LOCUS       NM_001172732            2079 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens retinoic acid induced 2 (RAI2), transcript variant 4,
            mRNA.
ACCESSION   NM_001172732
VERSION     NM_001172732.1  GI:290660752
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2079)
  AUTHORS   Brooks,S., Ebenezer,N., Poopalasundaram,S., Maher,E., Francis,P.,
            Moore,A. and Hardcastle,A.
  TITLE     Refinement of the X-linked cataract locus (CXN) and gene analysis
            for CXN and Nance-Horan syndrome (NHS)
  JOURNAL   Ophthalmic Genet. 25 (2), 121-131 (2004)
   PUBMED   15370543
REFERENCE   2  (bases 1 to 2079)
  AUTHORS   Walpole,S.M., Ronce,N., Grayson,C., Dessay,B., Yates,J.R., Trump,D.
            and Toutain,A.
  TITLE     Exclusion of RAI2 as the causative gene for Nance-Horan syndrome
  JOURNAL   Hum. Genet. 104 (5), 410-411 (1999)
   PUBMED   10394933
REFERENCE   3  (bases 1 to 2079)
  AUTHORS   Walpole,S.M., Hiriyana,K.T., Nicolaou,A., Bingham,E.L., Durham,J.,
            Vaudin,M., Ross,M.T., Yates,J.R., Sieving,P.A. and Trump,D.
  TITLE     Identification and characterization of the human homologue (RAI2)
            of a mouse retinoic acid-induced gene in Xp22
  JOURNAL   Genomics 55 (3), 275-283 (1999)
   PUBMED   10049581
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA648693.1, AK298873.1,
            Z93242.1, AK056214.1 and AI291859.1.
            
            Summary: Retinoic acid plays a critical role in development,
            cellular growth, and differentiation. The specific function of this
            retinoic acid-induced gene has not yet been determined but it may
            play a role in development. The chromosomal location of this gene
            designates it to be a candidate for diseases such as Nance-Horan
            syndrome, sensorineural deafness, non-specific X-linked mental
            retardation, oral-facial-digital syndrome, and Fried syndrome.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (4) differs in the 5' UTR and
            lacks a segment in the coding region, compared to variant 1. The
            resulting protein (isoform 2) is shorter than isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK298873.1, DC366644.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025086 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-39                DA648693.1         1-39
            40-1082             AK298873.1         1-1043
            1083-1218           Z93242.1           41767-41902
            1219-2071           AK056214.1         1462-2314
            2072-2079           AI291859.1         1-8                 c
FEATURES             Location/Qualifiers
     source          1..2079
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp22"
     gene            1..2079
                     /gene="RAI2"
                     /note="retinoic acid induced 2"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
     exon            1..240
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     exon            241..399
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    259..261
                     /gene="RAI2"
                     /note="upstream in-frame stop codon"
     CDS             265..1707
                     /gene="RAI2"
                     /note="isoform 2 is encoded by transcript variant 4;
                     retinoic acid-induced protein 2"
                     /codon_start=1
                     /product="retinoic acid-induced protein 2 isoform 2"
                     /protein_id="NP_001166203.1"
                     /db_xref="GI:290660753"
                     /db_xref="CCDS:CCDS55374.1"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
                     /translation="

MDDLQSQNLSMDMTDSPPALANNRLENGMAQLITTEAWNINSTDLVEGSSAPELNPNGNATYVMTTQGPVQLPVVLEQHVFQHLNSPLVLPQEAPCSSSTIHNNLFQGAEDPEAQPQLLDLRIPSQPQEPTLPFEAVLQNLFPSQGTLGPPPCQPPPGYAPVPPQPFSSPLSPLVPPATLLVPYPVIVPLPVPVPIPIPIPVPQSSESKFSSSFPKPPSSFGLHPFKGTQTPLEKDELKPFDILQPKEYFQLSRHTVIKMGSENEALDLSMKSVPWLKAGEVSPPIFQEDAALDLSVAAHRKSEPPPETLYDSGASVDSSGHTVMEKLPSGMEISFAPATSHEAPAMMDSHISSSDAATEMLSQPNHPSGEVKAENNIEMVGESQAAKVIVSVEDAVPTIFCGKIKGLSGVSTKNFSFKREDSVLQGYDINSQGEESMGNAEPLRKPIKNRSIKLKKVNSQEIHMLPIKKQRLATFFPRK

"
     exon            400..2076
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     STS             1388..2077
                     /gene="RAI2"
                     /standard_name="RAI2__5640"
                     /db_xref="UniSTS:463847"
     variation       1598
                     /gene="RAI2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2213616"
     STS             1665..1854
                     /gene="RAI2"
                     /standard_name="RH94025"
                     /db_xref="UniSTS:90417"
     polyA_signal    2029..2034
                     /gene="RAI2"
     polyA_site      2076
                     /gene="RAI2"
ORIGIN      

cttggtgtatatagtaaaggccgggcgccgcacgcagacacacactcgccaggacacaggcgcacacacgctcacgcacaaccagcagcggcggcggcgacagcgactcggtgacagcggcgacggcggctcccaccgcggcgcacccccttcaggcggccggcggcgaggccagaccggagagttccagcacactcgaccaccccgcggcttcctggaggcggcggccgcgattgcgaggccaagtggcatcagagctgagtgatggacgacctgcagtcccagaacctctccatggacatgactgactcccctcctgccttggctaataacagactggagaatggcatggctcagctgatcaccaccgaggcctggaacatcaactccactgacctggtggagggaagctccgcaccagagctcaatccgaatggcaatgccacctacgtcatgaccacccagggccccgtgcaactgcccgtggtgctggagcagcacgtctttcagcacctcaactcccctctggtcctgccgcaggaggccccatgctcctccagtaccatccacaacaacctcttccagggagcggaggaccccgaggcccagccccagctcctggacctgaggatccccagccagccgcaggagcccactttgccatttgaagctgtgctccagaatttgtttccctcccagggcactctcgggcccccaccctgtcagcctcctcctggctatgcccctgtgcccccacagccttttagctcccccttgtcccccctggtcccaccagccaccctcttggtgccgtatcctgtaatcgtccccttgcctgtgccagtccctattcccatccccatcccggtgcctcagagttctgaatccaagttcagctccagtttccccaagccaccatcttccttcggcctgcacccctttaaaggcacccagacccctctggaaaaagatgaactgaagccctttgacatcctccagcctaaggagtacttccagctcagccgccacacggtcattaagatgggaagtgagaacgaggccctggatctctccatgaagtcagtgccctggctcaaggctggtgaagtcagtcccccaatcttccaggaagatgcagccctagacctgtcagtggcagcccaccggaaatccgagcctccccctgagacactgtatgacagtggtgcatcagtggacagctcaggtcacacagtgatggagaaacttcccagtggcatggaaatttcttttgcccctgccacgtcccatgaggccccagccatgatggatagtcacatcagcagcagtgatgctgctaccgagatgctcagccagcccaaccaccccagcggcgaagtcaaggctgaaaataacattgagatggtgggcgagtcccaggcggccaaggtcattgtctctgtcgaagatgctgtgcctaccatattctgtggcaagatcaaaggcctctcaggggtgtccaccaaaaacttctccttcaaaagagaagactccgtgcttcagggctatgacatcaacagccaaggggaagagtccatgggaaatgcagagccccttaggaaacccatcaaaaaccggagcataaagttaaagaaagtgaactcccaggaaatacacatgctcccaatcaaaaaacaacggctggccaccttttttccaagaaagtaaataacggctttttaaaatttgtatgattataatatggggaaaggtgcattggttttataaaaaggcatttaaaacaaattatctttgttaattattttggggagtagttgggaaatggaaaggtgaattggctctagaggccctgtatgctagtatcattttcttttttaatttttgacttttcacaaatgagtaaataagagcaacctatttttcaagcagattgcacattttttgcagctttaatggaatattgggtgaattagaggggtaaaaaaagctattttcattgccacaaagtgctttgatgatgtaatacctaataaagggtaggatgaatatttcacaataaatgtttgtttgcactaaaaa

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10742 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:10742 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:10742 -> Biological process: GO:0009790 [embryo development] evidence: NAS
            GeneID:10742 -> Cellular component: GO:0005575 [cellular_component] evidence: ND