GGRNA Home | Help | Advanced search

2024-04-19 16:47:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001172335            3246 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens plastin 3 (PLS3), transcript variant 3, mRNA.
ACCESSION   NM_001172335
VERSION     NM_001172335.1  GI:288915538
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3246)
  AUTHORS   Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
            Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
            Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
            Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
            Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
  TITLE     Plastin3 is a novel marker for circulating tumor cells undergoing
            the epithelial-mesenchymal transition and is associated with
            colorectal cancer prognosis
  JOURNAL   Cancer Res. 73 (7), 2059-2069 (2013)
   PUBMED   23378342
  REMARK    GeneRIF: Overexpression of PLS3 is associated with
            epithelial-mesenchymal transition and is associated with metastasis
            in colorectal cancer
REFERENCE   2  (bases 1 to 3246)
  AUTHORS   Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
  TITLE     Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
            combination for reliable Sezary syndrome diagnosis
  JOURNAL   Blood 121 (8), 1477-1478 (2013)
   PUBMED   23429988
  REMARK    GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
            efficient molecular Sezary syndrome diagnosis.
REFERENCE   3  (bases 1 to 3246)
  AUTHORS   Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
  TITLE     FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
            actin fringe
  JOURNAL   Plant Cell 24 (11), 4539-4554 (2012)
   PUBMED   23150633
REFERENCE   4  (bases 1 to 3246)
  AUTHORS   Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
            Bagot,M., Whittaker,S.J. and Mitchell,T.J.
  TITLE     Regulation of T-plastin expression by promoter hypomethylation in
            primary cutaneous T-cell lymphoma
  JOURNAL   J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
   PUBMED   22495182
  REMARK    GeneRIF: PLS3 is expressed in the majority of SS patients and
            provide insight into the molecular regulation of PLS3 expression in
            CTCL
REFERENCE   5  (bases 1 to 3246)
  AUTHORS   Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
            Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
            Michel,L.
  TITLE     Inducible expression and pathophysiologic functions of T-plastin in
            cutaneous T-cell lymphoma
  JOURNAL   Blood 120 (1), 143-154 (2012)
   PUBMED   22627769
  REMARK    GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
            from Sezary syndrome patients and plays a role for cell survival
            and migration.
REFERENCE   6  (bases 1 to 3246)
  AUTHORS   Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
  TITLE     Functional differences between L- and T-plastin isoforms
  JOURNAL   J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
   PUBMED   7806577
REFERENCE   7  (bases 1 to 3246)
  AUTHORS   Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
  TITLE     Human plastin genes. Comparative gene structure, chromosome
            location, and differential expression in normal and neoplastic
            cells
  JOURNAL   J. Biol. Chem. 268 (4), 2781-2792 (1993)
   PUBMED   8428952
REFERENCE   8  (bases 1 to 3246)
  AUTHORS   Lin,C.S., Aebersold,R.H. and Leavitt,J.
  TITLE     Correction of the N-terminal sequences of the human plastin
            isoforms by using anchored polymerase chain reaction:
            identification of a potential calcium-binding domain
  JOURNAL   Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
   PUBMED   2378651
REFERENCE   9  (bases 1 to 3246)
  AUTHORS   Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
  TITLE     Molecular cloning and characterization of plastin, a human
            leukocyte protein expressed in transformed human fibroblasts
  JOURNAL   Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
   PUBMED   3211125
REFERENCE   10 (bases 1 to 3246)
  AUTHORS   Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
  TITLE     Abundant synthesis of the transformation-induced protein of
            neoplastic human fibroblasts, plastin, in normal lymphocytes
  JOURNAL   Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
   PUBMED   4053036
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC357886.1, AK298530.1,
            AL589842.5 and AC005000.2.
            
            Summary: Plastins are a family of actin-binding proteins that are
            conserved throughout eukaryote evolution and expressed in most
            tissues of higher eukaryotes. In humans, two ubiquitous plastin
            isoforms (L and T) have been identified. Plastin 1 (otherwise known
            as Fimbrin) is a third distinct plastin isoform which is
            specifically expressed at high levels in the small intestine. The L
            isoform is expressed only in hemopoietic cell lineages, while the T
            isoform has been found in all other normal cells of solid tissues
            that have replicative potential (fibroblasts, endothelial cells,
            epithelial cells, melanocytes, etc.). The C-terminal 570 amino
            acids of the T-plastin and L-plastin proteins are 83% identical. It
            contains a potential calcium-binding site near the N terminus.
            Alternate splicing results in multiple transcript
            variants.[provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and uses
            an alternate in-frame splice site in the coding region, compared to
            variant 1. The encoded isoform (2) is shorter than isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK298530.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025083 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-12                DC357886.1         1-12
            13-373              AK298530.1         1-361
            374-374             AL589842.5         32282-32282
            375-2300            AK298530.1         363-2288
            2301-3246           AC005000.2         18281-19226
FEATURES             Location/Qualifiers
     source          1..3246
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq23"
     gene            1..3246
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="plastin 3"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="MIM:300131"
     exon            1..126
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       9
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12847396"
     variation       92
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370675011"
     exon            127..207
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    132..134
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="upstream in-frame stop codon"
     CDS             135..1946
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="isoform 2 is encoded by transcript variant 3; T
                     fimbrin; plastin-3; T plastin"
                     /codon_start=1
                     /product="plastin-3 isoform 2"
                     /protein_id="NP_001165806.1"
                     /db_xref="GI:288915539"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="MIM:300131"
                     /translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
     misc_feature    423..770
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(423..428,432..440,447..449,456..458,654..659,
                     666..668,675..677,681..683,726..731,738..743,747..752,
                     759..764)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    855..1187
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(855..860,864..872,879..881,888..890,1074..1079,
                     1086..1088,1095..1097,1101..1103,1143..1148,1155..1160,
                     1164..1169,1176..1181)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1260..1568
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1260..1262,1269..1271,1278..1280,1452..1457,
                     1464..1466,1476..1478,1482..1484,1527..1532,1539..1544,
                     1548..1553,1560..1565)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1614..1931
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1617..1625,1632..1634,1641..1643,1821..1826,
                     1833..1835,1842..1844,1848..1850,1890..1895,1902..1907,
                     1911..1916,1923..1928)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     exon            208..290
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       209
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150018375"
     variation       220
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145235506"
     exon            291..420
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       374
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140121121"
     variation       377
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144784703"
     variation       416
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147957783"
     exon            421..553
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       489
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141907957"
     variation       521
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143815252"
     variation       524
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151153004"
     exon            554..635
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     exon            636..801
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       693
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367830488"
     variation       704
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112589137"
     variation       741
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371332791"
     variation       775
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375187925"
     exon            802..944
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       803
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376568367"
     variation       929
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249162"
     variation       930
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914417"
     exon            945..1040
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       945
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202076515"
     variation       978
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140968059"
     variation       1011
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137917062"
     variation       1027
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142569974"
     exon            1041..1236
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1103
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113204501"
     variation       1154
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1859671"
     exon            1237..1315
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1245
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377411857"
     variation       1247
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138662773"
     variation       1263
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201842598"
     variation       1295
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2108099"
     variation       1298
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144592792"
     variation       1315
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370999829"
     exon            1316..1430
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1328
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148514983"
     variation       1347
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:871774"
     exon            1431..1564
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1433
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75219193"
     variation       1472
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140768895"
     variation       1529
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35211005"
     exon            1565..1688
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1571
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35525703"
     variation       1598
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140069545"
     variation       1599
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199893556"
     variation       1649
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372389185"
     variation       1651
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377191528"
     variation       1668
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150069454"
     variation       1681
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191246889"
     exon            1689..1813
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1714
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181782110"
     variation       1785
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149142111"
     variation       1793
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145393426"
     exon            1814..3246
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1945
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369448909"
     variation       1986
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373177061"
     variation       1997
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376407795"
     variation       2162
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184318952"
     variation       2330
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144589761"
     variation       2590
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11551495"
     variation       2662
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370865892"
     variation       2838
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373978498"
     polyA_signal    3036..3041
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     polyA_site      3057
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     variation       3088
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376902216"
     variation       3168
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148073444"
ORIGIN      
gacttgctctctaaagttgcaattgtaagaagaatgttgggtttccagattgctcttctgggcgtgggagaaggttctgtctatcagtgctgcgagaaaggaaagaaacaagtttgctctcagcggatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaaatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.