GGRNA Home | Help | Advanced search

2019-03-23 03:28:30, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001172411            8685 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens VANGL planar cell polarity protein 1 (VANGL1),
            transcript variant 3, mRNA.
ACCESSION   NM_001172411
VERSION     NM_001172411.1  GI:289547193
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8685)
  AUTHORS   Anastas,J.N., Biechele,T.L., Robitaille,M., Muster,J.,
            Allison,K.H., Angers,S. and Moon,R.T.
  TITLE     A protein complex of SCRIB, NOS1AP and VANGL1 regulates cell
            polarity and migration, and is associated with breast cancer
            progression
  JOURNAL   Oncogene 31 (32), 3696-3708 (2012)
   PUBMED   22179838
  REMARK    GeneRIF: NOS1AP colocalizes with both SCRIB and VANGL1 along
            cellular protrusions in metastatic breast cancer cells, but does
            not colocalize with either SCRIB or VANGL1 at cell junctions in
            normal breast cells
REFERENCE   2  (bases 1 to 8685)
  AUTHORS   Lee,S., Song,Y.A., Park,Y.L., Cho,S.B., Lee,W.S., Lee,J.H.,
            Chung,I.J., Kim,K.K., Rew,J.S. and Joo,Y.E.
  TITLE     Expression of KITENIN in human colorectal cancer and its relation
            to tumor behavior and progression
  JOURNAL   Pathol. Int. 61 (4), 210-220 (2011)
   PUBMED   21418393
  REMARK    GeneRIF: KITENIN is associated with human colorectal cancer
            progression including invasion and metastasis.
REFERENCE   3  (bases 1 to 8685)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Apuzzo,S. and Gros,P.
  TITLE     Transmembrane topology of mammalian planar cell polarity protein
            Vangl1
  JOURNAL   Biochemistry 50 (12), 2274-2282 (2011)
   PUBMED   21291170
  REMARK    GeneRIF: a compact membrane-associated portion with very short
            predicted extra- and intracellular loops, while the protein harbors
            a large intracellular domain
REFERENCE   4  (bases 1 to 8685)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Kibar,Z. and Gros,P.
  TITLE     Loss of membrane targeting of Vangl proteins causes neural tube
            defects
  JOURNAL   Biochemistry 50 (5), 795-804 (2011)
   PUBMED   21142127
  REMARK    GeneRIF: Loss of membrane targeting of Vangl1 and Vangl2 proteins
            causes neural tube defects.
REFERENCE   5  (bases 1 to 8685)
  AUTHORS   Ryu,H.S., Park,Y.L., Park,S.J., Lee,J.H., Cho,S.B., Lee,W.S.,
            Chung,I.J., Kim,K.K., Lee,K.H., Kweon,S.S. and Joo,Y.E.
  TITLE     KITENIN is associated with tumor progression in human gastric
            cancer
  JOURNAL   Anticancer Res. 30 (9), 3479-3486 (2010)
   PUBMED   20944126
  REMARK    GeneRIF: KITENIN plays an important role in human gastric cancer
            progression by AP-1 activation.
REFERENCE   6  (bases 1 to 8685)
  AUTHORS   Kalabis,J., Rosenberg,I. and Podolsky,D.K.
  TITLE     Vangl1 protein acts as a downstream effector of intestinal trefoil
            factor (ITF)/TFF3 signaling and regulates wound healing of
            intestinal epithelium
  JOURNAL   J. Biol. Chem. 281 (10), 6434-6441 (2006)
   PUBMED   16410243
  REMARK    GeneRIF: VANGL protein may serve as an effector mediating the
            intestinal trefoil factor (ITF) healing response of the intestinal
            mucosa.
REFERENCE   7  (bases 1 to 8685)
  AUTHORS   Doudney,K., Ybot-Gonzalez,P., Paternotte,C., Stevenson,R.E.,
            Greene,N.D., Moore,G.E., Copp,A.J. and Stanier,P.
  TITLE     Analysis of the planar cell polarity gene Vangl2 and its
            co-expressed paralogue Vangl1 in neural tube defect patients
  JOURNAL   Am. J. Med. Genet. A 136 (1), 90-92 (2005)
   PUBMED   15952208
  REMARK    Erratum:[Am J Med Genet A. 2005 Nov 1;138(4):415]
REFERENCE   8  (bases 1 to 8685)
  AUTHORS   Lee,J.H., Park,S.R., Chay,K.O., Seo,Y.W., Kook,H., Ahn,K.Y.,
            Kim,Y.J. and Kim,K.K.
  TITLE     KAI1 COOH-terminal interacting tetraspanin (KITENIN), a member of
            the tetraspanin family, interacts with KAI1, a tumor metastasis
            suppressor, and enhances metastasis of cancer
  JOURNAL   Cancer Res. 64 (12), 4235-4243 (2004)
   PUBMED   15205336
REFERENCE   9  (bases 1 to 8685)
  AUTHORS   Yagyu,R., Hamamoto,R., Furukawa,Y., Okabe,H., Yamamura,T. and
            Nakamura,Y.
  TITLE     Isolation and characterization of a novel human gene, VANGL1, as a
            therapeutic target for hepatocellular carcinoma
  JOURNAL   Int. J. Oncol. 20 (6), 1173-1178 (2002)
   PUBMED   12011995
REFERENCE   10 (bases 1 to 8685)
  AUTHORS   Katoh,M.
  TITLE     Molecular cloning and characterization of Strabismus 2 (STB2)
  JOURNAL   Int. J. Oncol. 20 (5), 993-998 (2002)
   PUBMED   11956595
  REMARK    GeneRIF: Molecular cloning and characterization of Strabismus 2
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BM146608.1, AF481859.1 and
            AL450389.12.
            
            Summary: This gene encodes a member of the tretraspanin family. The
            encoded protein may be involved in mediating intestinal trefoil
            factor induced wound healing in the intestinal mucosa. Mutations in
            this gene are associated with neural tube defects. Alternate
            splicing results in multiple transcript variants. [provided by
            RefSeq, Feb 2010].
            
            Transcript Variant: This variant (3) uses an alternate in-frame
            splice site in the coding region, compared to variant 1. The
            encoded isoform (2) is shorter, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF481859.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025085 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-38                BM146608.1         2-39
            39-1877             AF481859.1         1-1839
            1878-8685           AL450389.12        54841-61648
FEATURES             Location/Qualifiers
     source          1..8685
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p13.1"
     gene            1..8685
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="VANGL planar cell polarity protein 1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="MIM:610132"
     exon            1..134
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       46
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116216703"
     variation       48
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191609592"
     exon            135..342
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       157
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181583261"
     misc_feature    206..208
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="upstream in-frame stop codon"
     variation       217
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371591397"
     variation       234
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78368849"
     variation       240
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371100144"
     variation       243
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375618149"
     variation       254
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185393860"
     CDS             272..1840
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="isoform 2 is encoded by transcript variant 3;
                     strabismus 2; KAI1 C-terminal interacting tetraspanin;
                     vang-like protein 1; van Gogh-like protein 1; loop-tail
                     protein 2 homolog; vang-like 1 (van gogh, Drosophila)"
                     /codon_start=1
                     /product="vang-like protein 1 isoform 2"
                     /protein_id="NP_001165882.1"
                     /db_xref="GI:289547194"
                     /db_xref="CCDS:CCDS53350.1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="MIM:610132"
                     /translation="
MDTESTYSGYSYYSSHSKKSHRQGERTRERHKSPRNKDGRGSEKSVTIQPPTGEPLLGNDSTRTEEDDNWGETTTAITGTSEHSISQEDIARISKDMEDSVGLDCKRYLGLTVASFLGLLVFLTPIAFILLPPILWRDELEPCGTICEGLFISMAFKLLILLIGTWALFFRKRRADMPRVFVFRALLLVLIFLFVVSYWLFYGVRILDSRDRNYQGIVQYAVSLVDALLFIHYLAIVLLELRQLQPMFTLQVVRSTDGESRFYSLGHLSIQRAALVVLENYYKDFTIYNPNLLTASKFRAAKHMAGLKVYNVDGPSNNATGQSRAMIAAAARRRDSSHNELYYEEAEHERRVKKRKARLVVAVEEAFIHIQRLQAEEQQKAPGEVMDPREAAQAIFPSMARALQKYLRITRQQNYHSMESILQHLAFCITNGMTPKAFLERYLSAGPTLQYDKDRWLSTQWRLVSDEAVTNGLRDGIVFVLKCLDFSLVVNVKKIPFIILSEEFIDPKSHKFVLRLQSETSV
"
     misc_feature    338..1837
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="Strabismus protein; Region: Strabismus; pfam06638"
                     /db_xref="CDD:148316"
     misc_feature    617..679
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    719..781
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    812..874
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    932..994
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     variation       307
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371629555"
     variation       338
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374630481"
     exon            343..469
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       344
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734296"
     variation       348
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143990097"
     variation       369
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78535164"
     variation       371
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372052239"
     variation       374
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375505955"
     variation       375
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369543626"
     variation       385
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201840785"
     variation       422
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200391853"
     exon            470..1077
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       496
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186509771"
     variation       503
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139472200"
     variation       510
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371028647"
     variation       513
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146695372"
     variation       514
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146495414"
     STS             530..1529
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="Vangl1"
                     /db_xref="UniSTS:532467"
     variation       534
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374024136"
     variation       539
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143196463"
     variation       550
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140451005"
     variation       572
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147048524"
     variation       577
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146723580"
     variation       588
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141673853"
     variation       595
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41275546"
     variation       607
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141525464"
     variation       608
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370292117"
     variation       610
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79828493"
     variation       611
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4839469"
     variation       662
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141482063"
     variation       670
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200325939"
     variation       700
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34768472"
     variation       747
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201871883"
     variation       757
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372165510"
     variation       775
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368383358"
     variation       782
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200535188"
     variation       783
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148341022"
     variation       788
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142594314"
     variation       789
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201441696"
     variation       802
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201493360"
     variation       811
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143094973"
     variation       841
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146175997"
     variation       891
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201593132"
     variation       905
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143395094"
     variation       914
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373384296"
     variation       946
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201698322"
     variation       950
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143956994"
     variation       979
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376477305"
     variation       980
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918218"
     variation       985
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200762200"
     variation       1009
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148388816"
     variation       1017
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630629"
     variation       1030
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722418"
     variation       1031
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199932833"
     variation       1045
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373473714"
     variation       1052
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377435467"
     variation       1072
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200039235"
     exon            1078..1211
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1086
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918219"
     variation       1103
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370403671"
     variation       1112
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139744440"
     variation       1133
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145309218"
     variation       1149
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77983133"
     variation       1150
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201705477"
     variation       1161
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142348368"
     variation       1167
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373814054"
     variation       1186
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148965020"
     variation       1204
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367774972"
     exon            1212..1344
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1225
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143754434"
     variation       1242
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141396495"
     variation       1248
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121918220"
     variation       1266
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368071458"
     variation       1269
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199526468"
     variation       1278
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74117015"
     variation       1289
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137860752"
     variation       1305
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34059106"
     variation       1306
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149279018"
     variation       1315
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147220426"
     exon            1345..1579
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1392
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200389969"
     variation       1431
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151256445"
     variation       1432
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376015336"
     variation       1437
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140485834"
     variation       1444
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370067272"
     variation       1454
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373242373"
     variation       1462
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376174821"
     variation       1497
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369450463"
     variation       1511
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146596086"
     variation       1523
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189584852"
     variation       1564
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145137292"
     variation       1565
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143016040"
     exon            1580..8685
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1592
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371428273"
     variation       1605
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148199776"
     variation       1606
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150326572"
     STS             1643..1793
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75371"
                     /db_xref="UniSTS:73877"
     variation       1709
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143622439"
     variation       1735
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199542978"
     variation       1756..1757
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34903463"
     variation       1756
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200739468"
     variation       1794
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375459125"
     variation       1799
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140596381"
     variation       1814
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184905686"
     variation       1815
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148512517"
     variation       1848
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377233845"
     variation       1863
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202050152"
     variation       1864..1865
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:151052987"
     variation       1885
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376792729"
     variation       1887
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190792695"
     variation       1923
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811013"
     variation       1956
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147518221"
     variation       2057
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299565"
     variation       2058
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183938394"
     variation       2073
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188834002"
     variation       2126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140372918"
     variation       2140
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41310108"
     variation       2141
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193075321"
     variation       2153
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811012"
     variation       2223
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75277108"
     variation       2256
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811011"
     variation       2261
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183137974"
     variation       2316
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187145225"
     variation       2345
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6700610"
     variation       2534
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41312690"
     variation       2562
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191916791"
     variation       2762
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142123586"
     variation       2864
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1140940"
     variation       2883
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150705915"
     variation       2893
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184219889"
     variation       2948
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189281695"
     variation       3023
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200424846"
     variation       3023
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:3841008"
     variation       3083
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192418098"
     variation       3117
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3204955"
     variation       3236
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185557879"
     variation       3355
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139030532"
     variation       3385
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117337677"
     STS             3435..3626
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH26190"
                     /db_xref="UniSTS:84486"
     variation       3465
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376483138"
     variation       3467
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149888685"
     STS             3489..3613
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75372"
                     /db_xref="UniSTS:59289"
     variation       3492
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146512242"
     variation       3528
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374184679"
     variation       3581
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199831777"
     variation       3588
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143344734"
     variation       3589
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3811010"
     variation       3591
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3811009"
     variation       3612
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114033235"
     variation       3614..3615
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:374697813"
     variation       3722
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190492027"
     STS             3755..3942
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH102185"
                     /db_xref="UniSTS:96519"
     variation       3768
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374222902"
     variation       3849
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181543393"
     variation       3883
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117021"
     variation       3961
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184469057"
     variation       3999
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376302608"
     variation       4026
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230119"
     variation       4027
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146730302"
     polyA_signal    4129..4134
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      4152
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       4169
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188964296"
     variation       4176
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148944333"
     variation       4191
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12121158"
     variation       4329
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299571"
     variation       4376
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377292403"
     variation       4421
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811008"
     variation       4484
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372511903"
     variation       4514
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181039153"
     variation       4705
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114921471"
     variation       4863
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10923204"
     variation       4917
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185557143"
     variation       4963
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143712039"
     variation       4990
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148126079"
     variation       4997
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114196858"
     variation       5096
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374942113"
     variation       5140
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190894422"
     variation       5175
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732172"
     variation       5176
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732170"
     variation       5217
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367988126"
     variation       5219
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797707"
     variation       5221
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797708"
     variation       5224
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181008715"
     variation       5249
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140931431"
     variation       5257
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76160883"
     variation       5336
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4839472"
     variation       5362
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78917287"
     variation       5384
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117023"
     variation       5438
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187286147"
     variation       5493
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146435279"
     variation       5507
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1128100"
     variation       5582
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:115376031"
     variation       5599..5602
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="aaac"
                     /db_xref="dbSNP:144395099"
     STS             5640..5834
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="D1S3610"
                     /db_xref="UniSTS:66759"
     variation       5659
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139328749"
     STS             5729..5903
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH70098"
                     /db_xref="UniSTS:69412"
     variation       5785
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192127758"
     variation       5896
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183004818"
     variation       5905
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187382548"
     polyA_signal    5909..5914
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5928
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:138659832"
     polyA_site      5930
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5942
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369489322"
     variation       6054
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112297385"
     variation       6059
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190660373"
     variation       6086
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501140"
     variation       6176
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113030671"
     variation       6187
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138485279"
     variation       6252
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149626166"
     variation       6318
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034226"
     variation       6344
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034228"
     variation       6470
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58002309"
     variation       6569
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182580560"
     variation       6571
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144489409"
     variation       6592
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370211174"
     variation       6628
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148437823"
     variation       6770
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377056964"
     variation       6793
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369257328"
     variation       6848
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:117347999"
     variation       6875
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188051509"
     variation       7106
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034230"
     variation       7107
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75064936"
     variation       7120
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148451859"
     variation       7126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192672583"
     variation       7168
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184529007"
     variation       7208
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10494179"
     variation       7262
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189009112"
     variation       7284
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142497673"
     variation       7306
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192325588"
     variation       7336..7339
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:111232035"
     variation       7468
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374395998"
     variation       7473
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4348723"
     variation       7557
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145945936"
     variation       7582
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371583408"
     variation       7591
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10801933"
     variation       7644
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76569370"
     variation       7648
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184708484"
     variation       7681
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4548441"
     variation       7696
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188827143"
     variation       7835
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4595366"
     variation       7866
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6428677"
     variation       7968
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181588954"
     variation       8039
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811007"
     variation       8052
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3811006"
     variation       8077
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184820374"
     variation       8156
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139953261"
     variation       8161
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77318780"
     variation       8253
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189697580"
     variation       8283
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7414259"
     STS             8437..8618
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH99220"
                     /db_xref="UniSTS:85528"
     variation       8449
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375912178"
     variation       8561
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17034249"
     variation       8596..8597
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5777244"
     variation       8602..8603
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:369126863"
     variation       8604..8605
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:67579944"
     polyA_signal    8664..8669
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      8682
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
ORIGIN      
aggaagcggaaagcagcagtgcagcggcggcggcggcggggctctgcctctccaggagcccagcgcaggccgcagagccggggccgctgtgagccgagaccgcgggccgcggagctcgggcggccggcgcggagaatttgttcctgttgaagagtggctcctcttctaatttccagactccttgaggttttaggagtctggtaggtgaaattttctacctctaaggagaaacagtacctgctccttcctcaagcgcaagccctccattgctatggataccgaatccacttattctggatattcttactattcaagtcattcgaaaaaatctcacagacaaggggaaagaactagagagagacacaagtcaccccggaataaagacggcagagggtcagaaaagtctgtcaccattcaacctcccactggagagcccctgttgggaaatgattctactcggacagaggaagatgacaactggggagagaccaccacggccatcacaggcacctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatggaggacagcgtggggctggattgcaaacgctacctgggcctcaccgtcgcctcttttcttggacttctagttttcctcacccctattgccttcatccttttacctccgatcctgtggagggatgagctggagccttgtggcacaatttgtgaggggctctttatctccatggcattcaaactcctcattctgctcatagggacctgggcactttttttccgcaagcggagagctgacatgccacgggtgtttgtgtttcgtgcccttttgttggtcctcatctttctctttgtggtttcctattggcttttttacggggtccgcattttggactctcgggaccggaattaccagggcattgtgcaatatgcagtctcccttgtggatgccctcctcttcatccattacctggccatcgtcctgctggagctcaggcagctgcagcccatgttcacgctgcaggtggtccgctccaccgatggcgagtcccgcttctacagcctgggacacctgagtatccagcgagcagcattggtggtcctagaaaattactacaaagatttcaccatctataacccaaacctcctaacagcctccaaattccgagcagccaagcatatggccgggctgaaagtctacaatgtagatggccccagtaacaatgccactggccagtcccgggccatgattgctgcagctgctcggcgcagggactcaagccacaacgagttgtattatgaagaggccgaacatgaacggcgagtaaagaagcggaaagcaaggctggtggttgcagtggaagaggccttcatccacattcagcgtctccaggctgaggagcagcagaaagccccaggggaggtgatggaccctagggaggccgcccaggccattttcccctccatggccagggctctccagaagtacctgcgcatcacccggcagcagaactaccacagcatggagagcatcctgcagcacctggccttctgcatcaccaacggcatgacccccaaggccttcctagaacggtacctcagtgcgggccccaccctgcaatatgacaaggaccgctggctctctacacagtggaggcttgtcagtgatgaggctgtgactaatggattacgggatggaattgtgttcgtccttaagtgcttggacttcagcctcgtagtcaatgtgaagaaaattccattcatcatactctctgaagagttcatagaccccaaatctcacaaatttgtccttcgcttacagtctgagacatccgtttaaaagttctatatttgtggctttattaaaaaaaaaagaaaaatatatagagagatatatatctatgccagaggggtgtcttttttaaaaattcttcttcattgctgactgaaactggcagatgattgaccagtatcctttgaccatctgcactttatttggaaggaagcaggggctgtccaccctgaaaaagagtgactgatgacatctgacttttgtcgatgggacttctcaagaagccattccttggagcttctgttacagctgtaaaccaaagtggagctggtgcttcttgggagcctcgccttacaactaattcctgcctttcgtccagtaccaagtcccccgttgcttctggtcagcccacttgtagacttccaggggacacatctttattctgtttcaggaaaccagtcacgacacgtccacatatgtatttgtgtatgttaatgtccagtatcacatcacccatgaaagtcgtgggcagttcaggagatacctgccttcatctttgttctttgttgccttaggttcttcagagaaagatcacaacaaaaaatgtacactgtcgtttacagctattaagtgatttgattttgtttttttcccaaagagaaaacctacctgccctgtttctgatcccacccctctgctggcttgaagcaggtaaccctttcccagccctgcagctgcccacctggcctccatgccatcctgcccccacctggctggcagccctggctctccatgtgtgccctccggctctgtgtgaagcctcaagtcagtcccagcattgtttccatagggaagtgtggggtgcccagcaggtaaagcacagggagagagggcagtgggaatgccacctttaggctgcagcaggagccccacactgcccagttttcctccccactgttctacaccaaccaggggagactaacactgtgactctgggattggcaggtgcaacttggagccacttaatttcctggggacgtaagttcttcccaagcttagagcaagctgccctgccaaaggagaccaaaccatgccaaccacgctggcaactgctgctgtccagtccctgtgttttctgaccaccgtcactgtgcaactcatcgcctctgccacttaggaccaggaaagaggctggttttgctcccactcttagttgctgataaagtggggagaaggaaaatggacactctacagagtttggggaagggagagtagggagcccatcttgtccagaaagattcatctgtggtctgtctgttaaacacagctgatttcagtgggctttcccctggccctgggggagcagacactgactgggttgtgggcagaggagccatcctggcggagccctgctgcaggggagctccttcaggagccccatccggacctcttgcactgggctgcctttgcctccatttgccttcctgtatctgcaacaaaccttttaaaagtgttcactcttgctttttccagtatttcggtaatcagccatcttgctgtagtacaggatgacattgtcgaatgctctttgtatgtgtgcacacccccttactcccttactgcttcatacactccacaagtggtacagtattttgtgtcattgtaaaaatcaaaattggctttggatctttgtaatacacctgtacctgaaaaagtaaacaacattcttcaattactagccttcagcttgaaaagacatgctggagaagaaggaagggggaacccataggtgtggcgtggagccaagatgtactattcaactatgtgtttctgtttataaaaaacacataccatggaaccatggtgcttttgttcttagtttttgccgttagatcccttcaaactggaagttccttacaatatctttctcaggaaatattttgggaaatggggtaagagatggcaagtgtgagacgggctgtgtcagaggttgctacgtcatggatacagtgcagttccaagtgccataagtgtatgtacatatagttaataatgacactgttcatcaccattctaaaatactgttcttccaaccctatcttcaatgaccagtccagaaggggttaagctggattcatttgctctggcatgtgcattcccagcagggtgaagaaaggtttaaattaaagaatttattttctctctcccccttcctctttctcccagtctttgcataggagaatgttagacattcagaaattactgtttctgttttaaattgagtattgatttttttatattgactttgtattgagttctttttgaaagaataacaaaataaaatgcaggatctttgtaaagcctttgcactttcaacctctttatagcttgagttacttttgcagtgggaacaatgtaaatgacatttaaaagatttaaggtttcagaaagctgcatcccacaattgaacacaatgcatttttatttcaattcttggaactggtaggctattctttttaaaagggggtaaacttcgccctaaggctggtagaatgtatgttcacattatagtagacaggatttcatttgccttatatgtttatagattttttataattttcatcctacgttattaaaattagagcattgagtgttaaagaacttaatgaggagtctatatctgagattgctctcttccctggtgatgttttaactggtagataatttgttcttaaatatgtacttttgaagataggacagtttttatagtccatgaactgaatgttaaaaagttctgtatgcattctcagagaggattttaaagctatatagttcatccatcctttgcattatcaaaatgttaagtcaaatctgtaatactttggctaaaattcataaagtaagccctagagaaaatacttgaccaccaaatttttgcccaactatcatcacctcccttcccccgcctctgttcttgccttttgacatctacatggaagacaagttctttacagcaaatggtaagaggcaggtgacctggtgtgtttgctgtgttgtagttcattgcctggggcttgggactccttttttaatggagagactagctgtgcaggtgtgtgttggatagggataaagtgctcacccctgccctctctacagtagttggtggtagatttctctctcattttgcctcataatcactttcgagtgcatgtatttacctaagggctgtagctctgtgggatgctaccagcatattggactgacagaaattgattaccttgccactccaacctacgtactgagtgagtgctccagccactcagtgaaaccaacaaaagtgagtccttggtttaccttccaatctgggtcctgctgtgtaagtatccctaagtggggatgcatatttgtttgtgcgtttttatttccatatatgtgagcatttctctgagtgtattaccagacggatagcacatttatatgtcagacatcttaacatctgtgttatctgtagcaggtgtgtagctcagcagatacgtgtcattgtgtatatagctgagtgtgtgagggtgtctgtgtttctgcagtcccctgtgtttgagagatgacttaataaccctgtgttttgagaggtcgctctaaaccagtgacttttccctcccctgctttattcctttccctcactgacactggcttctcccgctagagtaaatggctttagcacagcactgtcttctggggagcctgctgtcctgcaggcaagtccattaaactctttcttgctttaggactctgaaaacagcaagaaacaaacaaacaaaggtcaagctctaagaaaattactgctcaaacttcactaccctggaagccttactagatatttcttaaggtaacttaaaaattgggctttatttttaaaaagtgataggttacttacagtagcacagaaatgttagcatatttatttaaatagtcctgcagcagagaccctgcgattgtaaagtgatttaagtatttctgggtagtgtttgtgatttacggatttgttactgaaaaacaaaaaaatcactactgtgaatttactactatgtaaccttgtggtcgtatttcattataaataaaataagaattgctcttctgcccaccgttcttgattggtattcagtgcagtagcgaaatgagatagtttagacactgttgaaataactgcattgagctttaaccaagtgtatgctcagaaaattcagttttggatcacattttgacaaaacatgttttggtcaaagaaaggaaaggctactaacacatttatcaggtaatgtatgtcacagtccgtgttccacccagccttgttatccccacattctttcaagataggagtcatcttggtttttcgggtgaaaaacggaaggtcagagaggaaggggcttgtccaaggtctcatgtctggttaacagaatttcaaactagatgtttgattctaacccctcagtccactgtaccttgaagtatggtctaaatgattcggcacttctggatgttgaggaaggacctagagacacatccttgaactagaacctggggtgagagttcattgggaggcaggatctcttctttcactttggatttacaccttgtcccttggaaagcttctccactatgctagcaaatatcttaggatatttgatggaaagaacttgagaatcccttctggaaaacccagcctttcagtgttaacacctgctgcaagacagggatgctgttgttctggcagcccccctttgcttttgcctggccccaccttctgctcccactctgctggcttgggcaagatgcgtgccttgggccttgggtgcagggaggcaggcaggggcttgacctggcctctctctggtgccatggcaacattatgccccaaacttcttccctggttggagtgagaggggctgtccacagccccatcctgtggggatctcaagccggagtccctggcctggcctccttgacgtaggtgttctcagcaagcagtttgcatcccaccgtctttctcacacttgcccccaagacttttgacagagcagacgtaaaacaggactcagaaaaccatttttctctgttcccatatgtagtaagttttgattcagttgtgcataaaccatagttttctgccctgctgtttgctttcaatggaagacagtaaagggaagatggtgctcacatctctccatgtgacatctcattaggaattaagatgcgatggattagaaatgtaaaacttcagaataaaattaaatttcagggctctataagtcccgttttcccaggtcctgttccgtttctacgtagataacccaatttgttttgtctatgaaataagcctctttagtgggttgttttagtctctccaacaaaagagcagattcctaaagccaggtgcagcactgtgaaaagtttctttcaatatggcaccaagactctaccatttatgtctctctcagcttacaaacatcagcgttttgtccttgtcatagtggaagaaagacacttactttaagctttggggacaaaggtgacaaaccccaggcttttatcttaaaagtgtctttggcacttcttttggcactgaaatggtatttgggaagcattatttgaatgtacagttgtttggttttgtatgtgcttatctttatctgagctttcacttgtagacatggccttttgttgtgaagttgctcatcatttaggagtgtttaattctaaaaagccttcagcctaagaaagcttcatctgtggggaccagagacttgttgctcagggagttagtgatgggacttgggcatctgatctgcaggtgacaagtttagttcaactgaagttgtagggaatttagacagttgcacatcattgccgttctaggggccttgtagaaagatgaaacagttgtttttcatttaccagcacctctcagttatagaggtaatggaacattcgcttacttttcatcatcattctttaaaaagggaacatacaaaaatctaaactatggcaataatttatttttataatagtttacggtaggctttaattaaatggcaaactcctctgggacccctaagttatggcgtgattagccaaatttgatttccaacagtcatttatggccataactattgcatagagtgcaggatgccagcaaagatgagggtgggggcagatactggctcagtgatttaactcacattatagatgaccccttcctcaacagaaatgctactgagagaaccagagaggcctgggccaggcaggtcttatttgagaggagattatttgataattgctttggttagaaggactttacatttcctgatttcaagtccagcaccaatttagaaagttcagagatgaaaccacctgtctttacctgacagagtcataacggtttgtgtaaaaatgtggtcagggaccttttttgttctttctgattagttaatactgtacattgtaaccaggaggggcagttttgccaaccagcctctgctcatggtcaccatatgtgtatgacaaggcctgagtgagttcctgcataaactgggtagtgggctcttttgacacatttgcaagcatgtaaatgaatgaatgacactaccagcaaccatctgtacaggtccatttacttacattcataaggtttatgctatgaaacttcttctcattgtgatgtcagtaacagagttagtgtctctgatggaatagtgtacctgtcacccaagttattttgttcctttttgggtcctccagtataatccccccctcatcccaattaactgtaaaatgttttacacatcacattttttatactgtaaacttggaaaataaactgaaatatcaaattg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:81839 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:81839 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:81839 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.