GGRNA Home | Help | Advanced search

2019-03-23 03:28:38, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001172412            8635 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens VANGL planar cell polarity protein 1 (VANGL1),
            transcript variant 2, mRNA.
ACCESSION   NM_001172412
VERSION     NM_001172412.1  GI:289547197
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8635)
  AUTHORS   Anastas,J.N., Biechele,T.L., Robitaille,M., Muster,J.,
            Allison,K.H., Angers,S. and Moon,R.T.
  TITLE     A protein complex of SCRIB, NOS1AP and VANGL1 regulates cell
            polarity and migration, and is associated with breast cancer
            progression
  JOURNAL   Oncogene 31 (32), 3696-3708 (2012)
   PUBMED   22179838
  REMARK    GeneRIF: NOS1AP colocalizes with both SCRIB and VANGL1 along
            cellular protrusions in metastatic breast cancer cells, but does
            not colocalize with either SCRIB or VANGL1 at cell junctions in
            normal breast cells
REFERENCE   2  (bases 1 to 8635)
  AUTHORS   Lee,S., Song,Y.A., Park,Y.L., Cho,S.B., Lee,W.S., Lee,J.H.,
            Chung,I.J., Kim,K.K., Rew,J.S. and Joo,Y.E.
  TITLE     Expression of KITENIN in human colorectal cancer and its relation
            to tumor behavior and progression
  JOURNAL   Pathol. Int. 61 (4), 210-220 (2011)
   PUBMED   21418393
  REMARK    GeneRIF: KITENIN is associated with human colorectal cancer
            progression including invasion and metastasis.
REFERENCE   3  (bases 1 to 8635)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Apuzzo,S. and Gros,P.
  TITLE     Transmembrane topology of mammalian planar cell polarity protein
            Vangl1
  JOURNAL   Biochemistry 50 (12), 2274-2282 (2011)
   PUBMED   21291170
  REMARK    GeneRIF: a compact membrane-associated portion with very short
            predicted extra- and intracellular loops, while the protein harbors
            a large intracellular domain
REFERENCE   4  (bases 1 to 8635)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Kibar,Z. and Gros,P.
  TITLE     Loss of membrane targeting of Vangl proteins causes neural tube
            defects
  JOURNAL   Biochemistry 50 (5), 795-804 (2011)
   PUBMED   21142127
  REMARK    GeneRIF: Loss of membrane targeting of Vangl1 and Vangl2 proteins
            causes neural tube defects.
REFERENCE   5  (bases 1 to 8635)
  AUTHORS   Ryu,H.S., Park,Y.L., Park,S.J., Lee,J.H., Cho,S.B., Lee,W.S.,
            Chung,I.J., Kim,K.K., Lee,K.H., Kweon,S.S. and Joo,Y.E.
  TITLE     KITENIN is associated with tumor progression in human gastric
            cancer
  JOURNAL   Anticancer Res. 30 (9), 3479-3486 (2010)
   PUBMED   20944126
  REMARK    GeneRIF: KITENIN plays an important role in human gastric cancer
            progression by AP-1 activation.
REFERENCE   6  (bases 1 to 8635)
  AUTHORS   Kalabis,J., Rosenberg,I. and Podolsky,D.K.
  TITLE     Vangl1 protein acts as a downstream effector of intestinal trefoil
            factor (ITF)/TFF3 signaling and regulates wound healing of
            intestinal epithelium
  JOURNAL   J. Biol. Chem. 281 (10), 6434-6441 (2006)
   PUBMED   16410243
  REMARK    GeneRIF: VANGL protein may serve as an effector mediating the
            intestinal trefoil factor (ITF) healing response of the intestinal
            mucosa.
REFERENCE   7  (bases 1 to 8635)
  AUTHORS   Doudney,K., Ybot-Gonzalez,P., Paternotte,C., Stevenson,R.E.,
            Greene,N.D., Moore,G.E., Copp,A.J. and Stanier,P.
  TITLE     Analysis of the planar cell polarity gene Vangl2 and its
            co-expressed paralogue Vangl1 in neural tube defect patients
  JOURNAL   Am. J. Med. Genet. A 136 (1), 90-92 (2005)
   PUBMED   15952208
  REMARK    Erratum:[Am J Med Genet A. 2005 Nov 1;138(4):415]
REFERENCE   8  (bases 1 to 8635)
  AUTHORS   Lee,J.H., Park,S.R., Chay,K.O., Seo,Y.W., Kook,H., Ahn,K.Y.,
            Kim,Y.J. and Kim,K.K.
  TITLE     KAI1 COOH-terminal interacting tetraspanin (KITENIN), a member of
            the tetraspanin family, interacts with KAI1, a tumor metastasis
            suppressor, and enhances metastasis of cancer
  JOURNAL   Cancer Res. 64 (12), 4235-4243 (2004)
   PUBMED   15205336
REFERENCE   9  (bases 1 to 8635)
  AUTHORS   Yagyu,R., Hamamoto,R., Furukawa,Y., Okabe,H., Yamamura,T. and
            Nakamura,Y.
  TITLE     Isolation and characterization of a novel human gene, VANGL1, as a
            therapeutic target for hepatocellular carcinoma
  JOURNAL   Int. J. Oncol. 20 (6), 1173-1178 (2002)
   PUBMED   12011995
REFERENCE   10 (bases 1 to 8635)
  AUTHORS   Katoh,M.
  TITLE     Molecular cloning and characterization of Strabismus 2 (STB2)
  JOURNAL   Int. J. Oncol. 20 (5), 993-998 (2002)
   PUBMED   11956595
  REMARK    GeneRIF: Molecular cloning and characterization of Strabismus 2
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AB057596.1 and AL450389.12.
            
            Summary: This gene encodes a member of the tretraspanin family. The
            encoded protein may be involved in mediating intestinal trefoil
            factor induced wound healing in the intestinal mucosa. Mutations in
            this gene are associated with neural tube defects. Alternate
            splicing results in multiple transcript variants. [provided by
            RefSeq, Feb 2010].
            
            Transcript Variant: This variant (2) differs in the 5' UTR compared
            to variant 1. Both variants 1 and 2 encode the same isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB057596.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1845              AB057596.1         1-1845
            1846-8635           AL450389.12        54859-61648
FEATURES             Location/Qualifiers
     source          1..8635
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p13.1"
     gene            1..8635
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="VANGL planar cell polarity protein 1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="MIM:610132"
     exon            1..78
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       47
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12029798"
     variation       67
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377154941"
     exon            79..286
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       101
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181583261"
     misc_feature    150..152
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="upstream in-frame stop codon"
     variation       161
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371591397"
     variation       178
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78368849"
     variation       184
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371100144"
     variation       187
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375618149"
     variation       198
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185393860"
     CDS             216..1790
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="isoform 1 is encoded by transcript variant 2;
                     strabismus 2; KAI1 C-terminal interacting tetraspanin;
                     vang-like protein 1; van Gogh-like protein 1; loop-tail
                     protein 2 homolog; vang-like 1 (van gogh, Drosophila)"
                     /codon_start=1
                     /product="vang-like protein 1 isoform 1"
                     /protein_id="NP_001165883.1"
                     /db_xref="GI:289547198"
                     /db_xref="CCDS:CCDS883.1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="MIM:610132"
                     /translation="
MDTESTYSGYSYYSSHSKKSHRQGERTRERHKSPRNKDGRGSEKSVTIQPPTGEPLLGNDSTRTEEVQDDNWGETTTAITGTSEHSISQEDIARISKDMEDSVGLDCKRYLGLTVASFLGLLVFLTPIAFILLPPILWRDELEPCGTICEGLFISMAFKLLILLIGTWALFFRKRRADMPRVFVFRALLLVLIFLFVVSYWLFYGVRILDSRDRNYQGIVQYAVSLVDALLFIHYLAIVLLELRQLQPMFTLQVVRSTDGESRFYSLGHLSIQRAALVVLENYYKDFTIYNPNLLTASKFRAAKHMAGLKVYNVDGPSNNATGQSRAMIAAAARRRDSSHNELYYEEAEHERRVKKRKARLVVAVEEAFIHIQRLQAEEQQKAPGEVMDPREAAQAIFPSMARALQKYLRITRQQNYHSMESILQHLAFCITNGMTPKAFLERYLSAGPTLQYDKDRWLSTQWRLVSDEAVTNGLRDGIVFVLKCLDFSLVVNVKKIPFIILSEEFIDPKSHKFVLRLQSETSV
"
     misc_feature    282..1787
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="Strabismus protein; Region: Strabismus; pfam06638"
                     /db_xref="CDD:148316"
     misc_feature    567..629
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    669..731
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    762..824
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    882..944
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     variation       251
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371629555"
     variation       282
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374630481"
     exon            287..419
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       288
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734296"
     variation       292
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143990097"
     variation       313
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78535164"
     variation       315
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372052239"
     variation       318
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375505955"
     variation       319
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369543626"
     variation       329
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201840785"
     variation       366
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200391853"
     exon            420..1027
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       446
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186509771"
     variation       453
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139472200"
     variation       460
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371028647"
     variation       463
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146695372"
     variation       464
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146495414"
     STS             480..1479
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="Vangl1"
                     /db_xref="UniSTS:532467"
     variation       484
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374024136"
     variation       489
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143196463"
     variation       500
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140451005"
     variation       522
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147048524"
     variation       527
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146723580"
     variation       538
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141673853"
     variation       545
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41275546"
     variation       557
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141525464"
     variation       558
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370292117"
     variation       560
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79828493"
     variation       561
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4839469"
     variation       612
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141482063"
     variation       620
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200325939"
     variation       650
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34768472"
     variation       697
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201871883"
     variation       707
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372165510"
     variation       725
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368383358"
     variation       732
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200535188"
     variation       733
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148341022"
     variation       738
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142594314"
     variation       739
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201441696"
     variation       752
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201493360"
     variation       761
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143094973"
     variation       791
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146175997"
     variation       841
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201593132"
     variation       855
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143395094"
     variation       864
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373384296"
     variation       896
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201698322"
     variation       900
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143956994"
     variation       929
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376477305"
     variation       930
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918218"
     variation       935
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200762200"
     variation       959
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148388816"
     variation       967
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630629"
     variation       980
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722418"
     variation       981
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199932833"
     variation       995
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373473714"
     variation       1002
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377435467"
     variation       1022
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200039235"
     exon            1028..1161
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1036
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918219"
     variation       1053
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370403671"
     variation       1062
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139744440"
     variation       1083
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145309218"
     variation       1099
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77983133"
     variation       1100
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201705477"
     variation       1111
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142348368"
     variation       1117
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373814054"
     variation       1136
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148965020"
     variation       1154
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367774972"
     exon            1162..1294
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1175
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143754434"
     variation       1192
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141396495"
     variation       1198
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121918220"
     variation       1216
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368071458"
     variation       1219
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199526468"
     variation       1228
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74117015"
     variation       1239
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137860752"
     variation       1255
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34059106"
     variation       1256
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149279018"
     variation       1265
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147220426"
     exon            1295..1529
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1342
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200389969"
     variation       1381
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151256445"
     variation       1382
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376015336"
     variation       1387
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140485834"
     variation       1394
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370067272"
     variation       1404
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373242373"
     variation       1412
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376174821"
     variation       1447
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369450463"
     variation       1461
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146596086"
     variation       1473
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189584852"
     variation       1514
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145137292"
     variation       1515
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143016040"
     exon            1530..8635
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1542
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371428273"
     variation       1555
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148199776"
     variation       1556
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150326572"
     STS             1593..1743
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75371"
                     /db_xref="UniSTS:73877"
     variation       1659
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143622439"
     variation       1685
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199542978"
     variation       1706..1707
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34903463"
     variation       1706
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200739468"
     variation       1744
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375459125"
     variation       1749
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140596381"
     variation       1764
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184905686"
     variation       1765
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148512517"
     variation       1798
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377233845"
     variation       1813
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202050152"
     variation       1814..1815
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:151052987"
     variation       1835
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376792729"
     variation       1837
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190792695"
     variation       1873
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811013"
     variation       1906
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147518221"
     variation       2007
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299565"
     variation       2008
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183938394"
     variation       2023
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188834002"
     variation       2076
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140372918"
     variation       2090
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41310108"
     variation       2091
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193075321"
     variation       2103
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811012"
     variation       2173
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75277108"
     variation       2206
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811011"
     variation       2211
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183137974"
     variation       2266
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187145225"
     variation       2295
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6700610"
     variation       2484
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41312690"
     variation       2512
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191916791"
     variation       2712
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142123586"
     variation       2814
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1140940"
     variation       2833
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150705915"
     variation       2843
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184219889"
     variation       2898
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189281695"
     variation       2973
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200424846"
     variation       2973
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:3841008"
     variation       3033
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192418098"
     variation       3067
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3204955"
     variation       3186
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185557879"
     variation       3305
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139030532"
     variation       3335
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117337677"
     STS             3385..3576
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH26190"
                     /db_xref="UniSTS:84486"
     variation       3415
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376483138"
     variation       3417
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149888685"
     STS             3439..3563
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75372"
                     /db_xref="UniSTS:59289"
     variation       3442
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146512242"
     variation       3478
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374184679"
     variation       3531
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199831777"
     variation       3538
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143344734"
     variation       3539
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3811010"
     variation       3541
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3811009"
     variation       3562
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114033235"
     variation       3564..3565
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:374697813"
     variation       3672
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190492027"
     STS             3705..3892
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH102185"
                     /db_xref="UniSTS:96519"
     variation       3718
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374222902"
     variation       3799
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181543393"
     variation       3833
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117021"
     variation       3911
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184469057"
     variation       3949
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376302608"
     variation       3976
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230119"
     variation       3977
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146730302"
     polyA_signal    4079..4084
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      4102
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       4119
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188964296"
     variation       4126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148944333"
     variation       4141
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12121158"
     variation       4279
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299571"
     variation       4326
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377292403"
     variation       4371
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811008"
     variation       4434
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372511903"
     variation       4464
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181039153"
     variation       4655
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114921471"
     variation       4813
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10923204"
     variation       4867
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185557143"
     variation       4913
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143712039"
     variation       4940
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148126079"
     variation       4947
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114196858"
     variation       5046
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374942113"
     variation       5090
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190894422"
     variation       5125
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732172"
     variation       5126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732170"
     variation       5167
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367988126"
     variation       5169
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797707"
     variation       5171
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797708"
     variation       5174
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181008715"
     variation       5199
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140931431"
     variation       5207
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76160883"
     variation       5286
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4839472"
     variation       5312
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78917287"
     variation       5334
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117023"
     variation       5388
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187286147"
     variation       5443
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146435279"
     variation       5457
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1128100"
     variation       5532
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:115376031"
     variation       5549..5552
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="aaac"
                     /db_xref="dbSNP:144395099"
     STS             5590..5784
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="D1S3610"
                     /db_xref="UniSTS:66759"
     variation       5609
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139328749"
     STS             5679..5853
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH70098"
                     /db_xref="UniSTS:69412"
     variation       5735
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192127758"
     variation       5846
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183004818"
     variation       5855
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187382548"
     polyA_signal    5859..5864
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5878
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:138659832"
     polyA_site      5880
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5892
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369489322"
     variation       6004
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112297385"
     variation       6009
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190660373"
     variation       6036
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501140"
     variation       6126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113030671"
     variation       6137
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138485279"
     variation       6202
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149626166"
     variation       6268
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034226"
     variation       6294
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034228"
     variation       6420
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58002309"
     variation       6519
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182580560"
     variation       6521
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144489409"
     variation       6542
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370211174"
     variation       6578
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148437823"
     variation       6720
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377056964"
     variation       6743
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369257328"
     variation       6798
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:117347999"
     variation       6825
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188051509"
     variation       7056
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034230"
     variation       7057
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75064936"
     variation       7070
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148451859"
     variation       7076
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192672583"
     variation       7118
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184529007"
     variation       7158
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10494179"
     variation       7212
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189009112"
     variation       7234
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142497673"
     variation       7256
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192325588"
     variation       7286..7289
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:111232035"
     variation       7418
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374395998"
     variation       7423
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4348723"
     variation       7507
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145945936"
     variation       7532
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371583408"
     variation       7541
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10801933"
     variation       7594
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76569370"
     variation       7598
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184708484"
     variation       7631
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4548441"
     variation       7646
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188827143"
     variation       7785
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4595366"
     variation       7816
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6428677"
     variation       7918
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181588954"
     variation       7989
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811007"
     variation       8002
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3811006"
     variation       8027
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184820374"
     variation       8106
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139953261"
     variation       8111
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77318780"
     variation       8203
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189697580"
     variation       8233
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7414259"
     STS             8387..8568
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH99220"
                     /db_xref="UniSTS:85528"
     variation       8399
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375912178"
     variation       8511
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17034249"
     variation       8546..8547
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5777244"
     variation       8552..8553
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:369126863"
     variation       8554..8555
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:67579944"
     polyA_signal    8614..8619
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      8632
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
ORIGIN      
ctcgctcacaaaaaattgagccggccctggaggcctggggggcgagtccggttgcgcctcggagagcgcaacaggcagaatttgttcctgttgaagagtggctcctcttctaatttccagactccttgaggttttaggagtctggtaggtgaaattttctacctctaaggagaaacagtacctgctccttcctcaagcgcaagccctccattgctatggataccgaatccacttattctggatattcttactattcaagtcattcgaaaaaatctcacagacaaggggaaagaactagagagagacacaagtcaccccggaataaagacggcagagggtcagaaaagtctgtcaccattcaacctcccactggagagcccctgttgggaaatgattctactcggacagaggaagttcaggatgacaactggggagagaccaccacggccatcacaggcacctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatggaggacagcgtggggctggattgcaaacgctacctgggcctcaccgtcgcctcttttcttggacttctagttttcctcacccctattgccttcatccttttacctccgatcctgtggagggatgagctggagccttgtggcacaatttgtgaggggctctttatctccatggcattcaaactcctcattctgctcatagggacctgggcactttttttccgcaagcggagagctgacatgccacgggtgtttgtgtttcgtgcccttttgttggtcctcatctttctctttgtggtttcctattggcttttttacggggtccgcattttggactctcgggaccggaattaccagggcattgtgcaatatgcagtctcccttgtggatgccctcctcttcatccattacctggccatcgtcctgctggagctcaggcagctgcagcccatgttcacgctgcaggtggtccgctccaccgatggcgagtcccgcttctacagcctgggacacctgagtatccagcgagcagcattggtggtcctagaaaattactacaaagatttcaccatctataacccaaacctcctaacagcctccaaattccgagcagccaagcatatggccgggctgaaagtctacaatgtagatggccccagtaacaatgccactggccagtcccgggccatgattgctgcagctgctcggcgcagggactcaagccacaacgagttgtattatgaagaggccgaacatgaacggcgagtaaagaagcggaaagcaaggctggtggttgcagtggaagaggccttcatccacattcagcgtctccaggctgaggagcagcagaaagccccaggggaggtgatggaccctagggaggccgcccaggccattttcccctccatggccagggctctccagaagtacctgcgcatcacccggcagcagaactaccacagcatggagagcatcctgcagcacctggccttctgcatcaccaacggcatgacccccaaggccttcctagaacggtacctcagtgcgggccccaccctgcaatatgacaaggaccgctggctctctacacagtggaggcttgtcagtgatgaggctgtgactaatggattacgggatggaattgtgttcgtccttaagtgcttggacttcagcctcgtagtcaatgtgaagaaaattccattcatcatactctctgaagagttcatagaccccaaatctcacaaatttgtccttcgcttacagtctgagacatccgtttaaaagttctatatttgtggctttattaaaaaaaaaagaaaaatatatagagagatatatatctatgccagaggggtgtcttttttaaaaattcttcttcattgctgactgaaactggcagatgattgaccagtatcctttgaccatctgcactttatttggaaggaagcaggggctgtccaccctgaaaaagagtgactgatgacatctgacttttgtcgatgggacttctcaagaagccattccttggagcttctgttacagctgtaaaccaaagtggagctggtgcttcttgggagcctcgccttacaactaattcctgcctttcgtccagtaccaagtcccccgttgcttctggtcagcccacttgtagacttccaggggacacatctttattctgtttcaggaaaccagtcacgacacgtccacatatgtatttgtgtatgttaatgtccagtatcacatcacccatgaaagtcgtgggcagttcaggagatacctgccttcatctttgttctttgttgccttaggttcttcagagaaagatcacaacaaaaaatgtacactgtcgtttacagctattaagtgatttgattttgtttttttcccaaagagaaaacctacctgccctgtttctgatcccacccctctgctggcttgaagcaggtaaccctttcccagccctgcagctgcccacctggcctccatgccatcctgcccccacctggctggcagccctggctctccatgtgtgccctccggctctgtgtgaagcctcaagtcagtcccagcattgtttccatagggaagtgtggggtgcccagcaggtaaagcacagggagagagggcagtgggaatgccacctttaggctgcagcaggagccccacactgcccagttttcctccccactgttctacaccaaccaggggagactaacactgtgactctgggattggcaggtgcaacttggagccacttaatttcctggggacgtaagttcttcccaagcttagagcaagctgccctgccaaaggagaccaaaccatgccaaccacgctggcaactgctgctgtccagtccctgtgttttctgaccaccgtcactgtgcaactcatcgcctctgccacttaggaccaggaaagaggctggttttgctcccactcttagttgctgataaagtggggagaaggaaaatggacactctacagagtttggggaagggagagtagggagcccatcttgtccagaaagattcatctgtggtctgtctgttaaacacagctgatttcagtgggctttcccctggccctgggggagcagacactgactgggttgtgggcagaggagccatcctggcggagccctgctgcaggggagctccttcaggagccccatccggacctcttgcactgggctgcctttgcctccatttgccttcctgtatctgcaacaaaccttttaaaagtgttcactcttgctttttccagtatttcggtaatcagccatcttgctgtagtacaggatgacattgtcgaatgctctttgtatgtgtgcacacccccttactcccttactgcttcatacactccacaagtggtacagtattttgtgtcattgtaaaaatcaaaattggctttggatctttgtaatacacctgtacctgaaaaagtaaacaacattcttcaattactagccttcagcttgaaaagacatgctggagaagaaggaagggggaacccataggtgtggcgtggagccaagatgtactattcaactatgtgtttctgtttataaaaaacacataccatggaaccatggtgcttttgttcttagtttttgccgttagatcccttcaaactggaagttccttacaatatctttctcaggaaatattttgggaaatggggtaagagatggcaagtgtgagacgggctgtgtcagaggttgctacgtcatggatacagtgcagttccaagtgccataagtgtatgtacatatagttaataatgacactgttcatcaccattctaaaatactgttcttccaaccctatcttcaatgaccagtccagaaggggttaagctggattcatttgctctggcatgtgcattcccagcagggtgaagaaaggtttaaattaaagaatttattttctctctcccccttcctctttctcccagtctttgcataggagaatgttagacattcagaaattactgtttctgttttaaattgagtattgatttttttatattgactttgtattgagttctttttgaaagaataacaaaataaaatgcaggatctttgtaaagcctttgcactttcaacctctttatagcttgagttacttttgcagtgggaacaatgtaaatgacatttaaaagatttaaggtttcagaaagctgcatcccacaattgaacacaatgcatttttatttcaattcttggaactggtaggctattctttttaaaagggggtaaacttcgccctaaggctggtagaatgtatgttcacattatagtagacaggatttcatttgccttatatgtttatagattttttataattttcatcctacgttattaaaattagagcattgagtgttaaagaacttaatgaggagtctatatctgagattgctctcttccctggtgatgttttaactggtagataatttgttcttaaatatgtacttttgaagataggacagtttttatagtccatgaactgaatgttaaaaagttctgtatgcattctcagagaggattttaaagctatatagttcatccatcctttgcattatcaaaatgttaagtcaaatctgtaatactttggctaaaattcataaagtaagccctagagaaaatacttgaccaccaaatttttgcccaactatcatcacctcccttcccccgcctctgttcttgccttttgacatctacatggaagacaagttctttacagcaaatggtaagaggcaggtgacctggtgtgtttgctgtgttgtagttcattgcctggggcttgggactccttttttaatggagagactagctgtgcaggtgtgtgttggatagggataaagtgctcacccctgccctctctacagtagttggtggtagatttctctctcattttgcctcataatcactttcgagtgcatgtatttacctaagggctgtagctctgtgggatgctaccagcatattggactgacagaaattgattaccttgccactccaacctacgtactgagtgagtgctccagccactcagtgaaaccaacaaaagtgagtccttggtttaccttccaatctgggtcctgctgtgtaagtatccctaagtggggatgcatatttgtttgtgcgtttttatttccatatatgtgagcatttctctgagtgtattaccagacggatagcacatttatatgtcagacatcttaacatctgtgttatctgtagcaggtgtgtagctcagcagatacgtgtcattgtgtatatagctgagtgtgtgagggtgtctgtgtttctgcagtcccctgtgtttgagagatgacttaataaccctgtgttttgagaggtcgctctaaaccagtgacttttccctcccctgctttattcctttccctcactgacactggcttctcccgctagagtaaatggctttagcacagcactgtcttctggggagcctgctgtcctgcaggcaagtccattaaactctttcttgctttaggactctgaaaacagcaagaaacaaacaaacaaaggtcaagctctaagaaaattactgctcaaacttcactaccctggaagccttactagatatttcttaaggtaacttaaaaattgggctttatttttaaaaagtgataggttacttacagtagcacagaaatgttagcatatttatttaaatagtcctgcagcagagaccctgcgattgtaaagtgatttaagtatttctgggtagtgtttgtgatttacggatttgttactgaaaaacaaaaaaatcactactgtgaatttactactatgtaaccttgtggtcgtatttcattataaataaaataagaattgctcttctgcccaccgttcttgattggtattcagtgcagtagcgaaatgagatagtttagacactgttgaaataactgcattgagctttaaccaagtgtatgctcagaaaattcagttttggatcacattttgacaaaacatgttttggtcaaagaaaggaaaggctactaacacatttatcaggtaatgtatgtcacagtccgtgttccacccagccttgttatccccacattctttcaagataggagtcatcttggtttttcgggtgaaaaacggaaggtcagagaggaaggggcttgtccaaggtctcatgtctggttaacagaatttcaaactagatgtttgattctaacccctcagtccactgtaccttgaagtatggtctaaatgattcggcacttctggatgttgaggaaggacctagagacacatccttgaactagaacctggggtgagagttcattgggaggcaggatctcttctttcactttggatttacaccttgtcccttggaaagcttctccactatgctagcaaatatcttaggatatttgatggaaagaacttgagaatcccttctggaaaacccagcctttcagtgttaacacctgctgcaagacagggatgctgttgttctggcagcccccctttgcttttgcctggccccaccttctgctcccactctgctggcttgggcaagatgcgtgccttgggccttgggtgcagggaggcaggcaggggcttgacctggcctctctctggtgccatggcaacattatgccccaaacttcttccctggttggagtgagaggggctgtccacagccccatcctgtggggatctcaagccggagtccctggcctggcctccttgacgtaggtgttctcagcaagcagtttgcatcccaccgtctttctcacacttgcccccaagacttttgacagagcagacgtaaaacaggactcagaaaaccatttttctctgttcccatatgtagtaagttttgattcagttgtgcataaaccatagttttctgccctgctgtttgctttcaatggaagacagtaaagggaagatggtgctcacatctctccatgtgacatctcattaggaattaagatgcgatggattagaaatgtaaaacttcagaataaaattaaatttcagggctctataagtcccgttttcccaggtcctgttccgtttctacgtagataacccaatttgttttgtctatgaaataagcctctttagtgggttgttttagtctctccaacaaaagagcagattcctaaagccaggtgcagcactgtgaaaagtttctttcaatatggcaccaagactctaccatttatgtctctctcagcttacaaacatcagcgttttgtccttgtcatagtggaagaaagacacttactttaagctttggggacaaaggtgacaaaccccaggcttttatcttaaaagtgtctttggcacttcttttggcactgaaatggtatttgggaagcattatttgaatgtacagttgtttggttttgtatgtgcttatctttatctgagctttcacttgtagacatggccttttgttgtgaagttgctcatcatttaggagtgtttaattctaaaaagccttcagcctaagaaagcttcatctgtggggaccagagacttgttgctcagggagttagtgatgggacttgggcatctgatctgcaggtgacaagtttagttcaactgaagttgtagggaatttagacagttgcacatcattgccgttctaggggccttgtagaaagatgaaacagttgtttttcatttaccagcacctctcagttatagaggtaatggaacattcgcttacttttcatcatcattctttaaaaagggaacatacaaaaatctaaactatggcaataatttatttttataatagtttacggtaggctttaattaaatggcaaactcctctgggacccctaagttatggcgtgattagccaaatttgatttccaacagtcatttatggccataactattgcatagagtgcaggatgccagcaaagatgagggtgggggcagatactggctcagtgatttaactcacattatagatgaccccttcctcaacagaaatgctactgagagaaccagagaggcctgggccaggcaggtcttatttgagaggagattatttgataattgctttggttagaaggactttacatttcctgatttcaagtccagcaccaatttagaaagttcagagatgaaaccacctgtctttacctgacagagtcataacggtttgtgtaaaaatgtggtcagggaccttttttgttctttctgattagttaatactgtacattgtaaccaggaggggcagttttgccaaccagcctctgctcatggtcaccatatgtgtatgacaaggcctgagtgagttcctgcataaactgggtagtgggctcttttgacacatttgcaagcatgtaaatgaatgaatgacactaccagcaaccatctgtacaggtccatttacttacattcataaggtttatgctatgaaacttcttctcattgtgatgtcagtaacagagttagtgtctctgatggaatagtgtacctgtcacccaagttattttgttcctttttgggtcctccagtataatccccccctcatcccaattaactgtaaaatgttttacacatcacattttttatactgtaaacttggaaaataaactgaaatatcaaattg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:81839 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:81839 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:81839 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.