:55, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001172743            2426 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens retinoic acid induced 2 (RAI2), transcript variant 1,
            mRNA.
ACCESSION   NM_001172743
VERSION     NM_001172743.1  GI:290662162
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2426)
  AUTHORS   Brooks,S., Ebenezer,N., Poopalasundaram,S., Maher,E., Francis,P.,
            Moore,A. and Hardcastle,A.
  TITLE     Refinement of the X-linked cataract locus (CXN) and gene analysis
            for CXN and Nance-Horan syndrome (NHS)
  JOURNAL   Ophthalmic Genet. 25 (2), 121-131 (2004)
   PUBMED   15370543
REFERENCE   2  (bases 1 to 2426)
  AUTHORS   Walpole,S.M., Ronce,N., Grayson,C., Dessay,B., Yates,J.R., Trump,D.
            and Toutain,A.
  TITLE     Exclusion of RAI2 as the causative gene for Nance-Horan syndrome
  JOURNAL   Hum. Genet. 104 (5), 410-411 (1999)
   PUBMED   10394933
REFERENCE   3  (bases 1 to 2426)
  AUTHORS   Walpole,S.M., Hiriyana,K.T., Nicolaou,A., Bingham,E.L., Durham,J.,
            Vaudin,M., Ross,M.T., Yates,J.R., Sieving,P.A. and Trump,D.
  TITLE     Identification and characterization of the human homologue (RAI2)
            of a mouse retinoic acid-induced gene in Xp22
  JOURNAL   Genomics 55 (3), 275-283 (1999)
   PUBMED   10049581
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA648693.1, DC420191.1,
            BC027937.1, AK056214.1 and AI291859.1.
            
            Summary: Retinoic acid plays a critical role in development,
            cellular growth, and differentiation. The specific function of this
            retinoic acid-induced gene has not yet been determined but it may
            play a role in development. The chromosomal location of this gene
            designates it to be a candidate for diseases such as Nance-Horan
            syndrome, sensorineural deafness, non-specific X-linked mental
            retardation, oral-facial-digital syndrome, and Fried syndrome.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (1) encodes the longer isoform.
            Variants 1, 2 and 3 encode the same isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: DC420191.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025088 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-39                DA648693.1         1-39
            40-600              DC420191.1         1-561
            601-1484            BC027937.1         557-1440
            1485-2421           AK056214.1         1381-2317
            2422-2426           AI291859.1         1-5                 c
FEATURES             Location/Qualifiers
     source          1..2426
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp22"
     gene            1..2426
                     /gene="RAI2"
                     /note="retinoic acid induced 2"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
     exon            1..240
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     exon            241..437
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     exon            438..2423
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    456..458
                     /gene="RAI2"
                     /note="upstream in-frame stop codon"
     CDS             462..2054
                     /gene="RAI2"
                     /note="isoform 1 is encoded by transcript variant 1;
                     retinoic acid-induced protein 2"
                     /codon_start=1
                     /product="retinoic acid-induced protein 2 isoform 1"
                     /protein_id="NP_001166214.1"
                     /db_xref="GI:290662163"
                     /db_xref="CCDS:CCDS14183.1"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
                     /translation="
MDDLQSQNLSMDMTDSPPALANNRLENGMAQLITTEAWNINSTDLVKKALVTVPAPSILNPPAESQSGMALKVAATVLQPLCLGESPVVMPIHMQVEGSSAPELNPNGNATYVMTTQGPVQLPVVLEQHVFQHLNSPLVLPQEAPCSSSTIHNNLFQGAEDPEAQPQLLDLRIPSQPQEPTLPFEAVLQNLFPSQGTLGPPPCQPPPGYAPVPPQPFSSPLSPLVPPATLLVPYPVIVPLPVPVPIPIPIPVPQSSESKFSSSFPKPPSSFGLHPFKGTQTPLEKDELKPFDILQPKEYFQLSRHTVIKMGSENEALDLSMKSVPWLKAGEVSPPIFQEDAALDLSVAAHRKSEPPPETLYDSGASVDSSGHTVMEKLPSGMEISFAPATSHEAPAMMDSHISSSDAATEMLSQPNHPSGEVKAENNIEMVGESQAAKVIVSVEDAVPTIFCGKIKGLSGVSTKNFSFKREDSVLQGYDINSQGEESMGNAEPLRKPIKNRSIKLKKVNSQEIHMLPIKKQRLATFFPRK
"
     STS             1735..2424
                     /gene="RAI2"
                     /standard_name="RAI2__5640"
                     /db_xref="UniSTS:463847"
     variation       1945
                     /gene="RAI2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2213616"
     STS             2012..2201
                     /gene="RAI2"
                     /standard_name="RH94025"
                     /db_xref="UniSTS:90417"
     polyA_signal    2402..2407
                     /gene="RAI2"
     polyA_site      2423
                     /gene="RAI2"
ORIGIN      
cttggtgtatatagtaaaggccgggcgccgcacgcagacacacactcgccaggacacaggcgcacacacgctcacgcacaaccagcagcggcggcggcgacagcgactcggtgacagcggcgacggcggctcccaccgcggcgcacccccttcaggcggccggcggcgaggccagaccggagagttccagcacactcgaccaccccgcggcttcctggaggcggcggccgcgattgcgagcaggcttcccaggaagaatgaagcagtcaacttgcataaggcctgtcttgacttctctcctttgggggaagaggatcacattaagaagggtggcaggcttgcctggacacagaattccactaccaaacagacatcatttctgagaacttcagagtttatgatccaggtttcccagtgattaaattactccttggaaggccaagtggcatcagagctgagtgatggacgacctgcagtcccagaacctctccatggacatgactgactcccctcctgccttggctaataacagactggagaatggcatggctcagctgatcaccaccgaggcctggaacatcaactccactgacctggtaaagaaggccctggtgaccgtgccagccccatccattctgaacccccctgccgagtctcagagtggcatggctctgaaggtggcggccactgtgttgcagcccctgtgcctcggggagagcccagtggtgatgcccattcacatgcaggtggagggaagctccgcaccagagctcaatccgaatggcaatgccacctacgtcatgaccacccagggccccgtgcaactgcccgtggtgctggagcagcacgtctttcagcacctcaactcccctctggtcctgccgcaggaggccccatgctcctccagtaccatccacaacaacctcttccagggagcggaggaccccgaggcccagccccagctcctggacctgaggatccccagccagccgcaggagcccactttgccatttgaagctgtgctccagaatttgtttccctcccagggcactctcgggcccccaccctgtcagcctcctcctggctatgcccctgtgcccccacagccttttagctcccccttgtcccccctggtcccaccagccaccctcttggtgccgtatcctgtaatcgtccccttgcctgtgccagtccctattcccatccccatcccggtgcctcagagttctgaatccaagttcagctccagtttccccaagccaccatcttccttcggcctgcacccctttaaaggcacccagacccctctggaaaaagatgaactgaagccctttgacatcctccagcctaaggagtacttccagctcagccgccacacggtcattaagatgggaagtgagaacgaggccctggatctctccatgaagtcagtgccctggctcaaggctggtgaagtcagtcccccaatcttccaggaagatgcagccctagacctgtcagtggcagcccaccggaaatccgagcctccccctgagacactgtatgacagtggtgcatcagtggacagctcaggtcacacagtgatggagaaacttcccagtggcatggaaatttcttttgcccctgccacgtcccatgaggccccagccatgatggatagtcacatcagcagcagtgatgctgctaccgagatgctcagccagcccaaccaccccagcggcgaagtcaaggctgaaaataacattgagatggtgggcgagtcccaggcggccaaggtcattgtctctgtcgaagatgctgtgcctaccatattctgtggcaagatcaaaggcctctcaggggtgtccaccaaaaacttctccttcaaaagagaagactccgtgcttcagggctatgacatcaacagccaaggggaagagtccatgggaaatgcagagccccttaggaaacccatcaaaaaccggagcataaagttaaagaaagtgaactcccaggaaatacacatgctcccaatcaaaaaacaacggctggccaccttttttccaagaaagtaaataacggctttttaaaatttgtatgattataatatggggaaaggtgcattggttttataaaaaggcatttaaaacaaattatctttgttaattattttggggagtagttgggaaatggaaaggtgaattggctctagaggccctgtatgctagtatcattttcttttttaatttttgacttttcacaaatgagtaaataagagcaacctatttttcaagcagattgcacattttttgcagctttaatggaatattgggtgaattagaggggtaaaaaaagctattttcattgccacaaagtgctttgatgatgtaatacctaataaagggtaggatgaatatttcacaataaatgtttgtttgcactaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10742 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:10742 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:10742 -> Biological process: GO:0009790 [embryo development] evidence: NAS
            GeneID:10742 -> Cellular component: GO:0005575 [cellular_component] evidence: ND

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.